ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Base Sequence  (412)
  • Cell Line  (258)
  • *Ecosystem
  • American Association for the Advancement of Science (AAAS)  (622)
  • American Meteorological Society
  • MDPI Publishing
  • 1985-1989  (622)
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (622)
  • American Meteorological Society
  • MDPI Publishing
Years
Year
  • 1
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-05
    Description: Tumor promoters may bring about events that lead to neoplastic transformation by inducing specific promotion-relevant effector genes. Functional activation of the transacting transcription factor AP-1 by the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) may play an essential role in this process. Clonal genetic variants of mouse epidermal JB6 cells that are genetically susceptible (P+) or resistant (P-) to promotion of transformation by TPA were transfected with 3XTRE-CAT, a construct that has AP-1 cis-enhancer sequences attached to a reporter gene encoding chloramphenicol acetyltransferase (CAT). Transfected JB6 P+, but not P- variants, showed TPA-inducible CAT synthesis. Epidermal growth factor, another transformation promoter in JB6 cells, also caused P+ specific induction of CAT gene expression. These results demonstrate an association between induced AP-1 function and sensitivity to promotion of neoplastic transformation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bernstein, L R -- Colburn, N H -- New York, N.Y. -- Science. 1989 May 5;244(4904):566-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Johns Hopkins University, Department of Biology, Baltimore, MD 21218.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541502" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Chloramphenicol O-Acetyltransferase/genetics ; Cloning, Molecular ; DNA-Binding Proteins/genetics/*physiology ; Epidermal Growth Factor/pharmacology ; Epidermis ; Gene Expression Regulation ; Genetic Variation ; Kinetics ; Mice ; Nucleic Acid Hybridization ; Plasmids ; Promoter Regions, Genetic ; Proto-Oncogene Proteins ; Proto-Oncogene Proteins c-jun ; Simplexvirus/genetics ; Tetradecanoylphorbol Acetate/*pharmacology ; Transcription Factors/genetics/*physiology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-01
    Description: Oligonucleotide recognition offers a powerful chemical approach for the sequence-specific binding of double-helical DNA. In the pyrimidine-Hoogsteen model, a binding size of greater than 15 homopurine base pairs affords greater than 30 discrete sequence-specific hydrogen bonds to duplex DNA. Because pyrimidine oligonucleotides limit triple helix formation to homopurine tracts, it is desirable to determine whether oligonucleotides can be used to bind all four base pairs of DNA. A general solution would allow targeting of oligonucleotides (or their analogs) to any given sequence in the human genome. A study of 20 base triplets reveals that the triple helix can be extended from homopurine to mixed sequences. Guanine contained within a pyrimidine oligonucleotide specifically recognizes thymine.adenine base pairs in duplex DNA. Such specificity allows binding at mixed sites in DNA from simian virus 40 and human immunodeficiency virus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Griffin, L C -- Dervan, P B -- GM-35724/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):967-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549639" target="_blank"〉PubMed〈/a〉
    Keywords: *Adenine ; Base Sequence ; DNA/*genetics ; DNA, Viral/genetics ; *Guanine ; HIV/genetics ; Hydrogen Bonding ; Models, Structural ; Molecular Sequence Data ; *Nucleic Acid Conformation ; Oligodeoxyribonucleotides ; Simian virus 40/genetics ; *Thymine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: This article reviews some of the significant contributions of fetal research and fetal tissue research over the past 20 years. The benefits of fetal research include the development of vaccines, advances in prenatal diagnosis, detection of malformations, assessment of safe and effective medications, and the development of in utero surgical therapies. Fetal tissue research benefits vaccine development, assessment of risk factors and toxicity levels in drug production, development of cell lines, and provides a source of fetal cells for ongoing transplantation trials. Together, fetal research and fetal tissue research offer tremendous potential for the treatment of the fetus, neonate, and adult.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hansen, J T -- Sladek, J R Jr -- P01-NS24032/NS/NINDS NIH HHS/ -- P01-NS25778/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):775-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology and Anatomy, University of Rochester School of Medicine and Dentistry, NY 14642.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683082" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Line ; Congenital Abnormalities/diagnosis ; Female ; *Fetal Diseases ; *Fetal Research ; *Fetus/cytology/surgery ; Genetic Diseases, Inborn ; Humans ; Nontherapeutic Human Experimentation ; Pregnancy ; Prenatal Diagnosis ; *Research ; *Risk Assessment ; Therapeutic Human Experimentation ; Vaccines
