ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Mice  (531)
  • Rats  (432)
  • American Association for the Advancement of Science (AAAS)  (875)
  • Springer  (33)
  • American Chemical Society (ACS)
  • Periodicals Archive Online (PAO)
  • 1985-1989  (905)
  • 1965-1969  (3)
Collection
Publisher
  • American Association for the Advancement of Science (AAAS)  (875)
  • Springer  (33)
  • American Chemical Society (ACS)
  • Periodicals Archive Online (PAO)
Years
Year
  • 1
    Publication Date: 1989-04-14
    Description: Previous studies have demonstrated that allelic deletions of the short arm of chromosome 17 occur in over 75% of colorectal carcinomas. Twenty chromosome 17p markers were used to localize the common region of deletion in these tumors to a region contained within bands 17p12 to 17p13.3. This region contains the gene for the transformation-associated protein p53. Southern and Northern blot hybridization experiments provided no evidence for gross alterations of the p53 gene or surrounding sequences. As a more rigorous test of the possibility that p53 was a target of the deletions, the p53 coding regions from two tumors were analyzed; these two tumors, like most colorectal carcinomas, had allelic deletions of chromosome 17p and expressed considerable amounts of p53 messenger RNA from the remaining allele. The remaining p53 allele was mutated in both tumors, with an alanine substituted for valine at codon 143 of one tumor and a histidine substituted for arginine at codon 175 of the second tumor. Both mutations occurred in a highly conserved region of the p53 gene that was previously found to be mutated in murine p53 oncogenes. The data suggest that p53 gene mutations may be involved in colorectal neoplasia, perhaps through inactivation of a tumor suppressor function of the wild-type p53 gene.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Baker, S J -- Fearon, E R -- Nigro, J M -- Hamilton, S R -- Preisinger, A C -- Jessup, J M -- vanTuinen, P -- Ledbetter, D H -- Barker, D F -- Nakamura, Y -- White, R -- Vogelstein, B -- GM07184/GM/NIGMS NIH HHS/ -- GM07309/GM/NIGMS NIH HHS/ -- HD20619/HD/NICHD NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):217-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Oncology Center, Johns Hopkins University School of Medicine, Baltimore, MD 21231.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2649981" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Chromosome Deletion ; *Chromosomes, Human, Pair 17/ultrastructure ; Colorectal Neoplasms/*genetics ; Humans ; Mice ; Mice, Nude ; *Mutation ; Neoplasm Proteins/*genetics ; Nucleic Acid Hybridization ; Oncogenes ; Phosphoproteins/*genetics ; Suppression, Genetic ; Tumor Suppressor Protein p53
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-05
    Description: Tumor promoters may bring about events that lead to neoplastic transformation by inducing specific promotion-relevant effector genes. Functional activation of the transacting transcription factor AP-1 by the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) may play an essential role in this process. Clonal genetic variants of mouse epidermal JB6 cells that are genetically susceptible (P+) or resistant (P-) to promotion of transformation by TPA were transfected with 3XTRE-CAT, a construct that has AP-1 cis-enhancer sequences attached to a reporter gene encoding chloramphenicol acetyltransferase (CAT). Transfected JB6 P+, but not P- variants, showed TPA-inducible CAT synthesis. Epidermal growth factor, another transformation promoter in JB6 cells, also caused P+ specific induction of CAT gene expression. These results demonstrate an association between induced AP-1 function and sensitivity to promotion of neoplastic transformation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bernstein, L R -- Colburn, N H -- New York, N.Y. -- Science. 1989 May 5;244(4904):566-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Johns Hopkins University, Department of Biology, Baltimore, MD 21218.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541502" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Chloramphenicol O-Acetyltransferase/genetics ; Cloning, Molecular ; DNA-Binding Proteins/genetics/*physiology ; Epidermal Growth Factor/pharmacology ; Epidermis ; Gene Expression Regulation ; Genetic Variation ; Kinetics ; Mice ; Nucleic Acid Hybridization ; Plasmids ; Promoter Regions, Genetic ; Proto-Oncogene Proteins ; Proto-Oncogene Proteins c-jun ; Simplexvirus/genetics ; Tetradecanoylphorbol Acetate/*pharmacology ; Transcription Factors/genetics/*physiology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    Publication Date: 1989-06-23
    Description: Although the T cell receptor (TCR) alpha beta heterodimer and its encoding genes have been characterized, a cell-free form of this receptor, which is needed for the study of functional or ligand-binding properties of the receptor, has not previously been isolated. When the cell-free supernatant products of activated cloned T helper (TH) cells were found to mediate helper activity with antigen specificity identical to that of intact T cells, experiments were carried out to determine whether this functional activity was mediated by a cell-free form of TCR-related material. A disulfide-linked dimer indistinguishable from the T cell surface alpha beta heterodimer was precipitated from cell-free supernatants of cloned TH cells with F23.1, a monoclonal antibody specific for a TCR V beta 8 determinant. Moreover, when cell-free TH products were bound to and eluted from immobilized F23.1, these affinity-purified materials had antigen-specific and major histocompatibility complex-restricted helper activity that synergized with recombinant lymphokines in the generation of B cell antibody responses. These findings suggest that the factor isolated from T cell supernatants is a cell-free form of the TCR alpha beta dimer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Guy, R -- Ullrich, S J -- Foo-Philips, M -- Hathcock, K S -- Appella, E -- Hodes, R J -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1477-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Experimental Immunology Branch, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472009" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Antigens/*immunology ; B-Lymphocytes/immunology ; Disulfides ; Epitopes/immunology ; Hemocyanin/immunology ; Histocompatibility Antigens/immunology ; Immunoglobulin G/immunology ; Immunosorbent Techniques ; Interleukin-2/pharmacology ; Interleukin-4 ; Interleukins/pharmacology ; Lymphocyte Activation ; Macromolecular Substances ; Mice ; Molecular Weight ; Receptors, Antigen, T-Cell/*immunology/isolation & purification ; Recombinant Proteins ; Serum Albumin, Bovine/immunology ; T-Lymphocytes, Helper-Inducer/*immunology ; Trinitrobenzenes/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 1989-12-22
    Description: The murine acquired immunodeficiency syndrome is induced by a defective retrovirus. To study the role of virus replication in this disease, helper-free stocks of defective Duplan virus were produced. These stocks were highly pathogenic in absence of detectable replicating murine leukemia viruses (MuLVs) other than xenotropic MuLV. They induced expansion of the infected cell population (over 1000-fold), and this cell expansion was oligoclonal in origin and, most likely, arose through cell division. These results suggest that this defective virus is oncogenic, inducing a primary neoplasia associated with an acquired immunodeficiency syndrome as a paraneoplastic syndrome. These data emphasize the need to determine whether virus replication is necessary for the progression of other immunodeficiency diseases, including acquired immunodeficiency syndrome, and whether these diseases also represent paraneoplastic syndromes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huang, M -- Simard, C -- Jolicoeur, P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1614-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Biology, Clinical Research Institute of Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Southern ; Cells, Cultured ; DNA, Viral/isolation & purification ; Defective Viruses/isolation & purification/*pathogenicity ; Helper Viruses/isolation & purification ; Immunologic Deficiency Syndromes/*microbiology ; Leukemia Virus, Murine/pathogenicity ; Lymph Nodes/microbiology ; Lymphocytes/microbiology ; Mice ; Mice, Inbred C57BL ; RNA-Directed DNA Polymerase/analysis ; Retroviridae/isolation & purification/*pathogenicity ; Retroviridae Infections/*microbiology ; Spleen/microbiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    Publication Date: 1989-12-08
    Description: A novel bacteriophage lambda vector system was used to express in Escherichia coli a combinatorial library of Fab fragments of the mouse antibody repertoire. The system allows rapid and easy identification of monoclonal Fab fragments in a form suitable for genetic manipulation. It was possible to generate, in 2 weeks, large numbers of monoclonal Fab fragments against a transition state analog hapten. The methods described may supersede present-day hybridoma technology and facilitate the production of catalytic and other antibodies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huse, W D -- Sastry, L -- Iverson, S A -- Kang, A S -- Alting-Mees, M -- Burton, D R -- Benkovic, S J -- Lerner, R A -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531466" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal/*biosynthesis/genetics ; Antibody Specificity ; Antigen-Antibody Reactions ; Bacteriophage lambda/*genetics ; Base Sequence ; Cloning, Molecular/methods ; Escherichia coli/genetics ; Gene Amplification ; Gene Library ; *Genetic Vectors ; Hemocyanin/analogs & derivatives/immunology ; Immunoglobulin Fab Fragments/biosynthesis ; Immunoglobulin Fragments/*biosynthesis/genetics ; Mice ; Molecular Sequence Data ; Organophosphorus Compounds/immunology ; Recombinant Proteins/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-03
    Description: Monoclonal antibodies have been induced that are capable of catalyzing specific hydrolysis of the Gly-Phe bond of peptide substrates at neutral pH with a metal complex cofactor. The antibodies were produced by immunizing with a Co(III) triethylenetetramine (trien)-peptide hapten. These antibodies as a group are capable of binding trien complexes of not only Co(III) but also of numerous other metals. Six peptides were examined as possible substrates with the antibodies and various metal complexes. Two of these peptides were cleaved by several of the antibodies. One antibody was studied in detail, and cleavage was observed for the substrates with the trien complexes of Zn(II), Ga(III), Fe(III), In(III), Cu(II), Ni(II), Lu(III), Mg(II), or Mn(II) as cofactors. A turnover number of 6 x 10(-4) per second was observed for these substrates. These results demonstrate the feasibility of the use of cofactor-assisted catalysis in an antibody binding site to accomplish difficult chemical transformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Iverson, B L -- Lerner, R A -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1184-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922606" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; *Antibodies, Monoclonal ; Antigens/immunology ; Binding Sites, Antibody ; Catalysis ; Chemical Phenomena ; Chemistry ; Cobalt/immunology/metabolism ; Glycine/metabolism ; Haptens/immunology ; Hydrogen-Ion Concentration ; Hydrolysis ; Immunization ; Metals/metabolism ; Mice ; Molecular Sequence Data ; Molecular Structure ; Oligopeptides/*metabolism ; Phenylalanine/metabolism ; Trientine/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-04-28
