ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (1,326)
  • American Association for the Advancement of Science (AAAS)  (1,326)
  • Annual Reviews
  • Springer Nature
  • 2005-2009  (208)
  • 1985-1989  (426)
  • 1980-1984  (692)
Collection
Keywords
Publisher
Years
Year
  • 1
    facet.materialart.
    Unknown
    Molecular cloning of odorant-binding protein: member of a ligand carrier family (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-07-15
    Description: Odorant-binding protein (OBP) is found in nasal epithelium, and it selectively binds odorants. Three complementary DNAs encoding rat odorant-binding protein have now been cloned and sequenced. One clone contains an open reading frame predicted to encode an 18,091-dalton protein. RNA blot analysis confirms the localization of OBP messenger RNA in the nasal epithelium. This OBP has 33 percent amino acid identity to alpha 2-microglobulin, a secreted plasma protein. Other members of an alpha 2-microglobulin superfamily bind and transport hydrophobic ligands. Thus, OBP probably binds and carries odorants within the nasal epithelium to putative olfactory receptors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pevsner, J -- Reed, R R -- Feinstein, P G -- Snyder, S H -- DA-00074/DA/NIDA NIH HHS/ -- GM-07626/GM/NIGMS NIH HHS/ -- P01 CA16519-13/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 15;241(4863):336-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388043" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Carrier Proteins/*genetics ; Cloning, Molecular ; Ligands ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Nasal Mucosa/*physiology ; Rats ; *Receptors, Odorant ; Smell/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Heat shock is lethal to fibroblasts microinjected with antibodies against hsp70 (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-10-21
    Description: Synthesis of a small group of highly conserved proteins in response to elevated temperature and other agents that induce stress is a universal feature of prokaryotic and eukaryotic cells. Although correlative evidence suggests that these proteins play a role in enhancing survival during and after stress, there is no direct evidence to support this in mammalian cells. To assess the role of the most highly conserved heat shock protein (hsp) family during heat shock, affinity-purified monoclonal antibodies to hsp70 were introduced into fibroblasts by needle microinjection. In addition to impairing the heat-induced translocation of hsp70 proteins into the nucleus after mild heat shock treatment, injected cells were unable to survive a brief incubation at 45 degrees C. Cells injected with control antibodies survived a similar heat shock. These results indicate that functional hsp70 is required for survival of these cells during and after thermal stress.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riabowol, K T -- Mizzen, L A -- Welch, W J -- GM33551/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Oct 21;242(4877):433-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cold Spring Harbor Laboratory, NY 11724.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3175665" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies/administration & dosage ; Antigen-Antibody Complex ; Cell Survival ; Fibroblasts/cytology ; Heat-Shock Proteins/immunology/*physiology ; *Hot Temperature ; Microinjections ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Grafting genetically modified cells to the damaged brain: restorative effects of NGF expression (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-16
    Description: Fibroblasts were genetically modified to secrete nerve growth factor (NGF) by infection with a retroviral vector and then implanted into the brains of rats that had surgical lesions of the fimbria-fornix. The grafted cells survived and produced sufficient NGF to prevent the degeneration of cholinergic neurons that would die without treatment. In addition, the protected cholinergic cells sprouted axons that projected in the direction of the cellular source of NGF. These results indicate that a combination of gene transfer and intracerebral grafting may provide an effective treatment for some disorders of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenberg, M B -- Friedmann, T -- Robertson, R C -- Tuszynski, M -- Wolff, J A -- Breakefield, X O -- Gage, F H -- AG06088/AG/NIA NIH HHS/ -- HD20034/HD/NICHD NIH HHS/ -- NS24279/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1575-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, University of California School of Medicine, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201248" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholinesterase/metabolism ; Animals ; Brain/cytology/enzymology/*pathology ; Cell Survival ; DNA/genetics ; Fibroblasts/metabolism/*transplantation ; Genetic Vectors ; Histocytochemistry ; Moloney murine leukemia virus/genetics ; Nerve Growth Factors/genetics/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Expression of c-fos protein in brain: metabolic mapping at the cellular level (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-06-03
    Description: The proto-oncogene c-fos is expressed in neurons in response to direct stimulation by growth factors and neurotransmitters. In order to determine whether the c-fos protein (Fos) and Fos-related proteins can be induced in response to polysynaptic activation, rat hindlimb motor/sensory cortex was stimulated electrically and Fos expression examined immunohistochemically. Three hours after the onset of stimulation, focal nuclear Fos staining was seen in motor and sensory thalamus, pontine nuclei, globus pallidus, and cerebellum. Moreover, 24-hour water deprivation resulted in Fos expression in paraventricular and supraoptic nuclei. Fos immunohistochemistry therefore provides a cellular method to label polysynaptically activated neurons and thereby map functional pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagar, S M -- Sharp, F R -- Curran, T -- EY05721/EY/NEI NIH HHS/ -- NS24666/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 3;240(4857):1328-31.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of California, San Francisco.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3131879" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/*metabolism ; Cell Nucleus/metabolism ; Cerebellum/metabolism ; Cerebral Cortex/metabolism ; Electric Stimulation ; *Gene Expression Regulation ; Globus Pallidus/metabolism ; Hippocampus/metabolism ; Hypothalamus/metabolism ; Immunohistochemistry ; Motor Cortex/physiology ; Neurons/metabolism ; Pons/metabolism ; Proto-Oncogene Proteins/*genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Thalamus/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Molecular crowding on the cell surface (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-01-01
    Description: Strong steric interactions among proteins on crowded living cell surfaces were revealed by measurements of the equilibrium spatial distributions of proteins in applied potential gradients. The fraction of accessible surface occupied by mobile surface proteins can be accurately represented by including steric exclusion in the statistical thermodynamic analysis of the data. The analyses revealed enhanced, concentration-dependent activity coefficients, implying unanticipated thermodynamic activity even at typical cell surface receptor concentrations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ryan, T A -- Myers, J -- Holowka, D -- Baird, B -- Webb, W W -- AI18306/AI/NIAID NIH HHS/ -- AI22449/AI/NIAID NIH HHS/ -- GM33028/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jan 1;239(4835):61-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physics, Cornell University, Ithaca, NY 14853.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2962287" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Membrane/*physiology ; *Membrane Fluidity ; Membrane Proteins/*physiology ; Rats ; Receptors, Fc/physiology ; Receptors, IgE ; Thermodynamics ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Mammalian glucocorticoid receptor derivatives enhance transcription in yeast (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-08-19
    Description: In mammalian cells, the glucocorticoid receptor binds specifically to glucocorticoid response element (GRE) DNA sequences and enhances transcription from linked promoters. It is shown here that derivatives of the glucocorticoid receptor also enhance transcription when expressed in yeast. Receptor-mediated enhancement in yeast was observed in fusions of GRE sequences to the yeast cytochrome c1 (CYC1) promoter; the CYC1 upstream activator sequences were not essential, since enhancement was observed in fusions of GREs to mutant CYC1 promoters retaining only the TATA region and transcription startpoints. It is concluded that the receptor operates by a common, highly conserved mechanism in yeast and mammalian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schena, M -- Yamamoto, K R -- CA20535-12/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Aug 19;241(4868):965-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3043665" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; DNA/metabolism ; *Enhancer Elements, Genetic ; Gene Expression Regulation ; Immunoassay ; Plasmids ; Promoter Regions, Genetic ; Rats ; Receptors, Glucocorticoid/*genetics ; Saccharomyces cerevisiae/*genetics ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    Astrocytes synthesize angiotensinogen in brain (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-09
    Description: Cell types associated with angiotensinogen mRNA in rat brain were identified in individual brain sections by in situ hybridization with tritiated RNA probes or with a sulfur-35--labeled oligonucleotide combined with immunocytochemical detection of either glial fibrillary acidic protein (GFAP) for astrocytes or microtubule-associated protein (MAP-2) for neurons. Autoradiography revealed silver grains clustered primarily over GFAP-reactive soma and processes; most grain clusters were not associated with MAP-2--reactive cells. These results demonstrate that, in contrast to other known neuropeptide precursors, angiotensinogen is synthesized by glia.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stornetta, R L -- Hawelu-Johnson, C L -- Guyenet, P G -- Lynch, K R -- R01 HL33513/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1444-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201232" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensinogen/*biosynthesis/genetics ; Animals ; Astrocytes/*metabolism ; Brain/*metabolism ; Glial Fibrillary Acidic Protein/analysis ; Histocytochemistry ; Microtubule-Associated Proteins/analysis ; Nucleic Acid Hybridization ; RNA, Messenger/analysis/genetics ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    Synaptic reorganization in the hippocampus induced by abnormal functional activity (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-03-04
    Description: Abnormal functional activity induces long-lasting physiological alterations in neural pathways that may play a role in the development of epilepsy. The cellular mechanisms of these alterations are not well understood. One hypothesis is that abnormal activity causes structural reorganization of neural pathways and promotes epileptogenesis. This report provides morphological evidence that synchronous perforant path activation and kindling of limbic pathways induce axonal growth and synaptic reorganization in the hippocampus, in the absence of overt morphological damage. The results show a previously unrecognized anatomic plasticity associated with synchronous activity and development of epileptic seizures in neural pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sutula, T -- He, X X -- Cavazos, J -- Scott, G -- K07-NS00808/NS/NINDS NIH HHS/ -- R29-NS25020/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Mar 4;239(4844):1147-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of Wisconsin, Madison 53792.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2449733" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/ultrastructure ; Cytoplasmic Granules/ultrastructure ; Electric Stimulation ; Electrophysiology ; Hippocampus/physiopathology/*ultrastructure ; Histocytochemistry ; Kindling, Neurologic ; Microscopy, Electron ; Neural Pathways/ultrastructure ; Neurons/ultrastructure ; Rats ; Seizures/*pathology/physiopathology ; Staining and Labeling ; Synapses/*ultrastructure
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    Cloning of a membrane protein that induces a slow voltage-gated potassium current (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-11-18
    Description: A rat kidney messenger RNA that induces a slowly activating, voltage-dependent potassium current on its expression in Xenopus oocytes was identified by combining molecular cloning with an electrophysiological assay. The cloned complementary DNA encodes a novel membrane protein that consists of 130 amino acids with a single putative transmembrane domain. This protein differs from the known ion channel proteins but is involved in the induction of selective permeation of potassium ions by membrane depolarization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takumi, T -- Ohkubo, H -- Nakanishi, S -- New York, N.Y. -- Science. 1988 Nov 18;242(4881):1042-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Immunology, Kyoto University Faculty of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3194754" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cloning, Molecular ; DNA/genetics ; Electric Conductivity ; Membrane Potentials ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Molecular Weight ; Potassium Channels/*physiology ; Rats ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    Vasopressin mRNA in the suprachiasmatic nuclei: daily regulation of polyadenylate tail length (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-07-15
    Description: Daily variation has been found in the length of the polyadenylate tail attached to vasopressin messenger RNA in the suprachiasmatic nuclei, which is the location of an endogenous circadian pacemaker in mammals. No such variation was found in the supraoptic or paraventricular nuclei. This variation in the length of the polyadenylate tail may underlie the circadian rhythm of vasopressin peptide levels in cerebrospinal fluid and is a unique example of a daily rhythm in messenger RNA structure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Robinson, B G -- Frim, D M -- Schwartz, W J -- Majzoub, J A -- 1P50HL36568/HL/NHLBI NIH HHS/ -- R01NS24542/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 15;241(4863):342-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388044" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arginine Vasopressin/*physiology ; Biological Clocks ; Circadian Rhythm ; Gene Expression Regulation ; Poly A/*physiology ; RNA, Messenger/*physiology ; Rats ; Suprachiasmatic Nucleus/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 11
    facet.materialart.