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    Publication Date: 1989-04-28
    Description: Transcriptional activation of the human interleukin-2 (IL-2) gene, like induction of the IL-2 receptor alpha (IL-2R alpha) gene and the type 1 human immunodeficiency virus (HIV-1), is shown to be modulated by a kappa B-like enhancer element. Mutation of a kappa B core sequence identified in the IL-2 promoter (-206 to -195) partially inhibits both mitogen- and HTLV-I Tax-mediated activation of this transcription unit and blocks the specific binding of two inducible cellular factors. These kappa B-specific proteins (80 to 90 and 50 to 55 kilodaltons) similarly interact with the functional kappa B enhancer present in the IL-2R alpha promoter. These data suggest that these kappa B-specific proteins have a role in the coordinate regulation of this growth factor-growth factor receptor gene system that controls T cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoyos, B -- Ballard, D W -- Bohnlein, E -- Siekevitz, M -- Greene, W C -- A127053-01/PHS HHS/ -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):457-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Medical Center, Department of Microbiology, New York, NY 10029.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497518" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/metabolism ; DNA-Binding Proteins/*metabolism ; *Enhancer Elements, Genetic ; *Gene Expression Regulation ; Genes, Viral ; HIV-1/genetics ; HTLV-I Antigens/pharmacology ; Humans ; Immunoglobulin kappa-Chains/*genetics ; Interleukin-2/*genetics ; Molecular Weight ; Mutation ; Phytohemagglutinins/pharmacology ; Plasmids ; Promoter Regions, Genetic ; RNA, Messenger/biosynthesis ; T-Lymphocytes/metabolism ; Tetradecanoylphorbol Acetate/pharmacology ; Trans-Activators ; Transcription Factors/pharmacology ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-28
    Description: The CD4 and CD8 T cell receptor accessory molecules can both be isolated from T lymphocytes in association with p56lck, a membrane-associated, cytoplasmic tyrosine protein kinase that is expressed exclusively in lymphoid cells. The enzymatic activity of p56lck may therefore be regulated by CD4 and CD8 and be important in antigen-induced T cell activation. Exposure of human T cells and some mouse T cells to the tumor promoter 12-O-tetradecanoyl phorbol-13-acetate (TPA), an activator of protein kinase C, caused the dissociation of p56lck and CD4. Activation of protein kinase C may therefore interrupt regulation of p56lck by CD4 and alter the ability of p56lck to interact with polypeptide substrates. In contrast, exposure of cells to TPA did not cause dissociation of p56lck and CD8. Regulation of p56lck by CD4 may therefore differ from regulation by CD8.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hurley, T R -- Luo, K -- Sefton, B M -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):407-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Biology and Virology Laboratory, Salk Institute, San Diego, CA 92138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2787934" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, T-Lymphocyte/*immunology ; Cell Line ; Enzyme Activation ; Humans ; Leukemia, T-Cell ; Lymphocyte Specific Protein Tyrosine Kinase p56(lck) ; Phosphorylation ; Precipitin Tests ; Protein Kinase C/*metabolism ; Protein-Tyrosine Kinases/*metabolism ; T-Lymphocytes/*immunology ; Tetradecanoylphorbol Acetate/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 1989-12-08
    Description: A novel bacteriophage lambda vector system was used to express in Escherichia coli a combinatorial library of Fab fragments of the mouse antibody repertoire. The system allows rapid and easy identification of monoclonal Fab fragments in a form suitable for genetic manipulation. It was possible to generate, in 2 weeks, large numbers of monoclonal Fab fragments against a transition state analog hapten. The methods described may supersede present-day hybridoma technology and facilitate the production of catalytic and other antibodies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huse, W D -- Sastry, L -- Iverson, S A -- Kang, A S -- Alting-Mees, M -- Burton, D R -- Benkovic, S J -- Lerner, R A -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531466" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal/*biosynthesis/genetics ; Antibody Specificity ; Antigen-Antibody Reactions ; Bacteriophage lambda/*genetics ; Base Sequence ; Cloning, Molecular/methods ; Escherichia coli/genetics ; Gene Amplification ; Gene Library ; *Genetic Vectors ; Hemocyanin/analogs & derivatives/immunology ; Immunoglobulin Fab Fragments/biosynthesis ; Immunoglobulin Fragments/*biosynthesis/genetics ; Mice ; Molecular Sequence Data ; Organophosphorus Compounds/immunology ; Recombinant Proteins/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    Publication Date: 1989-06-23