    Description: The specific hydrolysis of unactivated esters bearing an R or S enantiomeric alcohol has been achieved by two separate classes of catalytic antibodies induced to bind either the R or S substrates. The antibodies exhibit rate accelerations (10(3) to 10(5] above background hydrolysis that, coupled with their antipodal specificity, provide a novel set of reagents for use in synthesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Janda, K D -- Benkovic, S J -- Lerner, R A -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):437-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2717936" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Antibodies, Monoclonal/immunology ; Antibody Specificity ; Antigens/immunology ; Benzyl Alcohols/metabolism ; *Catalysis ; Esters/metabolism ; Haptens ; Hemocyanin/immunology ; Hydrolysis ; Immunization ; Kinetics ; Lipase/*metabolism ; Mice ; Mice, Inbred A ; Molecular Structure ; Organophosphonates/immunology ; Stereoisomerism ; Substrate Specificity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    Publication Date: 1989-05-12
    Description: Although the immunologic role of T cells bearing the conventional alpha beta T cell receptor (TCR) has been well characterized, little is known about the function of the population of T cells bearing the gamma delta TCR. Therefore, the role of gamma delta T cells in the immune response to Mycobacterium tuberculosis (MT) was investigated. The number of TCR gamma delta cells in the draining lymph nodes of mice immunized with MT was greatly increased in comparison with the number of TCR alpha beta cells. Three biochemically distinct gamma delta TCRs were detected. Analyses of cell cycle, of interleukin-2 receptor expression, and of interleukin-2 responsiveness showed that a large proportion of the gamma delta T cells were activated in vivo. TCR gamma delta cells responded to solubilized MT antigens in vitro but, in contrast to MT-specific alpha beta T cells, the response of gamma delta T cells to MT did not require major histocompatability complex class II recognition. These results provide an example of antigen-specific activation of gamma delta T cells in vivo and indicate that gamma delta T cells may have a distinct role in generating a primary immune response to certain microorganisms.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Janis, E M -- Kaufmann, S H -- Schwartz, R H -- Pardoll, D M -- New York, N.Y. -- Science. 1989 May 12;244(4905):713-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Immunology, National Institutes of Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2524098" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/*immunology ; Antigens, CD3 ; Antigens, CD8 ; Antigens, Differentiation, T-Lymphocyte/analysis ; Cell Count ; Cell Cycle ; Electrophoresis, Polyacrylamide Gel ; Flow Cytometry ; Histocompatibility Antigens Class II/immunology ; Immunosorbent Techniques ; Interleukin-2/pharmacology ; Lymph Nodes/cytology ; *Lymphocyte Activation ; Macromolecular Substances ; Mice ; Mycobacterium tuberculosis/*immunology ; Receptors, Antigen, T-Cell/analysis/*immunology ; Receptors, Interleukin-2/metabolism ; T-Lymphocytes/cytology/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    Publication Date: 1989-09-15
    Description: Gene targeting via homologous recombination-mediated disruption in murine embryonic stem (ES) cells has been described for a number of different genes expressed in these cells; it has not been reported for any nonexpressed genes. Pluripotent stem cell lines were isolated with homologously recombined insertions at three different loci: c-fos, which is expressed at a low level in ES cells, and two genes, adipsin and adipocyte P2 (aP2), which are transcribed specifically in adipose cells and are not expressed at detectable levels in ES cells. The frequencies at which homologous recombination events occurred did not correlate with levels of expression of the targeted genes, but did occur at rates comparable to those previously reported for genes that are actively expressed in ES cells. Injection of successfully targeted cells into mouse blastocysts resulted in the formation of chimeric mice. These studies demonstrate the feasibility of altering genes in ES cells that are expressed in a tissue-specific manner in the mouse, in order to study their function at later developmental stages.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R S -- Sheng, M -- Greenberg, M E -- Kolodner, R D -- Papaioannou, V E -- Spiegelman, B M -- DK 31405/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1234-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506639" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/cytology ; Animals ; Blotting, Northern ; Blotting, Southern ; Carrier Proteins/biosynthesis/*genetics ; Cell Line ; Chimera ; Complement Factor D ; DNA, Recombinant ; DNA-Binding Proteins/biosynthesis/genetics ; Fatty Acid-Binding Proteins ; Fatty Acids/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; *Neoplasm Proteins ; *Nerve Tissue Proteins ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-fos ; RNA, Messenger/biosynthesis/genetics ; *Recombination, Genetic ; Serine Endopeptidases/*genetics ; Stem Cells/*metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    Publication Date: 1989-06-02
    Description: Neurotransmitter receptors are usually restricted to neuronal cells, but the signaling pathways activated by these receptors are widely distributed in both neural and non-neural cells. The functional consequences of activating a brain-specific neurotransmitter receptor, the serotonin 5HT1c receptor, in the unnatural environment of a fibroblast were examined. Introduction of functional 5HT1c receptors into NIH 3T3 cells results, at high frequency, in the generation of transformed foci. Moreover, the generation and maintenance of transformed foci requires continued activation of the serotonin receptor. In addition, the injection of cells derived from transformed foci into nude mice results in the generation of tumors. The serotonin 5HT1c receptor therefore functions as a protooncogene when expressed in NIH 3T3 fibroblasts.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Julius, D -- Livelli, T J -- Jessell, T M -- Axel, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1057-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, College of Physicians and Surgeons, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727693" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcium/pharmacology ; Cell Division ; Cell Line ; *Cell Transformation, Neoplastic ; Cloning, Molecular ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Receptors, Serotonin/*genetics/physiology ; Second Messenger Systems ; Serotonin/pharmacology/physiology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    Publication Date: 1989-12-22
    Description: A human acute lymphoblastic leukemia (ALL) cell line that was transplanted into immune-deficient SCID mice proliferated in the hematopoietic tissues, invaded various organs, and led to the death of the mice. The distribution of leukemic cells in SCID mice was similar to the course of the disease in children. A-1 cells marked with a retrovirus vector showed clonal evolution after the transplant. SCID mice that were injected with bone marrow from three patients with non-T ALL had leukemic cells in their bone marrow and spleen. This in vivo model of human leukemia is an approach to understanding leukemic growth and progression and is a novel system for testing new treatment strategies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kamel-Reid, S -- Letarte, M -- Sirard, C -- Doedens, M -- Grunberger, T -- Fulop, G -- Freedman, M H -- Phillips, R A -- Dick, J E -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1597-600.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595371" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/pathology ; Cell Line ; Clone Cells ; DNA, Neoplasm/isolation & purification ; Humans ; Immunologic Deficiency Syndromes/*pathology ; Kidney/pathology ; Liver/pathology ; Mice ; Mice, Mutant Strains ; Neoplasm Transplantation ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/*pathology ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    Publication Date: 1989-03-10
    Description: Antisense RNA-mediated inhibition of gene expression was used to investigate the biological function of the c-raf-1 gene in a radiation-resistant human squamous carcinoma cell line, SQ-20B. S1 nuclease protection assays revealed that transfection of full-length raf complementary DNA in the antisense orientation (AS) leads to a specific reduction (greater than tenfold) of steady-state levels of the endogenous c-raf-1 sense (S) transcript in SQ-20B cells. In nude mice, the malignant potential of SQ-20B cells transfected with raf (S) was significantly increased relative to that of SQ-20B cells transfected with raf (AS). SQ-20B cells containing transfected raf (S) maintained a radiation-resistant phenotype as compared to those cells harboring the AS version, which appeared to have enhanced radiation sensitivity. These data indicate that the reduced expression of endogenous c-raf-1 is sufficient to modulate the tumorigenicity and the radiation-resistant phenotype of SQ-20B cells, thus implicating c-raf-1 in a pathway important to the genesis of this type of cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kasid, U -- Pfeifer, A -- Brennan, T -- Beckett, M -- Weichselbaum, R R -- Dritschilo, A -- Mark, G E -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1354-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiation Medicine, Vincent T. Lombardi Comprehensive Cancer Research Center, Georgetown University Medical Center, Washington 20007.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466340" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Southern ; Carcinoma, Squamous Cell/*genetics ; Cell Line ; Cell Survival/*radiation effects ; Clone Cells ; Dose-Response Relationship, Radiation ; *Gene Expression Regulation ; Humans ; Kinetics ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Nucleic Acid Hybridization ; *Proto-Oncogenes ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors ; Transcription, Genetic ; Transfection ; Transplantation, Heterologous ; Tumor Cells, Cultured/*radiation effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    Publication Date: 1989-02-17