    Unknown
    In situ transcription: specific synthesis of complementary DNA in fixed tissue sections (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-06-17
    Description: A technique, in situ transcription, is described, in which reverse transcription of mRNAs is achieved within fixed tissue sections. An oligonucleotide complementary to proopiomelanocortin (POMC) mRNA was used as a primer for the specific synthesis of radiolabeled POMC cDNA in fixed sections of rat pituitary, thus permitting the rapid anatomical localization of POMC mRNA by autoradiography. Intermediate lobe signal intensities were sensitive to dopaminergic drugs, demonstrating that the method can be used for studies of mRNA regulation. The transcripts may also be eluted from tissue sections for a variety of uses, including the identification and cloning of autoradiographically localized cDNAs from small amounts of tissue.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tecott, L H -- Barchas, J D -- Eberwine, J H -- DA-05010/DA/NIDA NIH HHS/ -- MH-23861/MH/NIMH NIH HHS/ -- MH09099/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1661-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Nancy Pritzker Laboratory of Behavioral Neurochemistry, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2454508" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/*biosynthesis ; Deoxycytidine/metabolism ; Electrophoresis, Polyacrylamide Gel ; Nucleic Acid Denaturation ; Nucleic Acid Hybridization ; Oligonucleotides/genetics ; Pituitary Gland/*metabolism ; Pro-Opiomelanocortin/*genetics ; RNA, Messenger/*metabolism ; RNA-Directed DNA Polymerase/metabolism ; Rats ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 12
    facet.materialart.
    Unknown
    Imaging of phosphorescence: a novel method for measuring oxygen distribution in perfused tissue (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-23
    Description: The imaging of phosphorescence provides a method for monitoring oxygen distribution within the vascular system of intact tissues. Isolated rat lives were perfused through the portal vein with media containing palladium coproporphyrin, which phosphoresced and was used to image the liver at various perfusion rates. Because oxygen is a powerful quenching agent for phosphors, the transition from well-perfused liver to anoxia (no flow of oxygen) resulted in large increases of phosphorescence. During stepwise restoration of oxygen flow, the phosphorescence images showed marked heterogeneous patterns of tissue reoxygenation, which indicated that there were regional inequalities in oxygen delivery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rumsey, W L -- Vanderkooi, J M -- Wilson, D F -- GM 21524/GM/NIGMS NIH HHS/ -- GM 36393/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1649-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of Pennsylvania School of Medicine, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3420417" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Coproporphyrins ; Liver Circulation ; *Luminescence ; Male ; Oxygen/*analysis ; Palladium ; Perfusion ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 13
    facet.materialart.
    Unknown
    Two mechanisms for the extinction of gene expression in hybrid cells (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-02
    Description: When two different mammalian cell types are fused to generate a stable hybrid cell line, genes that are active in only one of the parents are frequently shut off, a phenomenon called extinction. In this study two distinct, complementary mechanisms for such extinction of growth hormone gene expression were identified. In hybrids formed by fusing fibroblasts to pituitary cells, pituitary-specific proteins that bind to the growth hormone promoter were absent. In addition, a negative regulatory element located near the rat growth hormone promoter was specifically activated.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tripputi, P -- Guerin, S L -- Moore, D D -- New York, N.Y. -- Science. 1988 Sep 2;241(4870):1205-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2842865" target="_blank"〉PubMed〈/a〉
    Keywords: Acetyltransferases/genetics ; Animals ; Avian Sarcoma Viruses/genetics ; Chloramphenicol O-Acetyltransferase ; Enhancer Elements, Genetic ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Growth Hormone/*genetics ; Herpesviridae/genetics ; Hybrid Cells/*metabolism ; Hypoxanthine Phosphoribosyltransferase/genetics ; L Cells (Cell Line) ; Mice ; Pituitary Gland/metabolism ; Plasmids ; Promoter Regions, Genetic ; Rats ; Thymidine Kinase/genetics ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 14
    facet.materialart.
    Unknown
    Newly identified brain potassium channels gated by the guanine nucleotide binding protein Go (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-09
    Description: Potassium channels in neurons are linked by guanine nucleotide binding (G) proteins to numerous neurotransmitter receptors. The ability of Go, the predominant G protein in the brain, to stimulate potassium channels was tested in cell-free membrane patches of hippocampal pyramidal neurons. Four distinct types of potassium channels, which were otherwise quiescent, were activated by both isolated brain G0 and recombinant Go alpha. Hence brain Go can couple diverse brain potassium channels to neurotransmitter receptors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉VanDongen, A M -- Codina, J -- Olate, J -- Mattera, R -- Joho, R -- Birnbaumer, L -- Brown, A M -- DK-19318/DK/NIDDK NIH HHS/ -- HL-31154/HL/NHLBI NIH HHS/ -- HL-37044/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1433-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Molecular Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3144040" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Imidodiphosphate/pharmacology ; Animals ; Cattle ; Electric Conductivity ; GTP-Binding Proteins/*pharmacology ; Hippocampus/*physiology ; In Vitro Techniques ; Kinetics ; Macromolecular Substances ; Membrane Potentials/drug effects ; Potassium Channels/drug effects/*physiology ; Pyramidal Tracts/physiology ; Rats ; Recombinant Proteins/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 15
    facet.materialart.
    Unknown
    Identification of an intracellular peptide segment involved in sodium channel inactivation (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-23
    Description: Antibodies directed against a conserved intracellular segment of the sodium channel alpha subunit slow the inactivation of sodium channels in rat muscle cells. Of four site-directed antibodies tested, only antibodies against the short intracellular segment between homologous transmembrane domains III and IV slowed inactivation, and their effects were blocked by the corresponding peptide antigen. No effects on the voltage dependence of sodium channel activation or of steady-state inactivation were observed, but the rate of onset of the antibody effect and the extent of slowing of inactivation were voltage-dependent. Antibody binding was more rapid at negative potentials, at which sodium channels are not inactivated; antibody-induced slowing of inactivation was greater during depolarizations to more positive membrane potentials. The peptide segment recognized by this antibody appears to participate directly in rapid sodium channel inactivation during large depolarizations and to undergo a conformational change that reduces its accessibility to antibodies as the channel inactivates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Vassilev, P M -- Scheuer, T -- Catterall, W A -- NS 15751/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Washington, School of Medicine, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2458625" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies ; Cytoplasm/analysis ; In Vitro Techniques ; Ion Channels/*metabolism ; Membrane Potentials ; Molecular Sequence Data ; Peptides/*metabolism ; Rats ; Sodium/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 16
    facet.materialart.
    Unknown
    Modulation of acetylcholine receptor desensitization by forskolin is independent of cAMP (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-06-17
    Description: Biochemical and electrophysiological studies suggest that adenosine 3',5'-monophosphate (cAMP)-dependent phosphorylation of the nicotinic acetylcholine receptor channel is functionally significant because it modifies the receptor's rate of desensitization to acetylcholine. In studies that support this conclusion researchers have used forskolin to stimulate cAMP-dependent phosphorylation in intact muscle. It is now shown that although forskolin facilitated desensitization in voltage-clamped rat muscle, this effect was not correlated with the abilities of forskolin and forskolin analogs to activate adenylate cyclase or phosphorylate the receptor. Furthermore, elevation of intracellular cAMP or addition of the catalytic subunit of A-kinase failed to alter desensitization. Therefore, in intact skeletal muscle, cAMP-dependent phosphorylation does not modulate desensitization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wagoner, P K -- Pallotta, B S -- GM32211/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1655-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Pharmacology, Glaxo Research Laboratories, Chapel Hill, NC 27599.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2454507" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-3-isobutylxanthine/pharmacology ; Acetylcholine/pharmacology ; Adenylyl Cyclases/metabolism ; Animals ; Bucladesine/pharmacology ; Colforsin/*pharmacology ; Cyclic AMP/analogs & derivatives/*pharmacology ; Electric Conductivity ; Enzyme Activation/drug effects ; Kinetics ; Muscles/*metabolism ; Phosphorylation ; Rats ; Receptors, Cholinergic/drug effects/*physiology ; Torpedo/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 17
    facet.materialart.
    Unknown
    Functional expression of a new pharmacological subtype of brain nicotinic acetylcholine receptor (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-04-15
    Description: A new type of agonist-binding subunit of rat neuronal nicotinic acetylcholine receptors (nAChRs) was identified. Rat genomic DNA and complementary DNA encoding this subunit (alpha 2) were cloned and analyzed. Complementary DNA expression studies in Xenopus oocytes revealed that the injection of messenger RNAs (mRNAs) for alpha 2 and beta 2 (a neuronal nAChR subunit) led to the generation of a functional nAChR. In contrast to the other known neuronal nAChRs, the receptor produced by the injection of alpha 2 and beta 2 mRNAs was resistant to the alpha-neurotoxin Bgt3.1. In situ hybridization histochemistry showed that alpha 2 mRNA was expressed in a small number of regions, in contrast to the wide distribution of the other known agonist-binding subunits (alpha 3 and alpha 4) mRNAs. These results demonstrate that the alpha 2 subunit differs from other known agonist-binding alpha-subunits of nAChRs in its distribution in the brain and in its pharmacology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wada, K -- Ballivet, M -- Boulter, J -- Connolly, J -- Wada, E -- Deneris, E S -- Swanson, L W -- Heinemann, S -- Patrick, J -- New York, N.Y. -- Science. 1988 Apr 15;240(4850):330-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Salk Institute for Biological Studies, San Diego, CA 92138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2832952" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Brain/*metabolism ; DNA Restriction Enzymes ; Female ; *Genes ; Molecular Sequence Data ; Neurons/metabolism ; Nucleotide Mapping ; Oocytes/metabolism ; Rats ; Receptors, Nicotinic/*genetics/metabolism ; Transcription, Genetic ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 18
    facet.materialart.