    Description: An airway epithelial cell line (CF/T43) was developed by infecting cultured airway epithelial cells from patients with cystic fibrosis (CF) with the pZIPneoSV(X)1/SV40T retrovirus and selecting for G418 resistance and ion transport properties. The distinctive chloride secretory phenotypes of the CF cell line CF/T43 and a normal cell line (NL/T4) were not perturbed by SV40T-induced cell transformation. Epithelial cell lines generated from CF cells with the SV40T gene can be used to test candidate CF genes and to evaluate the molecular mechanisms responsible for the CF phenotype.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jetten, A M -- Yankaskas, J R -- Stutts, M J -- Willumsen, N J -- Boucher, R C -- HL41983/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1472-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472008" target="_blank"〉PubMed〈/a〉
    Keywords: Amiloride/pharmacology ; Antigens, Polyomavirus Transforming/*genetics ; Calcimycin/pharmacology ; Cell Line ; Cell Membrane/physiology ; Chloride Channels ; Chlorides/*physiology ; Colforsin/pharmacology ; Cystic Fibrosis/pathology/*physiopathology ; Electric Conductivity ; Epithelium/drug effects/pathology/physiology ; Ethers/pharmacology ; Freeze Fracturing ; Humans ; Intercellular Junctions ; Ion Channels/physiology ; Ionomycin ; Membrane Proteins/*physiology ; Microscopy, Electron ; Nasal Polyps ; Simian virus 40/*immunology ; *Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    Publication Date: 1989-09-15
    Description: Gene targeting via homologous recombination-mediated disruption in murine embryonic stem (ES) cells has been described for a number of different genes expressed in these cells; it has not been reported for any nonexpressed genes. Pluripotent stem cell lines were isolated with homologously recombined insertions at three different loci: c-fos, which is expressed at a low level in ES cells, and two genes, adipsin and adipocyte P2 (aP2), which are transcribed specifically in adipose cells and are not expressed at detectable levels in ES cells. The frequencies at which homologous recombination events occurred did not correlate with levels of expression of the targeted genes, but did occur at rates comparable to those previously reported for genes that are actively expressed in ES cells. Injection of successfully targeted cells into mouse blastocysts resulted in the formation of chimeric mice. These studies demonstrate the feasibility of altering genes in ES cells that are expressed in a tissue-specific manner in the mouse, in order to study their function at later developmental stages.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R S -- Sheng, M -- Greenberg, M E -- Kolodner, R D -- Papaioannou, V E -- Spiegelman, B M -- DK 31405/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1234-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506639" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/cytology ; Animals ; Blotting, Northern ; Blotting, Southern ; Carrier Proteins/biosynthesis/*genetics ; Cell Line ; Chimera ; Complement Factor D ; DNA, Recombinant ; DNA-Binding Proteins/biosynthesis/genetics ; Fatty Acid-Binding Proteins ; Fatty Acids/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; *Neoplasm Proteins ; *Nerve Tissue Proteins ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-fos ; RNA, Messenger/biosynthesis/genetics ; *Recombination, Genetic ; Serine Endopeptidases/*genetics ; Stem Cells/*metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    Publication Date: 1989-06-02
    Description: Neurotransmitter receptors are usually restricted to neuronal cells, but the signaling pathways activated by these receptors are widely distributed in both neural and non-neural cells. The functional consequences of activating a brain-specific neurotransmitter receptor, the serotonin 5HT1c receptor, in the unnatural environment of a fibroblast were examined. Introduction of functional 5HT1c receptors into NIH 3T3 cells results, at high frequency, in the generation of transformed foci. Moreover, the generation and maintenance of transformed foci requires continued activation of the serotonin receptor. In addition, the injection of cells derived from transformed foci into nude mice results in the generation of tumors. The serotonin 5HT1c receptor therefore functions as a protooncogene when expressed in NIH 3T3 fibroblasts.