    Description: Mouse 3T3 cell lines capable of constitutively synthesizing an RNA complementary to the messenger RNA encoding TIMP, tissue inhibitor of metalloproteinases, were constructed by transfection with appropriate plasmid constructs. Many of the lines were down-modulated for TIMP messenger RNA levels and secreted less TIMP into the culture medium. In comparison to noninvasive, nontumorigenic controls, these cells not only were invasive in a human amnion invasion assay, but also were tumorigenic and metastatic in athymic mice. These results indicate that TIMP suppresses oncogenicity, at least in immortal murine 3T3 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Khokha, R -- Waterhouse, P -- Yagel, S -- Lala, P K -- Overall, C M -- Norton, G -- Denhardt, D T -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):947-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Western Ontario, London, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2465572" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Cells, Cultured ; Enzyme Inhibitors/*genetics/metabolism ; Female ; Metalloendopeptidases/antagonists & inhibitors ; Mice ; Mice, Nude ; Neoplasm Metastasis ; Pituitary Neoplasms/genetics/pathology ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors/genetics ; Tissue Inhibitor of Metalloproteinases ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    Publication Date: 1989-08-25
    Description: Mice fed a chemically defined diet devoid of pyrroloquinoline quinone (PQQ) grew poorly, failed to reproduce, and became osteolathyritic. Moreover, severely affected mice had friable skin, skin collagen that was readily extractable into neutral salt solutions, and decreased lysyl oxidase. The identification of functional defects in connective tissue and the growth retardation associated with PQQ deprivation suggest that PQQ plays a fundamental role as a growth factor or vitamin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Killgore, J -- Smidt, C -- Duich, L -- Romero-Chapman, N -- Tinker, D -- Reiser, K -- Melko, M -- Hyde, D -- Rucker, R B -- AM-35747/AM/NIADDK NIH HHS/ -- HL-15965/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):850-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Nutrition, School of Agricultural and Environmental Sciences, University of California, Davis 95616.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549636" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Coenzymes/*physiology ; Collagen/metabolism ; Female ; Growth Substances/physiology ; Mice ; Nutritional Physiological Phenomena ; PQQ Cofactor ; Quinolones/deficiency/*physiology ; Skin/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    Publication Date: 1989-09-15
    Description: The neutrophil Mac-1 and gp100MEL-14 adhesion proteins are involved in neutrophil extravasation during inflammation. Both the expression and activity of Mac-1 are greatly increased after neutrophil activation. In contrast, neutrophils shed gp100MEL-14 from the cell surface within 4 minutes after activation with chemotactic factors or phorbol esters, releasing a 96-kilodalton fragment of the antigen into the supernatant. Immunohistology showed that gp100MEL-14 was downregulated on neutrophils that had extravasated into inflamed tissue. The gp100MEL-14 adhesion protein may participate in the binding of unactivated neutrophils to the endothelium; rapid shedding of gp100MEL-14 may prevent extravasation into and damage of normal tissues by activated neutrophils.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kishimoto, T K -- Jutila, M A -- Berg, E L -- Butcher, E C -- AI 19957/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1238-41.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2551036" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation/*immunology ; Antigens, Surface/*immunology ; Bone Marrow Cells ; Cell Adhesion ; Cell Adhesion Molecules ; Chemotactic Factors/*physiology ; Complement C5/physiology ; Complement C5a ; Fluorescent Antibody Technique ; Interleukin-1/physiology ; Interleukin-8 ; Kinetics ; Leukotriene B4/physiology ; Lipopolysaccharides/physiology ; Lymphocyte Activation ; Macrophage Activation ; Macrophage-1 Antigen ; Mice ; Mice, Inbred BALB C ; Neutrophils/cytology/*immunology ; Tetradecanoylphorbol Acetate ; Tumor Necrosis Factor-alpha/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    Publication Date: 1989-09-08
    Description: Heat shock proteins are evolutionarily highly conserved polypeptides that are produced under a variety of stress conditions to preserve cellular functions. A major antigen of tubercle bacilli of 65 kilodaltons is a heat shock protein that has significant sequence similarity and cross-reactivity with antigens of various other microbes. Monoclonal antibodies against this common bacterial heat shock protein were used to identify a molecule of similar size in murine macrophages. Macrophages subjected to various stress stimuli including interferon-gamma activation and viral infection were recognized by class I-restricted CD8 T cells raised against the bacterial heat shock protein. These data suggest that heat shock proteins are processed in stressed host cells and that epitopes shared by heat shock proteins of bacterial and host origin are presented in the context of class I molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koga, T -- Wand-Wurttenberger, A -- DeBruyn, J -- Munk, M E -- Schoel, B -- Kaufmann, S H -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1112-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical Microbiology and Immunology, University of Ulm, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2788923" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Bacterial/physiology ; Antibodies, Monoclonal/physiology ; Antigens, Differentiation, T-Lymphocyte/immunology ; Bacterial Proteins/*immunology/pharmacology ; Binding, Competitive ; Cross Reactions ; Cytotoxicity, Immunologic ; Heat-Shock Proteins/*immunology/pharmacology ; Macrophages/drug effects/*immunology ; Mice ; Mice, Inbred C57BL ; T-Lymphocytes, Cytotoxic/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    Publication Date: 1989-08-18
    Description: CD4 is a cell surface glycoprotein that is thought to interact with nonpolymorphic determinants of class II major histocompatibility (MHC) molecules. CD4 is also the receptor for the human immunodeficiency virus (HIV), binding with high affinity to the HIV-1 envelope glycoprotein, gp120. Homolog-scanning mutagenesis was used to identify CD4 regions that are important in class II MHC binding and to determine whether the gp120 and class II MHC binding sites of CD4 are related. Class II MHC binding was abolished by mutations in each of the first three immunoglobulin-like domains of CD4. The gp120 binding could be abolished without affecting class II MHC binding and vice versa, although at least one mutation examined reduced both functions significantly. These findings indicate that, while there may be overlap between the gp120 and class II MHC binding sites of CD4, these sites are distinct and can be separated. Thus it should be possible to design CD4 analogs that can block HIV infectivity but intrinsically lack the ability to affect the normal immune response by binding to class II MHC molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lamarre, D -- Ashkenazi, A -- Fleury, S -- Smith, D H -- Sekaly, R P -- Capon, D J -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):743-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549633" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, Surface ; Binding Sites ; DNA, Recombinant ; HIV/*metabolism ; HIV Envelope Protein gp120 ; HLA-DP Antigens/immunology ; Histocompatibility Antigens Class II/*immunology ; Humans ; Hybridomas ; Mice ; Molecular Sequence Data ; Mutation ; Receptors, HIV ; Receptors, Virus/genetics/immunology/*metabolism ; Retroviridae Proteins/immunology/*metabolism ; Rosette Formation ; Structure-Activity Relationship ; T-Lymphocytes/immunology/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    Publication Date: 1989-07-07
    Description: Basic fibroblast growth factor (bFGF) participates in many processes including early developmental events, angiogenesis, wound healing, and maintenance of neuronal cell viability. A 130-kilodalton protein was isolated on the basis of its ability to specifically bind to bFGF. A complementary DNA clone was isolated with an oligonucleotide probe corresponding to determined amino acid sequences of tryptic peptide fragments of the purified protein. The putative bFGF receptor encoded by this complementary DNA is a transmembrane protein that contains three extracellular immunoglobulin-like domains, an unusual acidic region, and an intracellular tyrosine kinase domain. These domains are arranged in a pattern that is different from that of any growth factor receptor described.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, P L -- Johnson, D E -- Cousens, L S -- Fried, V A -- Williams, L T -- CA 21765/CA/NCI NIH HHS/ -- R01 HL32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):57-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544996" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cells, Cultured ; Chick Embryo ; *Cloning, Molecular ; DNA/*genetics ; Fibroblast Growth Factors/*genetics ; Kinetics ; Mice ; Molecular Sequence Data ; Peptide Fragments/analysis ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Fibroblast Growth Factor ; Recombinant Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    Publication Date: 1989-01-27
    Description: Embryonal carcinoma (EC) cell lines are models for early cells in mouse embryogenesis. A 300-base pair fragment of the heavy chain enhancer was inactive in F9 EC cells, unlike in other nonlymphoid cells where it has significant activity. Alterations of the octamer motif increased enhancer activity. Nuclear extracts from F9 cells contained an octamer binding protein (NF-A3) that was unique to EC cells; the amount of NF-A3 decreased upon differentiation. It is proposed that NF-A3 represses specific regulatory sequences that contain the octamer motif. Thus, the same DNA sequence mediates either negative or positive transcriptional effects, depending on the cell type.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lenardo, M J -- Staudt, L -- Robbins, P -- Kuang, A -- Mulligan, R C -- Baltimore, D -- CA 01074/CA/NCI NIH HHS/ -- HD0063/HD/NICHD NIH HHS/ -- HL37569/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):544-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536195" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bucladesine/pharmacology ; Cell Differentiation ; DNA/metabolism ; Embryonal Carcinoma Stem Cells ; *Enhancer Elements, Genetic ; Immunoglobulin Heavy Chains/*genetics ; Macromolecular Substances ; Mice ; Mutation ; Neoplastic Stem Cells/*metabolism ; RNA, Messenger/biosynthesis ; Regulatory Sequences, Nucleic Acid ; Repressor Proteins/genetics ; Transcription, Genetic ; Transfection ; Tretinoin/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    Publication Date: 1989-03-31