    Unknown
    Clonally related cortical cells show several migration patterns (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-09
    Description: The mammalian cerebral cortex is organized into columns of cells with common functional properties. During embryogenesis, cortical neurons are formed deep, near the lateral ventricles, and migrate radially to their final position. This observation led to the suggestion that the cortex consists of radial, ontogenetic units of clonally related neurons. In the experiments reported here, this hypothesis was tested by studying cell lineage in the rat cortex with a retroviral vector carrying the Escherichia coli beta-galactosidase gene, which can be easily visualized. Labeled, clonally related cortical neurons did not occur in simple columnar arrays. Instead, clonally related neurons entered several different radial columns, apparently by migrating along different radial glial fibers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Walsh, C -- Cepko, C L -- EY07331-01/EY/NEI NIH HHS/ -- R01 NS 23021-01/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1342-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3137660" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Movement ; Cerebral Cortex/cytology/*embryology ; Clone Cells ; Neuroglia/physiology ; Rats ; Transfection ; beta-Galactosidase/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 19
    facet.materialart.
    Unknown
    Muscarinic depression of long-term potentiation in CA3 hippocampal neurons (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-10-07
    Description: Behavioral studies have suggested that muscarinic cholinergic systems have an important role in learning and memory. A muscarinic cholinergic agonist is now shown to affect synaptic plasticity in the CA3 region of the hippocampal slice. Long-term potentiation (LTP) of the mossy fiber-CA3 synapse was blocked by muscarine. Low concentrations of muscarine (1 micromolar) had little effect on low-frequency (0.2 hertz) synaptic stimulation but did significantly reduce the magnitude and probability of induction of LTP. Experiments under voltage clamp showed that muscarine blocked the increase in excitatory synaptic conductance normally associated with LTP at this synapse. These results suggest a possible role for cholinergic systems in synaptic plasticity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Williams, S -- Johnston, D -- HL31164/HL/NHLBI NIH HHS/ -- NS11535/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Oct 7;242(4875):84-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2845578" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Electric Stimulation ; Evoked Potentials/drug effects ; Hippocampus/drug effects/*physiology ; In Vitro Techniques ; Muscarine/*pharmacology ; Neurons/drug effects/*physiology ; Pyramidal Tracts/drug effects/*physiology ; Rats ; Reference Values ; Synapses/physiology ; Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 20
    facet.materialart.
    Unknown
    Specific recognition of cruciform DNA by nuclear protein HMG1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 21
    facet.materialart.
    Unknown
    Expression of functional nerve growth factor receptors after gene transfer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 22
    facet.materialart.
    Unknown
    Indole-2-carboxylic acid: a competitive antagonist of potentiation by glycine at the NMDA receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 23
    facet.materialart.
    Unknown
    Effects of glucocorticoids and norepinephrine on the excitability in the hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 24
    facet.materialart.
    Unknown
    Fibroblasts transformed with v-src show enhanced formation of an inositol tetrakisphosphate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 25
    facet.materialart.
    Unknown
    Golf: an olfactory neuron specific-G protein involved in odorant signal transduction (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 26
    facet.materialart.
    Unknown
    Increased expression of DNA cointroduced with nuclear protein in adult rat liver (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 27
    facet.materialart.
    Unknown
    Corticosteroid modulation of hippocampal potentials: increased effect with aging (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 28
    facet.materialart.
    Unknown
    Potassium channels in cardiac cells activated by arachidonic acid and phospholipids (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 29
    facet.materialart.
    Unknown
    The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 30
    facet.materialart.
    Unknown
    The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 31
    facet.materialart.
    Unknown
    Secretion of activin by interstitial cells in the testis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 32
    facet.materialart.
    Unknown
    Atrial natriuretic peptide inhibits a cation channel in renal inner medullary collecting duct cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 33
    facet.materialart.
    Unknown
    Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 34
    facet.materialart.
    Unknown
    Specific block of calcium channel expression by a fragment of dihydropyridine receptor cDNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 35
    facet.materialart.
    Unknown
    Pavlovian conditioning of rat mucosal mast cells to secrete rat mast cell protease II (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 36
    facet.materialart.
    Unknown
    Relation of the amyloid beta protein precursor to heparan sulfate proteoglycans (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 37
    facet.materialart.
    Unknown
    Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 38
    facet.materialart.
    Unknown
    A pertussis toxin-sensitive G protein in hippocampal long-term potentiation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 39
    facet.materialart.
    Unknown
    Quisqualate activates a rapidly inactivating high conductance ionic channel in hippocampal neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 40
    facet.materialart.
    Unknown
    Beta-adrenergic inhibition of cardiac sodium channels by dual G-protein pathways (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 41
    facet.materialart.
    Unknown
    Brain region and gene specificity of neuropeptide gene expression in cultured astrocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 42
    facet.materialart.
    Unknown
    Inescapable versus escapable shock modulates long-term potentiation in the rat hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 43
    facet.materialart.
    Unknown
    Transneuronal transfer of herpes virus from peripheral nerves to cortex and brainstem (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 44
    facet.materialart.
    Unknown
    In vitro transcription enhancement by purified derivatives of the glucocorticoid receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 45
    facet.materialart.
    Unknown
    Pathological changes induced in cerebrocortical neurons by phencyclidine and related drugs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 46
    facet.materialart.
    Unknown
    Factors that predict individual vulnerability to amphetamine self-administration (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 47
    facet.materialart.
    Unknown
    Inhibitors of angiotensin-converting enzyme prevent myointimal proliferation after vascular injury (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 48
    facet.materialart.
    Unknown
    Glial cell diversification in the rat optic nerve (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 49
    facet.materialart.
    Unknown
    A genetic polymorphism in the renin gene of Dahl rats cosegregates with blood pressure (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 50
    facet.materialart.
    Unknown
    elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 51
    facet.materialart.
    Unknown
    Autoimmune target in Heymann nephritis is a glycoprotein with homology to the LDL receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 52
    facet.materialart.
    Unknown
    Treatment with tin prevents the development of hypertension in spontaneously hypertensive rats (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 53
    facet.materialart.
    Unknown
    Tonic activation of NMDA receptors by ambient glutamate enhances excitability of neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 54
    facet.materialart.
    Unknown
    High-level recombinant gene expression in rabbit endothelial cells transduced by retroviral vectors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 55
    facet.materialart.
    Unknown
    The neostriatal mosaic: striatal patch-matrix organization is related to cortical lamination (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 56
    facet.materialart.
    Unknown
    Identification of a thyroid hormone receptor that is pituitary-specific (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 57
    facet.materialart.
    Unknown
    Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 58
    facet.materialart.
    Unknown
    The EGF receptor kinase substrate p35 in the floor plate of the embryonic rat CNS (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 59
    facet.materialart.
    Unknown
    Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 60
    facet.materialart.
    Unknown
    Novel sites of expression of functional angiotensin II receptors in the late gestation fetus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 61
    facet.materialart.
    Unknown
    Expression of high-affinity binding of human immunoglobulin E by transfected cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 62
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 63
    facet.materialart.
    Unknown
    Regulation of calcium release is gated by calcium current, not gating charge, in cardiac myocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: In skeletal muscle, intramembrane charge movement initiates the processes that lead to the release of calcium from the sarcoplasmic reticulum. In cardiac muscle, in contrast, the similarity of the voltage dependence of developed tension and intracellular calcium transients to that of calcium current suggests that the calcium current may gate the release of calcium. Nevertheless, a mechanism similar to that of skeletal muscle continues to be postulated for cardiac muscle. By using rapid exchange (20 to 50 milliseconds) of the extracellular solutions in rat ventricular myocytes in which the intracellular calcium transients or cell shortening were measured, it has now been shown that the influx of calcium through the calcium channel is a mandatory link in the processes that couple membrane depolarization to the release of calcium. Thus, intramembrane charge movement does not contribute to the release of calcium in heart muscle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nabauer, M -- Callewaert, G -- Cleemann, L -- Morad, M -- R01-HL16152/HL/NHLBI NIH HHS/ -- R01-HL33720/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):800-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Pennsylvania, Department of Physiology, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543067" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Barium/metabolism/pharmacology ; Benzofurans ; Buffers ; Calcium/*metabolism ; Calcium Channels/*physiology ; Dialysis ; Egtazic Acid/pharmacology ; Extracellular Space/metabolism ; Fluorescent Dyes ; Fura-2 ; Heart/drug effects/*physiology ; Heart Ventricles ; Membrane Potentials ; Myocardial Contraction ; Rats ; Sarcoplasmic Reticulum/metabolism ; Sodium/metabolism ; Spectrometry, Fluorescence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 64
    facet.materialart.
    Unknown
    Angiotensin II: does it have a direct obligate role in ovulation? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Naftolin, F -- Andrade-Gordon, P -- Pellicer, A -- Palumbo, A -- Apa, R -- Zreik, T -- Yoon, T K -- DeCherney, A -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):870-1.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Obstetrics and Gynecology, Yale University, New Haven, CT 06510-8063.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772639" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Sarcosine-8-Isoleucine Angiotensin II/pharmacology ; Angiotensin II/*physiology ; Animals ; Chorionic Gonadotropin/pharmacology ; Female ; Gonadotropins, Equine/pharmacology ; *Ovulation ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/analysis ; Receptors, LH/analysis ; Saralasin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 65
    facet.materialart.
    Unknown
    Protection of dentate hilar cells from prolonged stimulation by intracellular calcium chelation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-13
    Description: Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein-negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Scharfman, H E -- Schwartzkroin, P A -- NS-01744/NS/NINDS NIH HHS/ -- NS-15317/NS/NINDS NIH HHS/ -- NS-18895/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):257-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2508225" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Calcium/*metabolism ; Calcium-Binding Proteins/metabolism ; Egtazic Acid/pharmacology ; Electric Stimulation ; Female ; Hippocampus/cytology/drug effects/*physiology ; In Vitro Techniques ; Neurons/drug effects/physiology ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 66
    facet.materialart.