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Julius, D -- Livelli, T J -- Jessell, T M -- Axel, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1057-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, College of Physicians and Surgeons, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727693" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcium/pharmacology ; Cell Division ; Cell Line ; *Cell Transformation, Neoplastic ; Cloning, Molecular ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Receptors, Serotonin/*genetics/physiology ; Second Messenger Systems ; Serotonin/pharmacology/physiology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    Publication Date: 1989-12-22
    Description: A human acute lymphoblastic leukemia (ALL) cell line that was transplanted into immune-deficient SCID mice proliferated in the hematopoietic tissues, invaded various organs, and led to the death of the mice. The distribution of leukemic cells in SCID mice was similar to the course of the disease in children. A-1 cells marked with a retrovirus vector showed clonal evolution after the transplant. SCID mice that were injected with bone marrow from three patients with non-T ALL had leukemic cells in their bone marrow and spleen. This in vivo model of human leukemia is an approach to understanding leukemic growth and progression and is a novel system for testing new treatment strategies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kamel-Reid, S -- Letarte, M -- Sirard, C -- Doedens, M -- Grunberger, T -- Fulop, G -- Freedman, M H -- Phillips, R A -- Dick, J E -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1597-600.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595371" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/pathology ; Cell Line ; Clone Cells ; DNA, Neoplasm/isolation & purification ; Humans ; Immunologic Deficiency Syndromes/*pathology ; Kidney/pathology ; Liver/pathology ; Mice ; Mice, Mutant Strains ; Neoplasm Transplantation ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/*pathology ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    Publication Date: 1989-12-08
    Description: Vascular permeability factor (VPF) is a 40-kilodalton disulfide-linked dimeric glycoprotein that is active in increasing blood vessel permeability, endothelial cell growth, and angiogenesis. These properties suggest that the expression of VPF by tumor cells could contribute to the increased neovascularization and vessel permeability that are associated with tumor vasculature. The cDNA sequence of VPF from human U937 cells was shown to code for a 189-amino acid polypeptide that is similar in structure to the B chain of platelet-derived growth factor (PDGF-B) and other PDGF-B-related proteins. The overall identity with PDGF-B is 18%. However, all eight of the cysteines in PDGF-B were found to be conserved in human VPF, an indication that the folding of the two proteins is probably similar. Clusters of basic amino acids in the COOH-terminal halves of human VPF and PDGF-B are also prevalent. Thus, VPF appears to be related to the PDGF/v-sis family of proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Keck, P J -- Hauser, S D -- Krivi, G -- Sanzo, K -- Warren, T -- Feder, J -- Connolly, D T -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1309-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture and Biochemistry, Monsanto Company, St. Louis, MO 63167.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479987" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Capillary Permeability/physiology ; Cell Division/physiology ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; *Growth Substances ; Guinea Pigs ; Humans ; Lymphokines/*physiology ; Molecular Sequence Data ; Neovascularization, Pathologic/physiopathology ; Oncogene Proteins v-sis ; Platelet-Derived Growth Factor/physiology ; Retroviridae Proteins, Oncogenic/physiology ; Sequence Homology, Nucleic Acid ; Transforming Growth Factors ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    Publication Date: 1989-03-10