    Description: Although the functional aspects of the alpha beta T cell antigen receptor (TCR) found on most peripheral T cells are well described, the function of the gamma delta TCR remains unclear. Murine intraepithelial lymphocytes (IEL) of the small intestine are CD8+, express the gamma delta TCR, and are constitutively lytic. Fresh IEL from germ-free mice had no lytic activity. Moreover, whereas IEL from normal mice are 30 to 50 percent Thy-1+, IEL from germ-free did not express Thy-1. Acclimation of germ-free mice to nonsterile conditions resulted in the generation of Thy-1+ IEL and induction of lytic activity. Thus CD8+ TCR-gamma delta IEL were regulated by externally derived stimuli via a specific functional interaction between IEL and gut-associated antigens.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lefrancois, L -- Goodman, T -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1716-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Upjohn Company, Kalamazoo, MI 49001.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2564701" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens/immunology ; Antigens, CD8 ; Antigens, Differentiation, T-Lymphocyte/analysis ; Antigens, Surface/*analysis/immunology ; Antigens, Thy-1 ; *Cytotoxicity, Immunologic ; Epithelial Cells ; Germ-Free Life ; Immunosorbent Techniques ; Intestine, Small/*cytology ; Mice ; Mice, Inbred BALB C ; Mice, Inbred C57BL ; Receptors, Antigen, T-Cell/analysis/*immunology ; Signal Transduction ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacDonald, H R -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):982.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Ludwig Institute for Cancer Research, Lausanne Branch, Epalinzes, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686027" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immune Tolerance ; Mice ; Mice, Transgenic ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    Publication Date: 1989-08-18
    Description: Keratinocyte growth factor (KGF) is a human mitogen that is specific for epithelial cells. The complementary DNA sequence of KGF demonstrates that it is a member of the fibroblast growth factor family. The KGF transcript was present in stromal cells derived from epithelial tissues. By comparison with the expression of other epithelial cell mitogens, only KGF, among known human growth factors, has the properties of a stromal mediator of epithelial cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Finch, P W -- Rubin, J S -- Miki, T -- Ron, D -- Aaronson, S A -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):752-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475908" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Division ; Codon ; DNA/genetics/isolation & purification ; Epithelial Cells ; Epithelium/analysis/metabolism ; Fibroblast Growth Factor 10 ; Fibroblast Growth Factor 7 ; *Fibroblast Growth Factors/genetics ; Fibroblasts/metabolism ; Gene Expression Regulation ; Growth Substances/*genetics/physiology ; Humans ; Mesoderm/metabolism ; Mice ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oligonucleotide Probes ; RNA/analysis ; Sequence Homology, Nucleic Acid ; Skin/analysis ; Tissue Distribution ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: The transfer of genetic information into mouse embryos to stably alter the genetic constitution of mice is affording new insights into and opportunities in a wide variety of biological problems. Higher eukaryotes are composed of many interacting cells and organs. The properties of individual cell systems are often discernible only by studying natural or induced disruptions in their functions. Transgenic mice represent a new form of perturbation analysis whereby the selective expression of novel or altered genes can be used to perturb complex systems in ways that are informative about their development, their functions, and their malfunctions. The utility of this strategy is illustrated by recent research into immunological self-tolerance, oncogenes and cancer, and development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hanahan, D -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1265-75.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686032" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoimmunity/genetics ; Cell Transformation, Neoplastic/genetics ; Growth/genetics ; Immune Tolerance/genetics ; Mice ; Mice, Transgenic/*genetics/immunology ; Oncogenes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: The mature T cell receptor (TCR) repertoire is the result of selection events during T cell development. Previous assessment of TCR beta-chain selection with serologic and molecular probes demonstrated both positive and negative selection. Although this work suggested a critical role for the thymus, no direct assessment has been made of the requirement for a thymus in TCR V beta selection. A comparison of TCR V beta expression in four different congenic pairs of normal and nu/nu (athymic) mice indicated that the normal V beta deletions associated with tolerance to self minor lymphocyte stimulating (Mlsc) antigens or to self major histocompatibility complex (MHC)-encoded E alpha E beta products did not occur in most athymic mice. Thus, the thymus has a critical role in mediating self tolerance by negative selection.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodes, R J -- Sharrow, S O -- Solomon, A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1041-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Experimental Immunology Branch, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587987" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, T-Lymphocyte/genetics ; Chromosome Deletion ; Gene Expression ; Macromolecular Substances ; Major Histocompatibility Complex ; Mice ; Mice, Inbred BALB C/immunology ; Mice, Inbred Strains/immunology ; Mice, Nude/*immunology ; Receptors, Antigen, T-Cell/*genetics ; Reference Values ; Species Specificity ; T-Lymphocytes/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    Publication Date: 1989-12-08
    Description: The fragile X syndrome is the most common cause of familial mental retardation. Genetic counseling and gene isolation are hampered by a lack of DNA markers close to the disease locus. Two somatic cell hybrids that each contain a human X chromosome with a breakpoint close to the fragile X locus have been characterized. A new DNA marker (DXS296) lies between the chromosome breakpoints and is the closest marker to the fragile X locus yet reported. The Hunter syndrome gene, which causes iduronate sulfatase deficiency, is located at the X chromosome breakpoint that is distal to this new marker, thus localizing the Hunter gene distal to the fragile X locus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Suthers, G K -- Callen, D F -- Hyland, V J -- Kozman, H M -- Baker, E -- Eyre, H -- Harper, P S -- Roberts, S H -- Hors-Cayla, M C -- Davies, K E -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1298-300.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Histopathology, Adelaide Children's Hospital, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573953" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chromosome Mapping ; Female ; Fragile X Syndrome/*genetics ; Genetic Counseling ; *Genetic Linkage ; *Genetic Markers ; Genomic Library ; Humans ; Hybrid Cells ; Likelihood Functions ; Mice ; Mucopolysaccharidosis II/genetics ; Mutation ; Nucleic Acid Hybridization ; Polymorphism, Restriction Fragment Length ; Sex Chromosome Aberrations/*genetics ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    Publication Date: 1989-10-06
    Description: For the IIIB isolate of human immunodeficiency virus type-1 (HIV-1), the immunodominant determinant of the envelope protein gp160 for cytotoxic T lymphocytes (CTLs) of H-2d mice is in a region of high sequence variability among HIV-1 isolates. The general requirements for CTL recognition of peptide antigens and the relation of recognition requirements to the natural variation in sequence of the HIV were investigated. For this purpose, a CTL line specific for the homologous segment of the envelope from the MN isolate of HIV-1 and restricted by the same class I major histocompatibility (MHC) molecule (Dd) as the IIIB-specific CTLs was raised from mice immunized with MN-env-recombinant vaccinia virus. The IIIB-specific and MN-specific CTLs were completely non-cross-reactive. Reciprocal exchange of a single amino acid between the two peptide sequences, which differed in 6 of 15 residues, led to a complete reversal of the specificity of the peptides in sensitizing targets, such that the IIIB-specific CTLs lysed targets exposed to the singly substituted MN peptide and vice versa. These data indicate the importance of single residues in defining peptide epitopic specificity and have implications for both the effect of immune pressure on selection of viral mutants and the design of effective vaccines.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, H -- Merli, S -- Putney, S D -- Houghten, R -- Moss, B -- Germain, R N -- Berzofsky, J A -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):118-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Metabolism Branch, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2789433" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Genes, MHC Class I ; HIV Envelope Protein gp160 ; HIV-1/*immunology ; Mice ; Mice, Inbred BALB C ; Mice, Inbred C3H ; Mice, Inbred C57BL ; Molecular Sequence Data ; Retroviridae Proteins/*immunology ; T-Lymphocytes, Cytotoxic/*immunology ; Viral Envelope Proteins/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    Publication Date: 1989-08-04
    Description: The pyrimidine analog 5-bromodeoxyuridine (BUdR) competes with thymidine for incorporation into DNA. Substitution of BUdR for thymidine does not significantly affect cell viability but does block cell differentiation in many different lineages. BUdR substitution in a mouse myoblast line blocked myogenic differentiation and extinguished the expression of the myogenic determination gene MyoD1. Forced expression of MyoD1 from a transfected expression vector in a BUdR-substituted myoblast overcame the block to differentiation imposed by BUdR. Activation of BUdR-substituted muscle structural genes and apparently normal differentiation were observed in transfected myoblasts. This shows that BUdR blocks myogenesis at the level of a myogenic regulatory gene, possibly MyoD1, not by directly inhibiting the activation of muscle structural genes. It is consistent with the idea that BUdR selectively blocks a class of regulatory genes, each member of which is important for the development of a different cell lineage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tapscott, S J -- Lassar, A B -- Davis, R L -- Weintraub, H -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):532-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Fred Hutchinson Cancer Research Center, Seattle, WA 98104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547249" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bromodeoxyuridine/metabolism/*pharmacology ; Cell Differentiation/drug effects ; Cell Line ; Creatine Kinase/genetics ; DNA/metabolism ; Desmin/genetics ; Gene Expression Regulation/*drug effects ; Genes ; Mice ; Muscle Proteins/*genetics ; Muscles/*cytology ; Myogenin ; Nuclear Proteins/*genetics ; Plasmids ; RNA, Messenger/genetics ; Repetitive Sequences, Nucleic Acid ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    Publication Date: 1989-11-10
    Description: A substitution mutation has been introduced into the c-abl locus of murine embryonic stem cells by homologous recombination between exogenously added DNA and the endogenous gene, and these cells have been used to generate chimeric mice. It is shown that the c-abl mutation was transmitted to progeny by several male chimeras. This work demonstrates the feasibility of germ-line transmission of a mutation introduced into a nonselectable autosomal gene by homologous recombination.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schwartzberg, P L -- Goff, S P -- Robertson, E J -- P01 CA 23767/CA/NCI NIH HHS/ -- R01 HD 25208/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):799-803.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, Columbia University, College of Physicians & Surgeons, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554496" target="_blank"〉PubMed〈/a〉