    Unknown
    Selective loss of hippocampal granule cells in the mature rat brain after adrenalectomy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Adrenalectomy of adult male rats resulted in a nearly complete loss of hippocampal granule cells 3 to 4 months after surgery. Nissl and immunocytochemical staining of hippocampal neurons revealed that the granule cell loss was selective; there was no apparent loss of hippocampal pyramidal cells or of gamma-amino butyric acid (GABA)-, somatostatin-, neuropeptide Y-, calcium binding protein-, or parvalbumin-containing hippocampal interneurons. The hippocampal CA1 pyramidal cells of adrenalectomized animals exhibited normal electrophysiological responses to afferent stimulation, whereas responses evoked in the dentate gyrus were severely attenuated. Corticosterone replacement prevented both the adrenalectomy-induced granule cell loss and the attenuated physiological response. Thus, the adrenal glands play a role in maintaining the structural integrity of the normal adult brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sloviter, R S -- Valiquette, G -- Abrams, G M -- Ronk, E C -- Sollas, A L -- Paul, L A -- Neubort, S -- NS18201/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):535-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurology Research Center, Helen Hayes Hospital, New York State Department of Health, West Haverstraw 10993.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911756" target="_blank"〉PubMed〈/a〉
    Keywords: *Adrenalectomy ; Animals ; Annexin A6 ; Calcium-Binding Proteins/analysis ; Corticosterone/pharmacology ; Cytoplasmic Granules ; Electrophysiology ; Evoked Potentials ; Hippocampus/*cytology/drug effects/physiology ; Immunohistochemistry ; Male ; Neurons/cytology/physiology ; Potassium/blood ; Rats ; Sodium/blood ; Weight Gain
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 67
    facet.materialart.
    Unknown
    Hyperpolarizing vasodilators activate ATP-sensitive K+ channels in arterial smooth muscle (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Vasodilators are used clinically for the treatment of hypertension and heart failure. The effects of some vasodilators seem to be mediated by membrane hyperpolarization. The molecular basis of this hyperpolarization has been investigated by examining the properties of single K+ channels in arterial smooth muscle cells. The presence of adenosine triphosphate (ATP)-sensitive K+ channels in these cells was demonstrated at the single channel level. These channels were opened by the hyperpolarizing vasodilator cromakalim and inhibited by the ATP-sensitive K+ channel blocker glibenclamide. Furthermore, in arterial rings the vasorelaxing actions of the drugs diazoxide, cromakalim, and pinacidil and the hyperpolarizing actions of vasoactive intestinal polypeptide and acetylcholine were blocked by inhibitors of the ATP-sensitive K+ channels, suggesting that all these agents may act through a common pathway in smooth muscle by opening ATP-sensitive K+ channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Standen, N B -- Quayle, J M -- Davies, N W -- Brayden, J E -- Huang, Y -- Nelson, M T -- HL 35911/HL/NHLBI NIH HHS/ -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):177-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Leicester, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501869" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholine/pharmacology ; Adenosine Triphosphate/*metabolism ; Animals ; Benzopyrans/antagonists & inhibitors/pharmacology ; Cerebral Arteries ; Cromakalim ; Diazoxide/pharmacology ; Glyburide/pharmacology ; Guanidines/pharmacology ; Mesenteric Arteries ; Muscle, Smooth, Vascular/*metabolism ; Pinacidil ; Potassium Channels/*drug effects/metabolism ; Pyrroles/antagonists & inhibitors/pharmacology ; Rabbits ; Rats ; Tolbutamide/pharmacology ; Vasoactive Intestinal Peptide/pharmacology ; Vasodilator Agents/antagonists & inhibitors/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 68
    facet.materialart.
    Unknown
    NMDA antagonists differentiate epileptogenesis from seizure expression in an in vitro model (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: In an electrographic model of seizures in the hippocampal slice, both of the N-methyl-D-aspartate (NMDA) antagonists 2-amino-5-phosphonovaleric acid and 5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohepten-5,10-imine maleate (MK-801) prevented the progressive development of seizures but did not block previously induced seizures. Thus, a process dependent on the NMDA receptor-ionophore complex establishes a long-lasting, seizure-prone state; thereafter the seizures depend on non-NMDA receptor-ionophore mechanisms. This suggests that there is an important distinction between epileptogenesis and seizure expression and between antiepileptogenic and anticonvulsant pharmacological agents.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stasheff, S F -- Anderson, W W -- Clark, S -- Wilson, W A -- NS 17771/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):648-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Epilepsy Center, Veterans Administration Medical Center, Durham, NC 27705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569762" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate ; Animals ; Anticonvulsants/pharmacology ; Aspartic Acid/*analogs & derivatives/antagonists & inhibitors ; Dibenzocycloheptenes/pharmacology ; *Disease Models, Animal ; Dizocilpine Maleate ; Electric Stimulation ; Electrophysiology ; Epilepsy/*physiopathology ; Evoked Potentials ; Hippocampus/*physiopathology ; In Vitro Techniques ; N-Methylaspartate ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Seizures/*physiopathology ; Valine/analogs & derivatives/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 69
    facet.materialart.
    Unknown
    Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The discovery that the AP-1 family of enhancer binding factors includes a complex of the cellular Fos (cFos) and cellular Jun (cJun) proteins established a direct and important link between oncogenesis and transcriptional regulation. Homodimeric cJun protein synthesized in vitro is capable of binding selectively to AP-1 recognition sites, whereas the cFos polypeptide is not. When cotranslated, the cFos and cJun proteins can form a stable, heterodimeric complex with the DNA binding properties of AP-1/cJun. The related proteins Jun B and vJun are also able to form DNA binding complexes with cFos. Directed mutagenesis of the cFos protein reveals that a leucine repeat structure is required for binding to cJun, in a manner consistent with the proposed function of the "leucine zipper." A novel domain adjacent to, but distinct from, the leucine repeat of cFos is required for DNA binding by cFos-cJun heterodimers. Thus experimental evidence is presented that leucine repeats can mediate complex formation between heterologous proteins and that promotes further understanding of the molecular mechanisms underlying the function of two proto-oncogene products.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turner, R -- Tjian, R -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1689-94.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494701" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Chromatography, Affinity ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation ; Humans ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Oncogenes ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 70
    facet.materialart.
    Unknown
    The cholinergic neuronal differentiation factor from heart cells is identical to leukemia inhibitory factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 71
    facet.materialart.
    Unknown
    Two NF1 translocations map within a 600-kilobase segment of 17q11.2 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-02
    Description: Balanced translocations, each involving chromosome 17q11.2, have been described in two patients with von Recklinghausen neurofibromatosis (NF1). To better localize the end points of these translocation events, and the NF1 gene (NF1) itself, human cosmids were isolated and mapped in the immediate vicinity of NF1. One cosmid probe, c11-1F10, demonstrated that both translocation breakpoints, and presumably NF1, are contained within a 600-kilobase Nru I fragment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Connell, P -- Leach, R -- Cawthon, R M -- Culver, M -- Stevens, J -- Viskochil, D -- Fournier, R E -- Rich, D C -- Ledbetter, D H -- White, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1087-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of Utah, Salt Lake City 84132.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543077" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Mapping ; *Chromosomes, Human, Pair 17 ; Cosmids ; DNA Restriction Enzymes ; Deoxyribonucleases, Type II Site-Specific ; Electrophoresis ; Genetic Linkage ; Humans ; Hybrid Cells ; Neurofibromatosis 1/*genetics ; Rats ; *Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 72
    facet.materialart.
    Unknown
    Parallel association of Fos and Jun leucine zippers juxtaposes DNA binding domains (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The protein products of the fos and jun proto-oncogenes form a heterodimeric complex that participates in a stable high affinity interaction with DNA elements containing AP-1 binding sites. The effects of deletions and point mutations in Fos and Jun on protein complex formation and DNA binding have been examined. The data suggest that Fos and Jun dimerize via a parallel interaction of helical domains containing a heptad repeat of leucine residues (the leucine zipper). Dimerization is required for DNA binding and results in the appropriate juxtaposition of basic amino acid regions from Fos and Jun, both of which are required for association with DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gentz, R -- Rauscher, F J 3rd -- Abate, C -- Curran, T -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1695-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Oncology, Roche Institute of Molecular Biology, Nutley, NJ 07110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494702" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Cross-Linking Reagents ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Glutaral ; Immunosorbent Techniques ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Protein Conformation ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 73
    facet.materialart.
    Unknown
    Histone H5 in the control of DNA synthesis and cell proliferation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: The linker histones (H1, H5, H1 degrees) are involved in the condensation of chromatin into the 30-nanometer fiber. This supranucleosome organization correlates with the resting state of chromatin, and it is therefore possible that the linker histones play an active role in the control of chromatin activity. The effect of H5 has been directly determined by expression of an inducible transfected H5 gene in rat sarcoma cells, which do not produce H5. Transfection resulted in the reversible inhibition of DNA replication and arrest of cells in G1, at which time H5 concentrations approached that of terminally differentiated avian erythrocytes. The arrest of proliferation was accompanied by specific changes in gene expression probably related to the cell cycle block. The selectivity of these effects suggest that H5 plays an active role in the control of DNA replication and cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, J M -- Wiaderkiewicz, R -- Ruiz-Carrillo, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):68-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cancer Research Center, Laval University School of Medicine, L'Hotel-Dieu du Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740916" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Cycle ; Cell Division ; Cell Line ; Chickens ; DNA/*biosynthesis ; *DNA Replication ; Histones/genetics/*physiology ; Rats ; Receptors, Glucocorticoid/biosynthesis ; Recombinant Proteins/pharmacology ; Sarcoma, Experimental ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 74
    facet.materialart.
    Unknown
    Amyloid beta protein enhances the survival of hippocampal neurons in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: The beta-amyloid protein is progressively deposited in Alzheimer's disease as vascular amyloid and as the amyloid cores of neuritic plaques. Contrary to its metabolically inert appearance, this peptide may have biological activity. To evaluate this possibility, a peptide ligand homologous to the first 28 residues of the beta-amyloid protein (beta 1-28) was tested in cultures of hippocampal pyramidal neurons for neurotrophic or neurotoxic effects. The beta 1-28 appeared to have neurotrophic activity because it enhanced neuronal survival under the culture conditions examined. This finding may help elucidate the sequence of events leading to plaque formation and neuronal damage in Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Whitson, J S -- Selkoe, D J -- Cotman, C W -- AG00538/AG/NIA NIH HHS/ -- AG07918/AG/NIA NIH HHS/ -- MH19691/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1488-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928783" target="_blank"〉PubMed〈/a〉
    Keywords: Amyloid/*pharmacology ; *Amyloid beta-Peptides ; *Amyloid beta-Protein Precursor ; Animals ; Cell Adhesion/drug effects ; Cell Survival ; Cells, Cultured ; Hippocampus/*cytology/embryology ; Neurons/cytology ; Peptide Fragments/*pharmacology ; Rats ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 75
    facet.materialart.