    Description: Antisense RNA-mediated inhibition of gene expression was used to investigate the biological function of the c-raf-1 gene in a radiation-resistant human squamous carcinoma cell line, SQ-20B. S1 nuclease protection assays revealed that transfection of full-length raf complementary DNA in the antisense orientation (AS) leads to a specific reduction (greater than tenfold) of steady-state levels of the endogenous c-raf-1 sense (S) transcript in SQ-20B cells. In nude mice, the malignant potential of SQ-20B cells transfected with raf (S) was significantly increased relative to that of SQ-20B cells transfected with raf (AS). SQ-20B cells containing transfected raf (S) maintained a radiation-resistant phenotype as compared to those cells harboring the AS version, which appeared to have enhanced radiation sensitivity. These data indicate that the reduced expression of endogenous c-raf-1 is sufficient to modulate the tumorigenicity and the radiation-resistant phenotype of SQ-20B cells, thus implicating c-raf-1 in a pathway important to the genesis of this type of cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kasid, U -- Pfeifer, A -- Brennan, T -- Beckett, M -- Weichselbaum, R R -- Dritschilo, A -- Mark, G E -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1354-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiation Medicine, Vincent T. Lombardi Comprehensive Cancer Research Center, Georgetown University Medical Center, Washington 20007.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466340" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Southern ; Carcinoma, Squamous Cell/*genetics ; Cell Line ; Cell Survival/*radiation effects ; Clone Cells ; Dose-Response Relationship, Radiation ; *Gene Expression Regulation ; Humans ; Kinetics ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Nucleic Acid Hybridization ; *Proto-Oncogenes ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors ; Transcription, Genetic ; Transfection ; Transplantation, Heterologous ; Tumor Cells, Cultured/*radiation effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    Publication Date: 1989-02-17
    Description: Mouse 3T3 cell lines capable of constitutively synthesizing an RNA complementary to the messenger RNA encoding TIMP, tissue inhibitor of metalloproteinases, were constructed by transfection with appropriate plasmid constructs. Many of the lines were down-modulated for TIMP messenger RNA levels and secreted less TIMP into the culture medium. In comparison to noninvasive, nontumorigenic controls, these cells not only were invasive in a human amnion invasion assay, but also were tumorigenic and metastatic in athymic mice. These results indicate that TIMP suppresses oncogenicity, at least in immortal murine 3T3 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Khokha, R -- Waterhouse, P -- Yagel, S -- Lala, P K -- Overall, C M -- Norton, G -- Denhardt, D T -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):947-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Western Ontario, London, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2465572" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Cells, Cultured ; Enzyme Inhibitors/*genetics/metabolism ; Female ; Metalloendopeptidases/antagonists & inhibitors ; Mice ; Mice, Nude ; Neoplasm Metastasis ; Pituitary Neoplasms/genetics/pathology ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors/genetics ; Tissue Inhibitor of Metalloproteinases ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Two human cell lines (termed rho 0), which had been completely depleted of mitochondrial DNA (mtDNA) by long-term exposure to ethidium bromide, were found to be dependent on uridine and pyruvate for growth because of the absence of a functional respiratory chain. Loss of either of these two metabolic requirements was used as a selectable marker for the repopulation of rho 0 cells with exogenous mitochondria by complementation. Transformants obtained with various mitochondrial donors exhibited a respiratory phenotype that was in most cases distinct from that of the rho 0 parent or the donor, indicating that the genotypes of the mitochondrial and nuclear genomes as well as their specific interactions play a role in the respiratory competence of a cell.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉King, M P -- Attardi, G -- GM11726/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):500-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814477" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Fusion ; Cell Line ; *DNA, Mitochondrial ; Humans ; Mitochondria/*physiology ; Oxygen Consumption/physiology ; *Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Klausner, R D -- Harford, J B -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):870-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683086" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; *Gene Expression Regulation ; *Models, Genetic ; Molecular Sequence Data ; Nucleic Acid Conformation ; *Protein Biosynthesis ; RNA, Messenger/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    Publication Date: 1989-08-25