    Keywords: Abelson murine leukemia virus/*genetics ; Animals ; Blotting, Southern ; Cell Line ; Chimera ; Cloning, Molecular ; *DNA, Recombinant ; Female ; Leukemia Virus, Murine/*genetics ; Male ; Mice ; Mice, Inbred C57BL ; *Mutation ; Oncogenes/*physiology ; Retroviridae Proteins, Oncogenic/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    Publication Date: 1989-02-03
    Description: The biological effects of ras oncogene activation in B cells were studied by using amphotropic retroviral vectors to introduce H- or N-ras oncogenes into human B lymphoblasts immortalized by Epstein-Barr virus. Expression of both H- and N-ras oncogenes led to malignant transformation of these cells, as shown by clonogenicity in semisolid media and tumorigenicity in immunodeficient mice. In addition, terminal differentiation into plasma cells was detectable as specific changes in morphology, immunoglobulin secretion, and cell surface antigen expression. This combined effect, promoting growth and differentiation in human lymphoblasts, represents a novel biological action of ras oncogenes and has implications for the pathogenesis of terminally differentiated B-lymphoid malignancies such as multiple myeloma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Seremetis, S -- Inghirami, G -- Ferrero, D -- Newcomb, E W -- Knowles, D M -- Dotto, G P -- Dalla-Favera, R -- CA-37165/CA/NCI NIH HHS/ -- CA49236/CA/NCI NIH HHS/ -- EY 06337/EY/NEI NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):660-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, New York University, NY 10016.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536954" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; B-Lymphocytes/metabolism/*pathology ; Cell Differentiation ; *Cell Transformation, Neoplastic ; *Cell Transformation, Viral ; DNA Replication ; Flow Cytometry ; Fluorescent Antibody Technique ; Gene Expression Regulation ; *Genes, ras ; *Herpesvirus 4, Human ; Humans ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Neoplasms, Experimental/etiology ; Phenotype ; Plasma Cells/*pathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    Publication Date: 1989-03-03
    Description: Isolation of a clone encoding the mouse lymph node homing receptor reveals a deduced protein with an unusual protein mosaic architecture, containing a separate carbohydrate-binding (lectin) domain, an epidermal growth factor-like (EGF) domain, and an extracellular precisely duplicated repeat unit, which preserves the motif seen in the homologous repeat structure of complement regulatory proteins and other proteins. The receptor molecule is potentially highly glycosylated, and contains an apparent transmembrane region. Analysis of messenger RNA transcripts reveals a predominantly lymphoid distribution in direct relation to the cell surface expression of the MEL-14 determinant, and the cDNA clone is shown to confer the MEL-14 epitope in heterologous cells. The many novel features, including ubiquitination, embodied in this single receptor molecule form the basis for numerous approaches to the study of cell-cell interactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siegelman, M H -- van de Rijn, M -- Weissman, I L -- AI09022/AI/NIAID NIH HHS/ -- OIG43551/PHS HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1165-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646713" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Base Sequence ; Binding Sites ; Carbohydrate Metabolism ; Cell Membrane/metabolism ; DNA/*genetics ; Epidermal Growth Factor ; Glycosylation ; Lymph Nodes/*metabolism ; Membrane Glycoproteins/*genetics ; Mice ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; Receptors, Lymphocyte Homing ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    Publication Date: 1989-06-02
    Description: Cytotoxic T lymphocytes (CTLs) recognize foreign antigens, including viral proteins, in association with major histocompatibility complex (MHC) class I molecules. Brefeldin A, a specific inhibitor of exocytosis, completely and reversibly inhibited the presentation of viral proteins, but not exogenous peptides, to MHC class I-restricted CTLs directed against influenza virus antigens. The effect of brefeldin A on antigen presentation correlated with its inhibition of intracellular transport of newly synthesized class I molecules. Brefeldin A is thus a specific inhibitor of antigen processing for class I-restricted T cell recognition. Its effect on antigen presentation supports the idea that exogenous peptide antigens associate with cell surface class I molecules, whereas protein antigens processed via the cytosolic route associate with nascent class I molecules before they leave the trans-Golgi complex.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yewdell, J W -- Bennink, J R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1072-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory for Viral Diseases, National Institute of Allergy and Infectious Diseases, Rockville, MD 20852.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471266" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigen-Presenting Cells/*drug effects/immunology ; Antigens, Viral/*immunology ; Biological Transport/drug effects ; Brefeldin A ; Cell Membrane/immunology ; Cyclopentanes/*pharmacology ; Endoplasmic Reticulum/immunology ; Epitopes/immunology ; Exocytosis/drug effects ; Golgi Apparatus/immunology ; H-2 Antigens/immunology ; Hemagglutinins/genetics/immunology ; Histocompatibility Antigens Class I/immunology ; Mice ; Nucleoproteins/immunology ; Orthomyxoviridae/immunology ; T-Lymphocytes, Cytotoxic/drug effects/*immunology ; Transfection ; Viral Proteins/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    Publication Date: 1989-06-09
    Description: The neuron-specific protein GAP-43 is associated with the membrane of the nerve growth cone and thus may be important to the activity of this distinctive neuronal structure. Transient transfection of COS and NIH 3T3 cells with appropriate vectors resulted in expression of GAP-43 in these non-neuronal cells; as in neurons, transfected GAP-43 associated with the membrane. In addition, many long fine filopodial processes extended from the periphery of such transfected cells. Stable CHO cell lines expressing GAP-43 also exhibited processes that were more numerous, far longer, and more complex than those of CHO cell lines not transfected or transfected with control plasmids. Thus GAP-43 may directly contribute to growth cone activity by regulating cell membrane structure and enhancing extension of filopodial processes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zuber, M X -- Goodman, D W -- Karns, L R -- Fishman, M C -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1193-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Developmental Biology Laboratory, Massachusetts General Hospital Cancer Center, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658062" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Cell Membrane/*ultrastructure ; Cells, Cultured ; Fluorescent Antibody Technique ; GAP-43 Protein ; Growth Substances/*physiology ; Membrane Proteins/genetics/*physiology ; Mice ; Nerve Tissue Proteins/genetics/*physiology ; Recombinant Proteins/pharmacology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-30
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dickson, D -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1539-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740899" target="_blank"〉PubMed〈/a〉
    Keywords: Absorption ; Animals ; *Dna ; Ethics ; Male ; Mice ; Mice, Transgenic ; *Patents as Topic ; Research Personnel ; Rome ; *Spermatozoa ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-07
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dickson, D -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):25.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740910" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Europe ; *Genetic Engineering ; Mice ; *Mice, Transgenic ; *Patents as Topic ; *Social Control, Formal ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-04-21
    Description: The mouse albumin gene promoter has six closely spaced binding sites for nuclear proteins that are located between the TATA motif and nucleotide position -170. In vitro transcription with liver or spleen nuclear extracts of templates containing either mutated or polymerized albumin promoter elements establishes a hierarchy of the different protein binding sites for tissue-specific albumin gene transcription. The HNF-1 and C/EBP binding sites strongly activate transcription in a tissue-specific manner. The NF-Y binding site has a lower activation potential and is less specific, being equally efficient in liver and spleen nuclear extracts. The remaining elements are relatively weak activator sites.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Maire, P -- Wuarin, J -- Schibler, U -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):343-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departement de Biologie Moleculaire, Sciences II, Geneva, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2711183" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Carrier Proteins/metabolism/pharmacology ; Cell Nucleus/metabolism ; DNA-Binding Proteins/*metabolism ; Dicarboxylic Acid Transporters ; *Gene Expression Regulation/drug effects ; Liver/metabolism/ultrastructure ; Mice ; Nuclear Proteins/metabolism/pharmacology ; *Promoter Regions, Genetic ; Serum Albumin/*genetics ; Spleen/metabolism/ultrastructure ; Templates, Genetic ; Transcription Factors ; Transcription, Genetic/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    Publication Date: 1989-01-06
    Description: The ZFY gene in the sex-determining region of the human Y chromosome encodes a "zinc-finger" protein that may be the testis-determining factor, TDF. Although the Y chromosomes of most placental mammals carry a single homolog of ZFY, the mouse Y chromosome has two homologs, both in the sex-determining (Sxr) region. Zfy-1 alone may suffice to determine maleness; Zfy-2 is dispensable, as it was deleted in an Sxr variant that retains sex-determining function but has lost other genes. Both loci mapped near the centromere of the mouse Y chromosome. The Y chromosomes of the subspecies Mus musculus musculus and M. m. domesticus were distinguishable by a Zfy-1 restriction fragment polymorphism, which can be used to study their differing interactions with autosomal sex-determining genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mardon, G -- Mosher, R -- Disteche, C M -- Nishioka, Y -- McLaren, A -- Page, D C -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):78-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute, Nine Cambridge Center, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563173" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Deletion ; Chromosome Mapping ; Male ; Mice ; Mice, Inbred Strains/*genetics ; *Multigene Family ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; *Sex Determination Analysis ; *Y Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    Publication Date: 1989-04-28