    Unknown
    Neural connections between the lateral geniculate nucleus and visual cortex in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Neural connections were established in cocultures of rat visual cortex (VC) and lateral geniculate nucleus (LGN), which were isolated in early infancy. Morphological and electrophysiological studies showed that the cortical laminar organization of afferent and efferent connections in the coculture preparations was similar to that in the adult VC. The results indicate the existence of intrinsic mechanisms in VC and LGN that guide the formation of synaptic connections with the appropriate targets.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamoto, N -- Kurotani, T -- Toyama, K -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):192-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Kyoto Prefectural School of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749258" target="_blank"〉PubMed〈/a〉
    Keywords: Afferent Pathways/physiology ; Animals ; Axons/physiology ; Culture Techniques ; Efferent Pathways/physiology ; Electrophysiology ; Geniculate Bodies/cytology/*physiology ; Organ Culture Techniques ; Rats ; Rats, Inbred Strains ; Synapses/physiology ; Visual Cortex/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 76
    facet.materialart.
    Unknown
    The periaqueductal gray matter mediates opiate-induced immunosuppression (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The periaqueductal gray matter of the mesencephalon (PAG) subserves a variety of diverse autonomic functions and also appears to be a site for opiate action in the induction of immunosuppression. Microinjections of morphine into the PAG, but not into other opiate receptor-containing neuroanatomical sites, result in a rapid suppression of natural killer (NK) cell activity. The NK cell suppression can be blocked by prior peripheral administration of the opiate antagonist naltrexone. These findings demonstrate that certain central actions of opiates that produce changes in NK cell function are mediated through opiate receptors in the PAG and identify a brain region involved in opiate regulation of immune function.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weber, R J -- Pert, A -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):188-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Medicinal Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749256" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immune Tolerance ; Killer Cells, Natural/drug effects/immunology ; Male ; Mesencephalon/drug effects/*immunology ; Microinjections ; Morphine/administration & dosage/antagonists & inhibitors/*pharmacology ; Naltrexone/pharmacology ; Rats ; Rats, Inbred F344
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 77
    facet.materialart.
    Unknown
    Characterization of the piRNA complex from rat testes (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-06-17
    Description: Small noncoding RNAs regulate processes essential for cell growth and development, including mRNA degradation, translational repression, and transcriptional gene silencing (TGS). During a search for candidate mammalian factors for TGS, we purified a complex that contains small RNAs and Riwi, the rat homolog to human Piwi. The RNAs, frequently 29 to 30 nucleotides in length, are called Piwi-interacting RNAs (piRNAs), 94% of which map to 100 defined (〈 or = 101 kb) genomic regions. Within these regions, the piRNAs generally distribute across only one genomic strand or distribute on two strands but in a divergent, nonoverlapping manner. Preparations of piRNA complex (piRC) contain rRecQ1, which is homologous to qde-3 from Neurospora, a gene implicated in silencing pathways. Piwi has been genetically linked to TGS in flies, and slicer activity cofractionates with the purified complex. These results are consistent with a gene-silencing role for piRC in mammals.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lau, Nelson C -- Seto, Anita G -- Kim, Jinkuk -- Kuramochi-Miyagawa, Satomi -- Nakano, Toru -- Bartel, David P -- Kingston, Robert E -- New York, N.Y. -- Science. 2006 Jul 21;313(5785):363-7. Epub 2006 Jun 15.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, 185 Cambridge Street, Boston, MA 02114, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16778019" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphatases/isolation & purification/metabolism ; Animals ; Chromosomes, Mammalian ; Conserved Sequence ; DNA Helicases/isolation & purification/metabolism ; Gene Library ; Genome ; Male ; Mice ; Proteins/isolation & purification/*metabolism ; *RNA Interference ; RNA, Untranslated/chemistry/genetics/isolation & purification/*metabolism ; Rats ; Rats, Sprague-Dawley ; RecQ Helicases ; Ribonucleoproteins/chemistry/isolation & purification/*metabolism ; Testis/*chemistry ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 78
    facet.materialart.
    Unknown
    A clamping mechanism involved in SNARE-dependent exocytosis (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-06-24
    Description: During neurotransmitter release at the synapse, influx of calcium ions stimulates the release of neurotransmitter. However, the mechanism by which synaptic vesicle fusion is coupled to calcium has been unclear, despite the identification of both the core fusion machinery [soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE)] and the principal calcium sensor (synaptotagmin). Here, we describe what may represent a basic principle of the coupling mechanism: a reversible clamping protein (complexin) that can freeze the SNAREpin, an assembled fusion-competent intermediate en route to fusion. When calcium binds to the calcium sensor synaptotagmin, the clamp would then be released. SNARE proteins, and key regulators like synaptotagmin and complexin, can be ectopically expressed on the cell surface. Cells expressing such "flipped" synaptic SNAREs fuse constitutively, but when we coexpressed complexin, fusion was blocked. Adding back calcium triggered fusion from this intermediate in the presence of synaptotagmin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Giraudo, Claudio G -- Eng, William S -- Melia, Thomas J -- Rothman, James E -- New York, N.Y. -- Science. 2006 Aug 4;313(5787):676-80. Epub 2006 Jun 22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Cellular Biophysics, Columbia University, New York, NY 10032, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16794037" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptor Proteins, Vesicular Transport ; Animals ; Calcium/metabolism ; Cell Membrane/metabolism ; *Exocytosis ; Glycosylphosphatidylinositols/metabolism ; HeLa Cells ; Humans ; Nerve Tissue Proteins/*metabolism ; Rats ; Recombinant Proteins/metabolism ; SNARE Proteins/*metabolism ; Synaptotagmin I/metabolism ; Synaptotagmins/metabolism ; Type C Phospholipases/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 79
    facet.materialart.
    Unknown
    A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-06-10
    Description: Bacterial pathogens frequently use protein secretion to mediate interactions with their hosts. Here we found that a virulence locus (HSI-I) of Pseudomonas aeruginosa encodes a protein secretion apparatus. The apparatus assembled in discrete subcellular locations and exported Hcp1, a hexameric protein that forms rings with a 40 angstrom internal diameter. Regulatory patterns of HSI-I suggested that the apparatus functions during chronic infections. We detected Hcp1 in pulmonary secretions of cystic fibrosis (CF) patients and Hcp1-specific antibodies in their sera. Thus, HSI-I likely contributes to the pathogenesis of P. aeruginosa in CF patients. HSI-I-related loci are widely distributed among bacterial pathogens and may play a general role in mediating host interactions.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2800167/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2800167/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mougous, Joseph D -- Cuff, Marianne E -- Raunser, Stefan -- Shen, Aimee -- Zhou, Min -- Gifford, Casey A -- Goodman, Andrew L -- Joachimiak, Grazyna -- Ordonez, Claudia L -- Lory, Stephen -- Walz, Thomas -- Joachimiak, Andrzej -- Mekalanos, John J -- AI21451/AI/NIAID NIH HHS/ -- AI26289/AI/NIAID NIH HHS/ -- GM074942/GM/NIGMS NIH HHS/ -- GM62414/GM/NIGMS NIH HHS/ -- P50 GM062414/GM/NIGMS NIH HHS/ -- P50 GM062414-02/GM/NIGMS NIH HHS/ -- U54 GM074942/GM/NIGMS NIH HHS/ -- U54 GM074942-04S2/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 2006 Jun 9;312(5779):1526-30.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA 02115, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16763151" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bacterial Proteins/*genetics/physiology/secretion ; Crystallography, X-Ray ; Cystic Fibrosis/complications/microbiology ; Humans ; Models, Molecular ; Protein Conformation ; Pseudomonas Infections/complications/microbiology ; Pseudomonas aeruginosa/*genetics/pathogenicity ; Rats ; Recombinant Fusion Proteins ; Sequence Alignment ; Virulence/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 80
    facet.materialart.
    Unknown
    American Society for Cell Biology. Sprayed-on growth factors guide stem cells (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-12-23
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Leslie, Mitch -- New York, N.Y. -- Science. 2006 Dec 22;314(5807):1865.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17185579" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bone Morphogenetic Proteins/*pharmacology ; Bone and Bones/*cytology ; Cell Differentiation ; Cell Lineage ; Cells, Cultured ; Extracellular Matrix ; Myoblasts/cytology ; Rats ; Stem Cells/*cytology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 81
    facet.materialart.
    Unknown
    Evolution of hormone-receptor complexity by molecular exploitation (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-04-08
    Description: According to Darwinian theory, complexity evolves by a stepwise process of elaboration and optimization under natural selection. Biological systems composed of tightly integrated parts seem to challenge this view, because it is not obvious how any element's function can be selected for unless the partners with which it interacts are already present. Here we demonstrate how an integrated molecular system-the specific functional interaction between the steroid hormone aldosterone and its partner the mineralocorticoid receptor-evolved by a stepwise Darwinian process. Using ancestral gene resurrection, we show that, long before the hormone evolved, the receptor's affinity for aldosterone was present as a structural by-product of its partnership with chemically similar, more ancient ligands. Introducing two amino acid changes into the ancestral sequence recapitulates the evolution of present-day receptor specificity. Our results indicate that tight interactions can evolve by molecular exploitation-recruitment of an older molecule, previously constrained for a different role, into a new functional complex.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bridgham, Jamie T -- Carroll, Sean M -- Thornton, Joseph W -- F32-GM074398/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 2006 Apr 7;312(5770):97-101.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Ecology and Evolutionary Biology, University of Oregon, Eugene, OR 97403, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16601189" target="_blank"〉PubMed〈/a〉
    Keywords: Aldosterone/chemistry/*metabolism ; Amino Acid Substitution ; Animals ; Bayes Theorem ; Binding Sites ; Desoxycorticosterone/metabolism ; *Evolution, Molecular ; Gene Duplication ; Hagfishes ; Hydrocortisone/metabolism ; Lampreys ; Ligands ; Mutation ; Perciformes ; Phylogeny ; Rats ; Receptors, Glucocorticoid/chemistry/genetics/metabolism ; Receptors, Mineralocorticoid/chemistry/*genetics/*metabolism ; Receptors, Steroid/chemistry/*genetics/*metabolism ; Skates (Fish)
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 82
    facet.materialart.