    Description: Mice transgenic for a hybrid gene containing the liver promoter of the mouse amylase gene (Amy-1a) fused to the SV40 tumor antigen coding region unexpected developed malignant brown adipose tissue tumors (malignant hibernomas). Expression of the alpha-amylase gene had previously been thought to be confined to the liver parotid, and pancreas; however, analysis of white and brown adipose tissue from nontransgenic mice revealed expression of the endogenous Amy-1a gene in these tissues. Gene constructs driven by the Amy-1a liver promoter thus provide a means of targeting gene expression to the adipocyte cell lineage in transgenic mice. Moreover the high frequency of metastases in the liver, lungs, spleen, heart, and adrenals of these mice provides an experimental system in which to study the development of disseminated malignancy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fox, N -- Crooke, R -- Hwang, L H -- Schibler, U -- Knowles, B B -- Solter, D -- CA-10815/CA/NCI NIH HHS/ -- CA-18470/CA/NCI NIH HHS/ -- CA-21124/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):460-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785714" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/metabolism/pathology ; *Adipose Tissue, Brown/metabolism/pathology ; Animals ; Antigens, Polyomavirus Transforming/*genetics ; Cloning, Molecular ; Gene Expression Regulation ; Liver/metabolism ; Mice ; Mice, Transgenic ; Neoplasm Metastasis ; Neoplasms, Experimental/*genetics/pathology ; Nucleic Acid Hybridization ; Promoter Regions, Genetic ; RNA, Messenger/metabolism ; Tissue Distribution ; Transcription, Genetic ; alpha-Amylases/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    Publication Date: 1989-10-27
    Description: Immunization with chemically detoxified pertussis toxin can prevent severe whooping cough with an efficacy similar to that of the cellular pertussis vaccine, which normally gives unwanted side effects. To avoid the reversion to toxicity and the loss of immunogenicity that may follow chemical treatment of pertussis toxin, inactive toxins were constructed by genetic manipulation. A number of genetically engineered alleles of the pertussis toxin genes, constructed by replacing either one or two key amino acids within the enzymatically active S1 subunit, were introduced into the chromosome of strains of Bordetella pertussis, B. parapertussis, and B. bronchiseptica. These strains produce mutant pertussis toxin molecules that are nontoxic and immunogenic and that protect mice from the intracerebral challenge with virulent Bordetella pertussis. Such molecules are ideal for the development of new and safer vaccines against whooping cough.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pizza, M -- Covacci, A -- Bartoloni, A -- Perugini, M -- Nencioni, L -- De Magistris, M T -- Villa, L -- Nucci, D -- Manetti, R -- Bugnoli, M -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):497-500.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Sclavo Research Center, Siena, Italy.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683073" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Female ; Genetic Techniques ; Mice ; Mice, Inbred BALB C ; Mutation ; *Pertussis Toxin ; Pertussis Vaccine/*toxicity ; Rabbits ; Vaccines, Synthetic/toxicity ; Virulence Factors, Bordetella/genetics/immunology/*toxicity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    Publication Date: 1989-04-28
    Description: The rapid transductional sequences initiated by interferon-gamma (IFN-gamma) on binding to its receptor regulate functional and genomic responses in many cells but are not well defined. Induction of macrophage activation is an example of such functional and genomic changes in response to IFN-gamma. Addition of IFN-gamma to murine macrophages, at activating concentrations, produced rapid (within 60 seconds) alkalinization of the cytosol and a concomitant, rapid influx of 22Na+. Amiloride inhibited the ion fluxes and the accumulation of specific messenger RNA for two genes induced by IFN-gamma (the early gene JE and the beta chain of the class II major histocompatibility complex gene I-A). The data indicate that IFN-gamma initiates rapid exchange of Na+ and H+ by means of the Na+/H+ antiporter and that these amiloride-sensitive ion fluxes are important to some of the genomic effects of IFN-gamma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Prpic, V -- Yu, S F -- Figueiredo, F -- Hollenbach, P W -- Gawdi, G -- Herman, B -- Uhing, R J -- Adams, D O -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):469-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541500" target="_blank"〉PubMed〈/a〉
    Keywords: Amiloride/pharmacology ; Animals ; Carrier Proteins/antagonists & inhibitors/metabolism ; Cells, Cultured ; Cytosol/metabolism ; *Gene Expression Regulation ; Histocompatibility Antigens Class II/*genetics ; Hydrogen-Ion Concentration ; Interferon-gamma/*physiology ; Kinetics ; Macrophage Activation ; Macrophages/drug effects/metabolism ; Mice ; *Protons ; RNA, Messenger/biosynthesis ; Sodium/*metabolism ; Sodium-Hydrogen Antiporter
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    Publication Date: 1989-06-16
    Description: Genetic engineering of livestock is expected to have a major effect on the agricultural industry. However, accurate assessment of the consequences of transgene expression is impossible without multigenerational studies. A systematic study of the beneficial and adverse consequences of long-term elevations in the plasma levels of bovine growth hormone (bGH) was conducted on two lines of transgenic pigs. Two successive generations of pigs expressing the bGH gene showed significant improvements in both daily weight gain and feed efficiency and exhibited changes in carcass composition that included a marked reduction in subcutaneous fat. However, long-term elevation of bGH was generally detrimental to health: the pigs had a high incidence of gastric ulcers, arthritis, cardiomegaly, dermatitis, and renal disease. The ability to produce pigs exhibiting only the beneficial, growth-promoting effects of growth hormone by a transgenic approach may require better control of transgene expression, a different genetic background, or a modified husbandry regimen.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pursel, V G -- Pinkert, C A -- Miller, K F -- Bolt, D J -- Campbell, R G -- Palmiter, R D -- Brinster, R L -- Hammer, R E -- HD-09172/HD/NICHD NIH HHS/ -- HD-19018/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1281-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉U.S. Department of Agriculture, Beltsville, MD 20705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499927" target="_blank"〉PubMed〈/a〉
    Keywords: Agriculture ; Animals ; Animals, Domestic/*genetics/growth & development ; *Animals, Genetically Modified ; Body Weight ; Female ; *Genetic Engineering ; Growth Hormone/genetics ; Growth Hormone-Releasing Hormone/genetics ; Insulin-Like Growth Factor I/genetics ; Mice ; Organ Size ; Swine/genetics/growth & development ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-02
    Description: Specialized regions of muscle fibers may result from differential gene expression within a single fiber. In order to investigate the range of action of individual nuclei in multinucleated myotubes, C2 myoblasts were transfected to obtain stable cell lines that express a reporter protein that is targeted to the nucleus. Hybrid myotubes were then formed containing one or a few transfected nuclei as well as a large number of nuclei from the parental strain. In order to determine how far the products of a single nucleus extend, transfected nuclei were labeled with [3H]thymidine before fusion and the myotubes were stained to identify the reporter protein. In such myotubes the fusion protein was not confined to its nucleus of origin, but was restricted to nearby nuclei.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ralston, E -- Hall, Z W -- NS 20107/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1066-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, School of Medicine, University of California, San Francisco 94143-0444.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543074" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Cell Nucleus/*metabolism ; Cloning, Molecular ; Cytoplasm/metabolism ; Enhancer Elements, Genetic ; Escherichia coli/genetics ; Fluorescent Antibody Technique ; Gene Expression Regulation ; Globins/genetics ; Mice ; Muscle Proteins/*genetics/metabolism ; Muscles/*ultrastructure ; Plasmids ; Promoter Regions, Genetic ; Receptors, Glucocorticoid/genetics ; Simian virus 40/genetics ; *Transfection ; beta-Galactosidase/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: T cells become tolerant of self antigens during their development in the thymus. Clonal deletion of thymocytes bearing self-reactive T cell receptors is a major mechanism for generating tolerance and occurs readily for antigens expressed by bone marrow-derived cells. Tolerance to antigens expressed on the radioresistant thymic stromal elements is demonstrated here to occur via a nondeletional mechanism. For minor lymphocyte stimulatory (Mls-1a) and major histocompatibility complex (MHC) antigens, this alternate form of tolerance induction results in clonal anergy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ramsdell, F -- Lantz, T -- Fowlkes, B J -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1038-41.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Immunology, National Institute of Allergy and Infectious Disease, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511629" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Antigens, CD4/analysis ; Antigens, CD8 ; Antigens, Differentiation, T-Lymphocyte ; Chimera ; Chromosome Deletion ; *Immune Tolerance ; Lymph Nodes/immunology ; Lymphocyte Activation ; Major Histocompatibility Complex ; Mice ; Mice, Inbred Strains ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology ; Thymus Gland/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: A procedure has been developed for introducing exogenous DNA into mouse eggs by injection of chromosome fragments. Chromosome fragments were dissected from human metaphase spreads and microinjected into the pronuclei of fertilized mouse eggs. Many of the injected eggs subsequently exhibited normal pre- and postimplantation development. Embryos obtained from eggs injected with centromeric fragments retained human centromeric DNA as demonstrated by in situ hybridization analysis. From eggs injected with noncentromeric fragments, a mouse was obtained whose tail tissue exhibited the presence of human DNA. This procedure should facilitate incorporation of very large (more than 10 megabases) DNA fragments into cells and embryos without the need for cloned sequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richa, J -- Lo, C W -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):175-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749254" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blastocyst ; Cell Line ; Centromere ; *Chromosomes, Human ; DNA/*genetics ; Humans ; Metaphase ; Mice ; *Mice, Transgenic ; Microinjections ; Nucleic Acid Hybridization ; Ovum ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    Publication Date: 1989-06-23
    Description: Adipsin is a serine protease that is secreted by adipocytes into the bloodstream; it is deficient in several animal models of obesity, representing a striking example of defective gene expression in this disorder. Recombinant mouse adipsin was purified and its biochemical and enzymatic properties were studied in order to elucidate the function of this protein. Activated adipsin has little or no proteolytic activity toward most substrates but has the same activity as human complement factor D, cleaving complement factor B when it is complexed with activated complement component C3. Like authentic factor D, adipsin can activate the alternative pathway of complement, resulting in red blood cell lysis. Decreased (58 to 80 percent) complement factor D activity, relative to lean controls, was observed as a common feature of several experimental models of obesity, including the ob/ob, db/db, and monosodium glutamate (MSG)-injected mouse and the fa/fa rat. These results suggest that adipsin and the alternative pathway of complement may play an unexpected but important role in the regulation of systemic energy balance in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosen, B S -- Cook, K S -- Yaglom, J -- Groves, D L -- Volanakis, J E -- Damm, D -- White, T -- Spiegelman, B M -- DK31403/DK/NIDDK NIH HHS/ -- DK34605/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1483-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734615" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/metabolism ; Amino Acid Sequence ; Animals ; Cell Line ; Complement Activating Enzymes/*metabolism ; Complement Factor D/*metabolism ; Complement Pathway, Alternative ; Cricetinae ; DNA/genetics ; Gene Expression Regulation ; Humans ; Immunoblotting ; Mice ; Molecular Sequence Data ; Obesity/genetics/*immunology/metabolism ; RNA, Messenger/metabolism ; Recombinant Proteins ; Serine Endopeptidases/genetics/isolation & purification/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    Publication Date: 1989-09-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roth, M E -- Lacy, M J -- McNeil, L K -- Kranz, D M -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2528208" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immunoglobulin Joining Region ; *Immunoglobulin Variable Region ; Mice ; *Receptors, Antigen, T-Cell ; Receptors, Antigen, T-Cell, alpha-beta
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-05
    Description: The major histocompatibility complex (MHC) genes are polymorphic in mouse and man. The products of these genes are receptors for peptides, which while bound, are displayed to T lymphocytes. When bound peptides from antigens are recognized by T lymphocytes, an immune response is initiated against the antigens. This study assessed the relation of the polymorphic MHC molecules to their peptide specificity. The results indicate that although an individual of the species has a limited ability to recognize antigens, the species as a whole has broad reactivity. This rationalizes the extreme polymorphism observed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roy, S -- Scherer, M T -- Briner, T J -- Smith, J A -- Gefter, M L -- AI13357/AI/NIAID NIH HHS/ -- CA28900/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 5;244(4904):572-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Massachusetts Institute of Technology, Cambridge 02139.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2470147" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens/immunology ; Bacteriophage lambda ; Epitopes/immunology ; Histocompatibility Antigens Class II/immunology ; Hybridomas/immunology ; Immunization ; *Major Histocompatibility Complex ; Mice ; Mice, Inbred BALB C ; Mice, Inbred C3H ; Mice, Inbred C57BL ; Peptide Fragments/immunology ; *Polymorphism, Genetic ; Repressor Proteins/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    Publication Date: 1989-09-08
    Description: An understanding of the basic defect in the inherited disorder cystic fibrosis requires cloning of the cystic fibrosis gene and definition of its protein product. In the absence of direct functional information, chromosomal map position is a guide for locating the gene. Chromosome walking and jumping and complementary DNA hybridization were used to isolate DNA sequences, encompassing more than 500,000 base pairs, from the cystic fibrosis region on the long arm of human chromosome 7. Several transcribed sequences and conserved segments were identified in this cloned region. One of these corresponds to the cystic fibrosis gene and spans approximately 250,000 base pairs of genomic DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rommens, J M -- Iannuzzi, M C -- Kerem, B -- Drumm, M L -- Melmer, G -- Dean, M -- Rozmahel, R -- Cole, J L -- Kennedy, D -- Hidaka, N -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- N01-CO-74102/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1059-65.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772657" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cattle ; Chickens ; *Chromosome Mapping ; *Chromosomes, Human, Pair 7 ; Cloning, Molecular/methods ; Cricetinae ; Cystic Fibrosis/*genetics ; DNA Probes ; Genes, Overlapping ; *Genes, Recessive ; Genetic Markers ; Humans ; Mice ; Nucleic Acid Hybridization ; Restriction Mapping/methods
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 82
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 83
    Publication Date: 1989-06-23
    Description: Phagocytosis of group A streptococci requires type-specific antibodies directed against the variable determinants of the bacterial surface M protein molecule. As a step toward developing a broadly protective anti-streptococcal vaccine, a vaccinia virus (VV) recombinant was constructed that expresses the conserved region of the structural gene encoding the M6 molecule (VV:M6'). Mice immunized intranasally with the VV:M6' virus showed markedly reduced pharyngeal colonization by streptococci after intranasal and oral challenge with these bacteria. M protein-specific serum immunoglobulin G was significantly elevated in vaccinated animals and absent in controls. A similar approach may prove useful for the identification of protective determinants present on other bacterial and viral pathogens.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fischetti, V A -- Hodges, W M -- Hruby, D E -- AI-00666/AI/NIAID NIH HHS/ -- AI-11822/AI/NIAID NIH HHS/ -- AI-26281/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1487-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Rockefeller University, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660266" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; *Bacterial Outer Membrane Proteins ; Bacterial Proteins/genetics/*immunology ; *Bacterial Vaccines/immunology ; *Carrier Proteins ; Cloning, Molecular ; *Immunization ; Immunoglobulin A/analysis ; Immunoglobulin G/analysis ; Mice ; Pharyngeal Diseases/etiology/*prevention & control ; Streptococcal Infections/*prevention & control ; Streptococcus pyogenes ; *Vaccines/immunology ; *Vaccines, Synthetic/immunology ; Vaccinia virus/genetics/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 84
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: During T cell differentiation, self tolerance is established in part by the deletion of self-reactive T cells within the thymus (negative selection). The presence of T cell receptor (TCR)-alpha beta + T cells in older athymic (nu/nu) mice indicates that some T cells can also mature without thymic influence. Therefore, to determine whether the thymus is required for negative selection, TCR V beta expression was compared in athymic nu/nu mice and their congenic normal littermates. T cells expressing V beta 3 proteins are specific for minor lymphocyte stimulatory (Mlsc) determinants and are deleted intrathymically due to self tolerance in Mlsc+ mouse strains. Here it is shown that V beta 3+ T cells are deleted in Mlsc+ BALB/c nu/+ mice, but not in their BALB/c nu/nu littermates. Thus, the thymus is required for clonal deletion during T cell development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fry, A M -- Jones, L A -- Kruisbeek, A M -- Matis, L A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1044-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511630" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD4/genetics ; Antigens, CD8 ; Antigens, Differentiation, T-Lymphocyte/genetics ; Flow Cytometry ; Gene Expression ; Macromolecular Substances ; Mice ; Mice, Inbred BALB C ; Mice, Inbred Strains ; Mice, Nude ; Receptors, Antigen, T-Cell/genetics ; T-Lymphocytes/*immunology ; Thymus Gland/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 85
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 86
    Publication Date: 1989-03-17
    Description: Ornithine decarboxylase (ODC) was converted from a protein with a short intracellular half-life in mammalian cells to a stable protein by truncating 37 residues at its carboxyl terminus. Cells expressing wild-type protein lost ODC activity with a half-life of approximately 1 hour. Cells expressing the truncated protein, however, retained full activity for at least 4 hours. Pulse-chase experiments in which immunoprecipitation and gel electrophoresis were used confirmed the stabilizing effect of the truncation. Thus, a carboxyl-terminal domain is responsible for the rapid intracellular degradation of murine ODC.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ghoda, L -- van Daalen Wetters, T -- Macrae, M -- Ascherman, D -- Coffino, P -- CA 09043/CA/NCI NIH HHS/ -- CA 29048/CA/NCI NIH HHS/ -- CA 47721/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1493-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928784" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Cloning, Molecular ; Mice ; Ornithine Decarboxylase/genetics/*metabolism ; Recombinant Proteins/metabolism ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 87
    Publication Date: 1989-11-24
    Description: Drug development is needed to improve chemotherapy of patients with locally advanced or metastatic colon carcinoma, who otherwise have an unfavorable prognosis. DNA topoisomerase I, a nuclear enzyme important for solving topological problems arising during DNA replication and for other cellular functions, has been identified as a principal target of a plant alkaloid 20(S)-camptothecin. Significantly increased concentrations of this enzyme, compared to that in normal colonic mucosa, were found in advanced stages of human colon adenocarcinoma and in xenografts of colon cancer carried by immunodeficient mice. Several synthetic analogs of camptothecin, selected by tests with the purified enzyme and tissue-culture screens, were evaluated in the xenograft model. Unlike other anticancer drugs tested, 20(RS)-9-amino-camptothecin (9-AC) induced disease-free remissions. The overall drug toxicity was low and allowed for repeated courses of treatment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Giovanella, B C -- Stehlin, J S -- Wall, M E -- Wani, M C -- Nicholas, A W -- Liu, L F -- Silber, R -- Potmesil, M -- CA-11655/CA/NCI NIH HHS/ -- CA-16087/CA/NCI NIH HHS/ -- CA-349636/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1046-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Stehlin Foundation for Cancer Research, St. Joseph Hospital, Houston, TX 77002.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555920" target="_blank"〉PubMed〈/a〉