    Unknown
    Cortex is driven by weak but synchronously active thalamocortical synapses (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-06-17
    Description: Sensory stimuli reach the brain via the thalamocortical projection, a group of axons thought to be among the most powerful in the neocortex. Surprisingly, these axons account for only approximately 15% of synapses onto cortical neurons. The thalamocortical pathway might thus achieve its effectiveness via high-efficacy thalamocortical synapses or via amplification within cortical layer 4. In rat somatosensory cortex, we measured in vivo the excitatory postsynaptic potential evoked by a single synaptic connection and found that thalamocortical synapses have low efficacy. Convergent inputs, however, are both numerous and synchronous, and intracortical amplification is not required. Our results suggest a mechanism of cortical activation by which thalamic input alone can drive cortex.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bruno, Randy M -- Sakmann, Bert -- New York, N.Y. -- Science. 2006 Jun 16;312(5780):1622-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Physiology, Max Planck Institute for Medical Research, Jahnstrasse 29, 69120 Heidelberg, Germany. bruno@mpimf-heidelberg.mpg.de〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16778049" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials ; Animals ; Axons/physiology ; Dendrites/physiology ; Electric Stimulation ; Excitatory Postsynaptic Potentials ; Membrane Potentials ; Neural Pathways ; Neurons/*physiology ; Rats ; Rats, Wistar ; Somatosensory Cortex/cytology/*physiology ; Synapses/*physiology ; *Synaptic Transmission ; Thalamus/cytology/*physiology ; Vibrissae/innervation/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 83
    facet.materialart.
    Unknown
    Ca2+ entry through plasma membrane IP3 receptors (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-07-15
    Description: Inositol 1,4,5-trisphosphate receptors (IP3Rs) release calcium ions, Ca2+, from intracellular stores, but their roles in mediating Ca2+ entry are unclear. IP3 stimulated opening of very few (1.9 +/- 0.2 per cell) Ca2+-permeable channels in whole-cell patch-clamp recording of DT40 chicken or mouse B cells. Activation of the B cell receptor (BCR) in perforated-patch recordings evoked the same response. IP3 failed to stimulate intracellular or plasma membrane (PM) channels in cells lacking IP3R. Expression of IP3R restored both responses. Mutations within the pore affected the conductances of IP3-activated PM and intracellular channels similarly. An impermeant pore mutant abolished BCR-evoked Ca2+ signals, and PM IP3Rs were undetectable. After introduction of an alpha-bungarotoxin binding site near the pore, PM IP3Rs were modulated by extracellular alpha-bungarotoxin. IP(3)Rs are unusual among endoplasmic reticulum proteins in being also functionally expressed at the PM, where very few IP3Rs contribute substantially to the Ca2+ entry evoked by the BCR.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dellis, Olivier -- Dedos, Skarlatos G -- Tovey, Stephen C -- Taufiq-Ur-Rahman -- Dubel, Stefan J -- Taylor, Colin W -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 2006 Jul 14;313(5784):229-33.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Tennis Court Road, Cambridge, CB2 1PD, UK.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16840702" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; B-Lymphocytes/metabolism ; Bungarotoxins/metabolism/pharmacology ; Calcium/*metabolism ; Calcium Channels/genetics/*metabolism ; *Calcium Signaling ; Cell Membrane/*metabolism ; Cells, Cultured ; Chickens ; Electric Conductivity ; Endoplasmic Reticulum/metabolism ; Inositol 1,4,5-Trisphosphate/metabolism ; Inositol 1,4,5-Trisphosphate Receptors ; *Ion Channel Gating ; Mice ; Nuclear Envelope/metabolism ; Patch-Clamp Techniques ; Point Mutation ; Rats ; Receptors, Antigen, B-Cell/metabolism ; Receptors, Cytoplasmic and Nuclear/antagonists & inhibitors/genetics/*metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 84
    facet.materialart.
    Unknown
    Genetic variant BDNF (Val66Met) polymorphism alters anxiety-related behavior (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-10-07
    Description: A common single-nucleotide polymorphism in the brain-derived neurotrophic factor (BDNF) gene, a methionine (Met) substitution for valine (Val) at codon 66 (Val66Met), is associated with alterations in brain anatomy and memory, but its relevance to clinical disorders is unclear. We generated a variant BDNF mouse (BDNF(Met/Met)) that reproduces the phenotypic hallmarks in humans with the variant allele. BDNF(Met) was expressed in brain at normal levels, but its secretion from neurons was defective. When placed in stressful settings, BDNF(Met/Met) mice exhibited increased anxiety-related behaviors that were not normalized by the antidepressant, fluoxetine. A variant BDNF may thus play a key role in genetic predispositions to anxiety and depressive disorders.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1880880/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1880880/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chen, Zhe-Yu -- Jing, Deqiang -- Bath, Kevin G -- Ieraci, Alessandro -- Khan, Tanvir -- Siao, Chia-Jen -- Herrera, Daniel G -- Toth, Miklos -- Yang, Chingwen -- McEwen, Bruce S -- Hempstead, Barbara L -- Lee, Francis S -- MH060478/MH/NIMH NIH HHS/ -- MH068850/MH/NIMH NIH HHS/ -- NS052819/NS/NINDS NIH HHS/ -- NS30687/NS/NINDS NIH HHS/ -- R01 NS052819/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 2006 Oct 6;314(5796):140-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Weill Medical College of Cornell University, New York, NY 10021, USA. zheyuchen@sdu.edu.cn〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17023662" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; Anxiety/drug therapy/*genetics ; Behavior, Animal ; Brain-Derived Neurotrophic Factor/*genetics/*physiology ; Conditioning (Psychology) ; Dendrites/ultrastructure ; Dentate Gyrus/cytology ; Fear ; Fluoxetine/administration & dosage/pharmacology ; Hippocampus/anatomy & histology/metabolism ; Memory ; Mice ; Mice, Inbred C57BL ; Mice, Transgenic ; Motor Activity ; Neurons/cytology/metabolism ; Organ Size ; *Polymorphism, Single Nucleotide ; Rats ; Rats, Sprague-Dawley ; Serotonin Uptake Inhibitors/administration & dosage/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 85
    facet.materialart.
    Unknown
    Applied physics. High-speed atomic force microscopy (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-10-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hansma, Paul K -- Schitter, Georg -- Fantner, Georg E -- Prater, Craig -- GM 65354/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 2006 Oct 27;314(5799):601-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physics, University of California, Santa Barbara, CA 93106, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17068247" target="_blank"〉PubMed〈/a〉
    Keywords: Algorithms ; Animals ; Collagen/ultrastructure ; Electronics ; *Microscopy, Atomic Force/instrumentation/methods ; Rats ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 86
    facet.materialart.
    Unknown
    Neuroscience. Neurons find strength through synchrony in the brain (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-06-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Alonso, Jose-Manuel -- New York, N.Y. -- Science. 2006 Jun 16;312(5780):1604-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Sciences, State University of New York College of Optometry, New York, NY 10036, USA. jalonso@sunyopt.edu〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16778042" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Excitatory Postsynaptic Potentials ; Mice ; Neural Pathways ; Neurons/*physiology ; Rats ; Somatosensory Cortex/*physiology ; Synapses/*physiology ; *Synaptic Transmission ; Thalamus/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 87
    facet.materialart.
    Unknown
    Alterations in 5-HT1B receptor function by p11 in depression-like states (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-01-10
    Description: The pathophysiology of depression remains enigmatic, although abnormalities in serotonin signaling have been implicated. We have found that the serotonin 1B receptor [5-hydroxytryptamine (5-HT1B) receptor] interacts with p11. p11 increases localization of 5-HT1B receptors at the cell surface. p11 is increased in rodent brains by antidepressants or electroconvulsive therapy, but decreased in an animal model of depression and in brain tissue from depressed patients. Overexpression of p11 increases 5-HT1B receptor function in cells and recapitulates certain behaviors seen after antidepressant treatment in mice. p11 knockout mice exhibit a depression-like phenotype and have reduced responsiveness to 5-HT1B receptor agonists and reduced behavioral reactions to an antidepressant.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Svenningsson, Per -- Chergui, Karima -- Rachleff, Ilan -- Flajolet, Marc -- Zhang, Xiaoqun -- El Yacoubi, Malika -- Vaugeois, Jean-Marie -- Nomikos, George G -- Greengard, Paul -- DA10044/DA/NIDA NIH HHS/ -- MH40899/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 2006 Jan 6;311(5757):77-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular and Cellular Neuroscience, Rockefeller University, New York, NY 10021, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16400147" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Aged ; Animals ; Annexin A2/genetics/*metabolism ; Antidepressive Agents/pharmacology ; Behavior, Animal/drug effects ; Brain/drug effects/metabolism ; Cell Membrane/metabolism ; Depression/genetics/*metabolism ; Electroconvulsive Therapy ; Female ; Humans ; Male ; Mice ; Mice, Knockout ; Mice, Transgenic ; Middle Aged ; Neurons/metabolism ; Rats ; Receptor, Serotonin, 5-HT1B/*metabolism ; S100 Proteins/genetics/*metabolism ; Serotonin/metabolism/physiology ; Signal Transduction ; Two-Hybrid System Techniques
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 88
    facet.materialart.
    Unknown
    Chemistry. Toward molecular imaging with xenon MRI (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-10-21
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Driehuys, Bastiaan -- New York, N.Y. -- Science. 2006 Oct 20;314(5798):432-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiology, Center for In Vivo Microscopy, Duke University Medical Center, Durham, NC 27710, USA. driehuys@orion.duhs.duke.edu〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17053138" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Atherosclerosis/diagnosis/physiopathology ; *Biosensing Techniques ; Humans ; Lung/anatomy & histology ; Magnetic Resonance Imaging/*methods ; Magnetic Resonance Spectroscopy ; Rats ; Sensitivity and Specificity ; *Xenon Isotopes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 89
    facet.materialart.
    Unknown
    Excitatory effect of GABAergic axo-axonic cells in cortical microcircuits (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-01-18
    Description: Axons in the cerebral cortex receive synaptic input at the axon initial segment almost exclusively from gamma-aminobutyric acid-releasing (GABAergic) axo-axonic cells (AACs). The axon has the lowest threshold for action potential generation in neurons; thus, AACs are considered to be strategically placed inhibitory neurons controlling neuronal output. However, we found that AACs can depolarize pyramidal cells and can initiate stereotyped series of synaptic events in rat and human cortical networks because of a depolarized reversal potential for axonal relative to perisomatic GABAergic inputs. Excitation and signal propagation initiated by AACs is supported by the absence of the potassium chloride cotransporter 2 in the axon.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Szabadics, Janos -- Varga, Csaba -- Molnar, Gabor -- Olah, Szabolcs -- Barzo, Pal -- Tamas, Gabor -- N535915/PHS HHS/ -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 2006 Jan 13;311(5758):233-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Comparative Physiology, University of Szeged, Kozep fasor 52, Szeged, H-6726, Hungary.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16410524" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials ; Animals ; Axons/*physiology ; Cerebral Cortex/*cytology/physiology ; Excitatory Postsynaptic Potentials ; Humans ; In Vitro Techniques ; Middle Aged ; Neural Inhibition ; Neurons/*physiology ; Pyramidal Cells/physiology ; Rats ; Rats, Wistar ; Symporters/metabolism ; gamma-Aminobutyric Acid/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 90
    facet.materialart.