    Keywords: Adenocarcinoma/analysis/*drug therapy/enzymology ; Animals ; Antineoplastic Agents/*therapeutic use ; Biomarkers, Tumor/analysis ; Camptothecin/*analogs & derivatives/*therapeutic use/toxicity ; Colonic Neoplasms/analysis/*drug therapy/enzymology ; DNA Topoisomerases, Type I/analysis ; DNA, Neoplasm/analysis ; Drug Design ; Humans ; Intestinal Mucosa/enzymology ; Mice ; Mice, Inbred Strains ; Neoplasm Transplantation ; *Topoisomerase I Inhibitors ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 88
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 89
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 90
    Publication Date: 1989-08-18
    Description: Two distinct CD3-associated T cell receptors (TCR alpha beta and TCR gamma delta) are expressed in a mutually exclusive fashion on separate subsets of T lymphocytes. While the specificity of the TCR alpha beta repertoire for major histocompatibility complex (MHC) antigens is well established, the diversity of expressed gamma delta receptors and the ligands they recognize are less well understood. An alloreactive CD3+CD4-CD8- T cell line specific for murine class II MHC (Ia) antigens encoded in the I-E subregion of the H-2 gene complex was identified, and the primary structure of its gamma delta receptor heterodimer was characterized. In contrast to a TCR alpha beta-expressing alloreactive T cell line selected for similar specificity, the TCR gamma delta line displayed broad cross-reactivity for multiple distinct I-E-encoded allogeneic Ia molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matis, L A -- Fry, A M -- Cron, R Q -- Cotterman, M M -- Dick, R F -- Bluestone, J A -- 5-T32AI07090-10/AI/NIAID NIH HHS/ -- CA-14599-15/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):746-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biochemistry and Biophysics, Food and Drug Administration, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2528206" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Antigens, CD3 ; Antigens, Differentiation, T-Lymphocyte/analysis/immunology ; Base Sequence ; Cell Line ; Cloning, Molecular ; Cytotoxicity, Immunologic ; H-2 Antigens/genetics/immunology ; Histocompatibility Antigens Class II/genetics/*immunology ; Hybridomas/immunology ; Immunosorbent Techniques ; Macromolecular Substances ; Mice ; Mice, Nude ; Molecular Sequence Data ; Receptors, Antigen, T-Cell/analysis/genetics/*immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 91
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 92
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 93
    Publication Date: 1989-12-01
    Description: Activation of spontaneously dividing T cell hybridomas induces interleukin-2 (IL-2) production, a cell cycle block, and programmed cell death. T cell hybridomas that express the T cell antigen receptor (TCR) zeta homodimer (zeta 2), but not the TCR zeta eta heterodimer, were studied. The zeta eta- cells produced little or no inositol phosphates (IP) when stimulated with antigen. In most cases the hydrolysis of phosphoinositides was also impaired after stimulation with antibody to CD3, although one zeta eta- cell produced normal concentrations of IP. The zeta eta- cells slowed their growth and secreted IL-2 in response to both stimuli. However, the zeta eta- cells did not die after activation with antigen. Since activated thymocytes also undergo programmed cell death, these results may have important implications for the role of the zeta eta.TCR in negative selection.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mercep, M -- Weissman, A M -- Frank, S J -- Klausner, R D -- Ashwell, J D -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1162-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biological Response Modifiers Program, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531464" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal/immunology ; Antigens/immunology ; Antigens, CD3 ; Antigens, Differentiation, T-Lymphocyte/immunology ; Cell Survival ; *Gene Expression ; Hybridomas/immunology ; Inositol Phosphates/metabolism ; Interleukin-2/secretion ; Lymphocyte Activation/*physiology ; Macromolecular Substances ; Mice ; Receptors, Antigen, T-Cell/*genetics/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 94
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 95
    Publication Date: 1989-11-17
    Description: The zona pellucida surrounding mouse oocytes is an extracellular matrix composed of three sulfated glycoproteins, ZP1, ZP2, and ZP3. It has been demonstrated that a monoclonal antibody to ZP3 injected into female mice inhibits fertilization by binding to the zona pellucida and blocking sperm penetration. A complementary DNA encoding ZP3 was randomly cleaved and 200- to 1000-base pair fragments were cloned into the expression vector lambda gt11. This epitope library was screened with the aforementioned contraceptive antibody, and the positive clones were used to map the seven-amino acid epitope recognized by the antibody. Female mice were immunized with a synthetic peptide containing this B cell epitope coupled to a carrier protein to provide helper T cell epitopes. The resultant circulating antibodies to ZP3 bound to the zona pellucida of immunized animals and produced long-lasting contraception. The lack of ovarian histopathology or cellular cytotoxicity among the immunized animals may be because of the absence of zona pellucida T cell epitopes in this vaccine.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millar, S E -- Chamow, S M -- Baur, A W -- Oliver, C -- Robey, F -- Dean, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):935-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479101" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens/immunology ; Base Sequence ; Cloning, Molecular ; *Contraception ; *Contraception, Immunologic ; DNA/genetics ; *Egg Proteins ; Epitopes/analysis ; Female ; Glycoproteins/genetics/*immunology ; Male ; *Membrane Glycoproteins ; Mice ; Molecular Sequence Data ; Ovum/*physiology ; Protein Conformation ; RNA, Messenger/genetics ; *Receptors, Cell Surface ; *Vaccination ; Zona Pellucida/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 96
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 97
    Publication Date: 1989-08-11
    Description: Cadherins are a family of Ca2+-dependent intercellular adhesion molecules. Complementary DNAs encoding mouse neural cadherin (N-cadherin) were cloned, and the cell binding specificity of this molecule was examined. Mouse N-cadherin shows 92 percent similarity in amino acid sequence to the chicken homolog, while it shows 49 percent and 43 percent similarity to epithelial cadherin and to placental cadherin of the same species, respectively. In cell binding assays, mouse N-cadherin did not cross-react with other mouse cadherins, but it did cross-react with chicken N-cadherin. The results indicate that each cadherin type confers distinct adhesive specificities on different cells, and also that the specificity of N-cadherin is conserved between mammalian and avian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miyatani, S -- Shimamura, K -- Hatta, M -- Nagafuchi, A -- Nose, A -- Matsunaga, M -- Hatta, K -- Takeichi, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):631-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2762814" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Antigens, Surface/genetics/*physiology ; Base Sequence ; Brain Chemistry ; *Cell Adhesion ; Cell Adhesion Molecules ; Chickens ; Cloning, Molecular ; DNA/genetics ; Embryo, Mammalian ; Embryo, Nonmammalian ; L Cells (Cell Line) ; Mice ; Molecular Sequence Data ; Nerve Tissue/*analysis ; Nucleic Acid Hybridization ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 98
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-19
    Description: T cell proliferation in response to stimulation with Staphylococcus enterotoxin A (SEA) requires accessory cells that express class II major histocompatibility complex (MHC) molecules. Murine fibroblasts transfected with genes encoding the alpha and beta subunits of HLA-DR, DQ, or DP were used to show that the proliferative response of purified human T cells to SEA is dependent on class II molecules but is not restricted by the haplotype of the responder. Binding of fluoresceinated SEA to class II transfectants and precipitation of class II heterodimers with SEA-Sepharose show that the proliferative response is a result of SEA binding to class II molecules. The binding is specific for class II molecules and is independent of class II allotype or isotype. The ability of SEA to bind class II molecules may be a general characteristic of this class of antigens, now called "superantigens".〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mollick, J A -- Cook, R G -- Rich, R R -- AI-15394/AI/NIAID NIH HHS/ -- AI-21289/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):817-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratory, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658055" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Enterotoxins/*immunology ; Fibroblasts/immunology ; Fluoresceins ; Fluorescent Dyes ; HLA-DP Antigens/genetics/immunology ; HLA-DQ Antigens/genetics/immunology ; HLA-DR Antigens/genetics/immunology ; Histocompatibility Antigens Class II/*immunology ; Immunosorbent Techniques ; Lymphocyte Activation ; Mice ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 99
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 100
    Publication Date: 1989-10-13
    Description: Interleukin-1 (IL-1) is a major regulator of inflammation and immunity. IL-1 induces T lymphocyte growth by acting as a second signal (together with antigen) in enhancing the production of interleukin-2 (IL-2). An IL-1-responsive element in the promoter region of the human IL-2 gene was similar to the binding site for the transcription factor AP-1. IL-1 enhanced expression of c-jun messenger RNA, whereas the antigenic signal enhanced messenger RNA expression of c-fos. Thus, the two components of the AP-1 factor are independently regulated and the AP-1 factor may serve as a nuclear mediator for the many actions of IL-1 on cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Muegge, K -- Williams, T M -- Kant, J -- Karin, M -- Chiu, R -- Schmidt, A -- Siebenlist, U -- Young, H A -- Durum, S K -- 5-T32-CA-09140/CA/NCI NIH HHS/ -- AI-R01-23879/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):249-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, Program Resources Inc., Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799385" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chloramphenicol O-Acetyltransferase/genetics ; Gene Expression Regulation ; Humans ; Interleukin-1/*physiology ; Interleukin-2/*genetics ; Mice ; Promoter Regions, Genetic/genetics ; Proto-Oncogene Proteins c-jun/*genetics ; Tetradecanoylphorbol Acetate/pharmacology ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...