    Unknown
    Conjunctive representation of position, direction, and velocity in entorhinal cortex (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-05-06
    Description: Grid cells in the medial entorhinal cortex (MEC) are part of an environment-independent spatial coordinate system. To determine how information about location, direction, and distance is integrated in the grid-cell network, we recorded from each principal cell layer of MEC in rats that explored two-dimensional environments. Whereas layer II was predominated by grid cells, grid cells colocalized with head-direction cells and conjunctive grid x head-direction cells in the deeper layers. All cell types were modulated by running speed. The conjunction of positional, directional, and translational information in a single MEC cell type may enable grid coordinates to be updated during self-motion-based navigation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sargolini, Francesca -- Fyhn, Marianne -- Hafting, Torkel -- McNaughton, Bruce L -- Witter, Menno P -- Moser, May-Britt -- Moser, Edvard I -- New York, N.Y. -- Science. 2006 May 5;312(5774):758-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Centre for the Biology of Memory, Norwegian University of Science and Technology, 7489 Trondheim, Norway.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16675704" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electrophysiology ; Entorhinal Cortex/*cytology/*physiology ; Exploratory Behavior ; Locomotion ; Male ; Nerve Net/*physiology ; Neurons/*physiology ; *Orientation ; Rats ; Rats, Long-Evans ; *Space Perception
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 91
    facet.materialart.
    Unknown
    Escherichia coli induces DNA double-strand breaks in eukaryotic cells (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-08-12
    Description: Transient infection of eukaryotic cells with commensal and extraintestinal pathogenic Escherichia coli of phylogenetic group B2 blocks mitosis and induces megalocytosis. This trait is linked to a widely spread genomic island that encodes giant modular nonribosomal peptide and polyketide synthases. Contact with E. coli expressing this gene cluster causes DNA double-strand breaks and activation of the DNA damage checkpoint pathway, leading to cell cycle arrest and eventually to cell death. Discovery of hybrid peptide-polyketide genotoxins in E. coli will change our view on pathogenesis and commensalism and open new biotechnological applications.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nougayrede, Jean-Philippe -- Homburg, Stefan -- Taieb, Frederic -- Boury, Michele -- Brzuszkiewicz, Elzbieta -- Gottschalk, Gerhard -- Buchrieser, Carmen -- Hacker, Jorg -- Dobrindt, Ulrich -- Oswald, Eric -- New York, N.Y. -- Science. 2006 Aug 11;313(5788):848-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INRA, UMR1225, Ecole Nationale Veterinaire de Toulouse, Toulouse F-31076, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16902142" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Ataxia Telangiectasia Mutated Proteins ; Cell Cycle ; Cell Cycle Proteins/metabolism ; Cell Death ; Cell Line ; Cell Nucleus/chemistry ; Cytotoxins/*metabolism ; DNA/analysis ; *DNA Damage ; DNA-Binding Proteins/metabolism ; Escherichia coli/genetics/*pathogenicity/*physiology ; G2 Phase ; *Genomic Islands ; HeLa Cells ; Histones/metabolism ; Humans ; Intestinal Mucosa/cytology/microbiology ; Molecular Sequence Data ; Mutagenesis ; Mutagens/*metabolism ; Peptides/*metabolism ; Phosphorylation ; Polyketide Synthases/genetics ; Protein-Serine-Threonine Kinases/metabolism ; Rats ; Signal Transduction ; Tumor Suppressor Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 92
    facet.materialart.
    Unknown
    An architectural framework that may lie at the core of the postsynaptic density (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-01-28
    Description: The postsynaptic density (PSD) is a complex assembly of proteins associated with the postsynaptic membrane that organizes neurotransmitter receptors, signaling pathways, and regulatory elements within a cytoskeletal matrix. Here we show that the sterile alpha motif domain of rat Shank3/ProSAP2, a master scaffolding protein located deep within the PSD, can form large sheets composed of helical fibers stacked side by side. Zn2+, which is found in high concentrations in the PSD, binds tightly to Shank3 and may regulate assembly. Sheets of the Shank protein could form a platform for the construction of the PSD complex.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Baron, Marisa K -- Boeckers, Tobias M -- Vaida, Bianca -- Faham, Salem -- Gingery, Mari -- Sawaya, Michael R -- Salyer, Danielle -- Gundelfinger, Eckart D -- Bowie, James U -- R01 CA081000/CA/NCI NIH HHS/ -- R01 GM063919/GM/NIGMS NIH HHS/ -- R01 GM063919-07/GM/NIGMS NIH HHS/ -- R01 GM063919-08/GM/NIGMS NIH HHS/ -- R01 GM075922/GM/NIGMS NIH HHS/ -- R01 GM075922-04/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 2006 Jan 27;311(5760):531-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, Molecular Biology Institute, University of California, Los Angeles, 611 Charles E. Young Drive East, Los Angeles, CA 90095-1570, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16439662" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptor Proteins, Signal Transducing/analysis/*chemistry/genetics/metabolism ; Animals ; Binding Sites ; Crystallization ; Crystallography, X-Ray ; Hippocampus/chemistry ; Microscopy, Electron ; Models, Molecular ; Mutation ; Nerve Tissue Proteins ; Neurons/chemistry ; Protein Conformation ; Protein Folding ; Protein Structure, Quaternary ; Protein Structure, Tertiary ; Protein Subunits/chemistry ; Rats ; Recombinant Fusion Proteins/analysis ; Solubility ; Synapses/*chemistry ; Zinc/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 93
    facet.materialart.
    Unknown
    Activity-dependent regulation of MEF2 transcription factors suppresses excitatory synapse number (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-02-18
    Description: In the mammalian nervous system, neuronal activity regulates the strength and number of synapses formed. The genetic program that coordinates this process is poorly understood. We show that myocyte enhancer factor 2 (MEF2) transcription factors suppressed excitatory synapse number in a neuronal activity- and calcineurin-dependent manner as hippocampal neurons formed synapses. In response to increased neuronal activity, calcium influx into neurons induced the activation of the calcium/calmodulin-regulated phosphatase calcineurin, which dephosphorylated and activated MEF2. When activated, MEF2 promoted the transcription of a set of genes, including arc and synGAP, that restrict synapse number. These findings define an activity-dependent transcriptional program that may control synapse number during development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Flavell, Steven W -- Cowan, Christopher W -- Kim, Tae-Kyung -- Greer, Paul L -- Lin, Yingxi -- Paradis, Suzanne -- Griffith, Eric C -- Hu, Linda S -- Chen, Chinfei -- Greenberg, Michael E -- AG05870/AG/NIA NIH HHS/ -- HD18655/HD/NICHD NIH HHS/ -- NS28829/NS/NINDS NIH HHS/ -- R01 EY013613/EY/NEI NIH HHS/ -- New York, N.Y. -- Science. 2006 Feb 17;311(5763):1008-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurobiology Program, Children's Hospital, and Departments of Neurology and Neurobiology, Harvard Medical School, 300 Longwood Avenue, Boston, MA 02115, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/16484497" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcineurin/metabolism ; Calcium/metabolism ; Cells, Cultured ; Cytoskeletal Proteins/genetics ; Dendrites/physiology/ultrastructure ; Excitatory Postsynaptic Potentials ; GTPase-Activating Proteins/genetics ; Gene Expression Regulation ; Glutamic Acid/metabolism ; Hippocampus/cytology/*physiology ; MEF2 Transcription Factors ; Mutation ; Myogenic Regulatory Factors/genetics/*physiology ; Nerve Tissue Proteins/genetics ; Neurons/*physiology ; Oligonucleotide Array Sequence Analysis ; Phosphorylation ; RNA Interference ; Rats ; Rats, Long-Evans ; Recombinant Fusion Proteins/metabolism ; Synapses/*physiology ; Synaptic Transmission ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 94
    facet.materialart.
    Unknown
    Muscular thin films for building actuators and powering devices (2007)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2007-09-08
    Description: We demonstrate the assembly of biohybrid materials from engineered tissues and synthetic polymer thin films. The constructs were built by culturing neonatal rat ventricular cardiomyocytes on polydimethylsiloxane thin films micropatterned with extracellular matrix proteins to promote spatially ordered, two-dimensional myogenesis. The constructs, termed muscular thin films, adopted functional, three-dimensional conformations when released from a thermally sensitive polymer substrate and were designed to perform biomimetic tasks by varying tissue architecture, thin-film shape, and electrical-pacing protocol. These centimeter-scale constructs perform functions as diverse as gripping, pumping, walking, and swimming with fine spatial and temporal control and generating specific forces as high as 4 millinewtons per square millimeter.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Feinberg, Adam W -- Feigel, Alex -- Shevkoplyas, Sergey S -- Sheehy, Sean -- Whitesides, George M -- Parker, Kevin Kit -- New York, N.Y. -- Science. 2007 Sep 7;317(5843):1366-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Disease Biophysics Group, School of Engineering and Applied Sciences, Harvard University, Cambridge, MA 02138, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17823347" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Anisotropy ; Cell Culture Techniques ; Cells, Cultured ; Dimethylpolysiloxanes ; Microscopy, Fluorescence ; Motion ; Muscle Contraction ; *Myocardium ; Myocytes, Cardiac ; Rats ; Rats, Sprague-Dawley ; Robotics ; Silicones ; *Tissue Engineering
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 95
    facet.materialart.
    Unknown
    BKCa-Cav channel complexes mediate rapid and localized Ca2+-activated K+ signaling (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-10-28
    Description: Large-conductance calcium- and voltage-activated potassium channels (BKCa) are dually activated by membrane depolarization and elevation of cytosolic calcium ions (Ca2+). Under normal cellular conditions, BKCa channel activation requires Ca2+ concentrations that typically occur in close proximity to Ca2+ sources. We show that BKCa channels affinity-purified from rat brain are assembled into macromolecular complexes with the voltage-gated calcium channels Cav1.2 (L-type), Cav2.1 (P/Q-type), and Cav2.2 (N-type). Heterologously expressed BKCa-Cav complexes reconstitute a functional "Ca2+ nanodomain" where Ca2+ influx through the Cav channel activates BKCa in the physiological voltage range with submillisecond kinetics. Complex formation with distinct Cav channels enables BKCa-mediated membrane hyperpolarization that controls neuronal firing pattern and release of hormones and transmitters in the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Berkefeld, Henrike -- Sailer, Claudia A -- Bildl, Wolfgang -- Rohde, Volker -- Thumfart, Jorg-Oliver -- Eble, Silke -- Klugbauer, Norbert -- Reisinger, Ellen -- Bischofberger, Josef -- Oliver, Dominik -- Knaus, Hans-Gunther -- Schulte, Uwe -- Fakler, Bernd -- New York, N.Y. -- Science. 2006 Oct 27;314(5799):615-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Physiology, University of Freiburg, Hermann-Herder-Strasse 7, 79104 Freiburg, Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17068255" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Brain Chemistry ; CHO Cells ; Calcium/*metabolism ; Calcium Channels, L-Type/drug effects/isolation & purification/*metabolism ; Calcium Channels, N-Type/drug effects/isolation & purification/*metabolism ; Calcium Signaling ; Chromaffin Cells/drug effects/metabolism ; Cricetinae ; Cricetulus ; Egtazic Acid/analogs & derivatives/pharmacology ; Large-Conductance Calcium-Activated Potassium Channels/drug effects/isolation & ; purification/*metabolism ; Membrane Potentials/drug effects ; Molecular Sequence Data ; Patch-Clamp Techniques ; Potassium/*metabolism ; Rats ; *Signal Transduction ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 96
    facet.materialart.
    Unknown
    Protrudin induces neurite formation by directional membrane trafficking (2006)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2006-11-04
    Description: Guanosine triphosphatases of the Rab family are key regulators of membrane trafficking, with Rab11 playing a specific role in membrane recycling. We identified a mammalian protein, protrudin, that promoted neurite formation through interaction with the guanosine diphosphate (GDP)-bound form of Rab11. Phosphorylation of protrudin by extracellular signal-regulated kinase (ERK) in response to nerve growth factor promoted protrudin association with Rab11-GDP. Down-regulation of protrudin by RNA interference induced membrane extension in all directions and inhibited neurite formation. Thus, protrudin regulates Rab11-dependent membrane recycling to promote the directional membrane trafficking required for neurite formation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shirane, Michiko -- Nakayama, Keiichi I -- New York, N.Y. -- Science. 2006 Nov 3;314(5800):818-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17082457" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Carrier Proteins/chemistry/genetics/*metabolism ; Cell Adhesion Molecules/metabolism ; Cell Line ; Cell Membrane/*metabolism ; Extracellular Signal-Regulated MAP Kinases/metabolism ; Guanosine Diphosphate/metabolism ; HeLa Cells ; Humans ; MAP Kinase Kinase 1/metabolism ; Membrane Proteins ; Mice ; Mice, Inbred C57BL ; Molecular Sequence Data ; Nerve Growth Factor/pharmacology/physiology ; Neurites/*physiology ; PC12 Cells ; Phosphorylation ; RNA Interference ; Rats ; Recombinant Fusion Proteins/chemistry/metabolism ; Vesicular Transport Proteins ; rab GTP-Binding Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 97
    facet.materialart.
    Unknown
    Structure of Nup58/45 suggests flexible nuclear pore diameter by intermolecular sliding (2007)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2007-03-24
    Description: The nucleoporins Nup58 and Nup45 are part of the central transport channel of the nuclear pore complex, which is thought to have a flexible diameter. In the crystal structure of an alpha-helical region of mammalian Nup58/45, we identified distinct tetramers, each consisting of two antiparallel hairpin dimers. The intradimeric interface is hydrophobic, whereas dimer-dimer association occurs through large hydrophilic residues. These residues are laterally displaced in various tetramer conformations, which suggests an intermolecular sliding by 11 angstroms. We propose that circumferential sliding plays a role in adjusting the diameter of the central transport channel.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Melcak, Ivo -- Hoelz, Andre -- Blobel, Gunter -- R01 GM111461/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 2007 Mar 23;315(5819):1729-32.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, Howard Hughes Medical Institute, Rockefeller University, 1230 York Avenue, New York, NY 10021, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17379812" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Crystallization ; Crystallography, X-Ray ; Dimerization ; Hydrogen Bonding ; Hydrophobic and Hydrophilic Interactions ; Membrane Glycoproteins/chemistry ; Molecular Sequence Data ; Nuclear Pore Complex Proteins/*chemistry ; Protein Folding ; Protein Structure, Quaternary ; Protein Structure, Secondary ; Protein Structure, Tertiary ; Protein Subunits/chemistry ; Rats ; Static Electricity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 98
    facet.materialart.
    Unknown
    Anatomy and dynamics of a supramolecular membrane protein cluster (2007)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2007-08-25
    Description: Most plasmalemmal proteins organize in submicrometer-sized clusters whose architecture and dynamics are still enigmatic. With syntaxin 1 as an example, we applied a combination of far-field optical nanoscopy, biochemistry, fluorescence recovery after photobleaching (FRAP) analysis, and simulations to show that clustering can be explained by self-organization based on simple physical principles. On average, the syntaxin clusters exhibit a diameter of 50 to 60 nanometers and contain 75 densely crowded syntaxins that dynamically exchange with freely diffusing molecules. Self-association depends on weak homophilic protein-protein interactions. Simulations suggest that clustering immobilizes and conformationally constrains the molecules. Moreover, a balance between self-association and crowding-induced steric repulsions is sufficient to explain both the size and dynamics of syntaxin clusters and likely of many oligomerizing membrane proteins that form supramolecular structures.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sieber, Jochen J -- Willig, Katrin I -- Kutzner, Carsten -- Gerding-Reimers, Claas -- Harke, Benjamin -- Donnert, Gerald -- Rammner, Burkhard -- Eggeling, Christian -- Hell, Stefan W -- Grubmuller, Helmut -- Lang, Thorsten -- New York, N.Y. -- Science. 2007 Aug 24;317(5841):1072-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Max Planck Institute for Biophysical Chemistry, Am Fassberg 11, 37077 Gottingen, Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17717182" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Motifs ; Animals ; Cell Membrane/chemistry/*metabolism ; Chemistry, Physical ; Computer Simulation ; Diffusion ; Fluorescence Recovery After Photobleaching ; Green Fluorescent Proteins ; Immunoblotting ; Microscopy, Confocal ; Microscopy, Fluorescence ; Models, Biological ; Nanotechnology ; PC12 Cells ; Physicochemical Phenomena ; Protein Structure, Tertiary ; Rats ; Recombinant Fusion Proteins/chemistry/metabolism ; Syntaxin 1/*chemistry/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 99
    facet.materialart.
    Unknown
    Hardwiring the brain: endocannabinoids shape neuronal connectivity (2007)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2007-05-26
    Description: The roles of endocannabinoid signaling during central nervous system development are unknown. We report that CB(1) cannabinoid receptors (CB(1)Rs) are enriched in the axonal growth cones of gamma-aminobutyric acid-containing (GABAergic) interneurons in the rodent cortex during late gestation. Endocannabinoids trigger CB(1)R internalization and elimination from filopodia and induce chemorepulsion and collapse of axonal growth cones of these GABAergic interneurons by activating RhoA. Similarly, endocannabinoids diminish the galvanotropism of Xenopus laevis spinal neurons. These findings, together with the impaired target selection of cortical GABAergic interneurons lacking CB(1)Rs, identify endocannabinoids as axon guidance cues and demonstrate that endocannabinoid signaling regulates synaptogenesis and target selection in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Berghuis, Paul -- Rajnicek, Ann M -- Morozov, Yury M -- Ross, Ruth A -- Mulder, Jan -- Urban, Gabriella M -- Monory, Krisztina -- Marsicano, Giovanni -- Matteoli, Michela -- Canty, Alison -- Irving, Andrew J -- Katona, Istvan -- Yanagawa, Yuchio -- Rakic, Pasko -- Lutz, Beat -- Mackie, Ken -- Harkany, Tibor -- DA00286/DA/NIDA NIH HHS/ -- DA015916/DA/NIDA NIH HHS/ -- DA11322/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 2007 May 25;316(5828):1212-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, S-17177 Stockholm, Sweden.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17525344" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/physiology ; Cannabinoid Receptor Modulators/metabolism/*physiology ; Cell Movement ; Cells, Cultured ; Cerebral Cortex/cytology/embryology/ultrastructure ; *Endocannabinoids ; Growth Cones/physiology/ultrasonography ; In Situ Hybridization ; Interneurons/metabolism/*physiology/ultrasonography ; Mice ; Mice, Inbred C57BL ; Microscopy, Confocal ; Rats ; Rats, Sprague-Dawley ; Receptor, Cannabinoid, CB1/agonists/*physiology ; Signal Transduction ; Stem Cells/metabolism ; Synapses/physiology/ultrasonography ; Xenopus Proteins/physiology ; Xenopus laevis ; gamma-Aminobutyric Acid/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 100
    facet.materialart.
    Unknown
    Anti-Hebbian long-term potentiation in the hippocampal feedback inhibitory circuit (2007)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2007-03-03
    Description: Long-term potentiation (LTP), which approximates Hebb's postulate of associative learning, typically requires depolarization-dependent glutamate receptors of the NMDA (N-methyl-D-aspartate) subtype. However, in some neurons, LTP depends instead on calcium-permeable AMPA-type receptors. This is paradoxical because intracellular polyamines block such receptors during depolarization. We report that LTP at synapses on hippocampal interneurons mediating feedback inhibition is "anti-Hebbian":Itis induced by presynaptic activity but prevented by postsynaptic depolarization. Anti-Hebbian LTP may occur in interneurons that are silent during periods of intense pyramidal cell firing, such as sharp waves, and lead to their altered activation during theta activity.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3369266/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3369266/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lamsa, Karri P -- Heeroma, Joost H -- Somogyi, Peter -- Rusakov, Dmitri A -- Kullmann, Dimitri M -- 071179/Wellcome Trust/United Kingdom -- G0400627/Medical Research Council/United Kingdom -- G0400627(71256)/Medical Research Council/United Kingdom -- G0400627(76527)/Medical Research Council/United Kingdom -- G0501424/Medical Research Council/United Kingdom -- G0600368/Medical Research Council/United Kingdom -- G0600368(77987)/Medical Research Council/United Kingdom -- MC_U138135973/Medical Research Council/United Kingdom -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 2007 Mar 2;315(5816):1262-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Neurology, University College London, Queen Square, London WC1N 3BG, UK.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17332410" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Stimulation ; Excitatory Postsynaptic Potentials ; Hippocampus/cytology/*physiology ; Interneurons/*physiology ; *Long-Term Potentiation ; Male ; Membrane Potentials ; Neural Inhibition/*physiology ; Patch-Clamp Techniques ; Pyramidal Cells/*physiology ; Rats ; Rats, Sprague-Dawley ; Receptors, AMPA/physiology ; Receptors, N-Methyl-D-Aspartate/physiology ; Spermine/analogs & derivatives/pharmacology ; Synapses/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...