    Description: The messenger RNAs specifying certain proteins involved in the inflammatory response and certain oncoproteins contain a conserved UA-rich sequence in the 3' untranslated region. This sequence, which is composed of several interspersed repeats of the octanucleotide UUAUUUAU, has been shown to destabilize mRNA in some eukaryotes. However, this effect is not seen when mRNAs are transferred to Xenopus oocytes, which made it possible to separate stability from translational regulation. For interferon, granulocyte-macrophage colony-stimulating factor, and c-fos RNAs, the UA-rich sequence was observed to preclude mRNA translation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kruys, V -- Marinx, O -- Shaw, G -- Deschamps, J -- Huez, G -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):852-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departement de Biologie Moleculaire, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672333" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Colony-Stimulating Factors/*genetics ; Granulocyte-Macrophage Colony-Stimulating Factor ; Growth Substances/*genetics ; Interferon Type I/*genetics ; Molecular Sequence Data ; *Protein Biosynthesis ; *Proto-Oncogenes ; RNA, Messenger/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    Publication Date: 1989-09-22
    Description: Bleomycin is a metal- and oxygen-dependent DNA cleaver. The chemistry of DNA damage has been proposed to involve rate-limiting abstraction of the 4'-hydrogen. A DNA fragment has been prepared that contains [4'-2H]thymidine residues of high isotopic content. Primary kinetic isotope effects have been directly observed at individual thymidine residues with DNA sequencing technology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kozarich, J W -- Worth, L Jr -- Frank, B L -- Christner, D F -- Vanderwall, D E -- Stubbe, J -- GM 34454/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1396-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, University of Maryland, College Park, MD 20742.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476851" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; *Bleomycin ; *DNA Damage ; Deuterium ; Iron ; Oxygen ; Structure-Activity Relationship ; Thymidine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    Publication Date: 1989-06-30
    Description: Complementary DNA's that encode an adenylyl cyclase were isolated from a bovine brain library. Most of the deduced amino acid sequence of 1134 residues is divisible into two alternating sets of hydrophobic and hydrophilic domains. Each of the two large hydrophobic domains appears to contain six transmembrane spans. Each of the two large hydrophilic domains contains a sequence that is homologous to a single cytoplasmic domain of several guanylyl cyclases; these sequences may represent nucleotide binding sites. An unexpected topographical resemblance between adenylyl cyclase and various plasma membrane channels and transporters was observed. This structural complexity suggests possible, unappreciated functions for this important enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Krupinski, J -- Coussen, F -- Bakalyar, H A -- Tang, W J -- Feinstein, P G -- Orth, K -- Slaughter, C -- Reed, R R -- Gilman, A G -- CA16519/CA/NCI NIH HHS/ -- GM12230/GM/NIGMS NIH HHS/ -- GM34497/GM/NIGMS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1558-64.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas 75235.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472670" target="_blank"〉PubMed〈/a〉
    Keywords: *Adenylyl Cyclases/genetics/isolation & purification ; Amino Acid Sequence ; Animals ; Base Sequence ; Brain/enzymology ; *Carrier Proteins ; Cattle ; Cell Line ; Cloning, Molecular ; DNA/genetics ; Electrophoresis, Polyacrylamide Gel ; *Ion Channels ; Membrane Proteins ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Protein Conformation ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: DNA mismatch correction is a strand-specific process involving recognition of noncomplementary Watson-Crick nucleotide pairs and participation of widely separated DNA sites. The Escherichia coli methyl-directed reaction has been reconstituted in a purified system consisting of MutH, MutL, and MutS proteins, DNA helicase II, single-strand DNA binding protein, DNA polymerase III holoenzyme, exonuclease I, DNA ligase, along with ATP (adenosine triphosphate), and the four deoxynucleoside triphosphates. This set of proteins can process seven of the eight base-base mismatches in a strand-specific reaction that is directed by the state of methylation of a single d(GATC) sequence located 1 kilobase from the mispair.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lahue, R S -- Au, K G -- Modrich, P -- F32 GM12684/GM/NIGMS NIH HHS/ -- GM23719/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):160-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2665076" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; *DNA Repair ; DNA, Bacterial/biosynthesis/*genetics ; Escherichia coli/*genetics ; Methylation ; Mutation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    Publication Date: 1989-02-24
    Description: Branched RNA-linked multicopy single-stranded DNA (msDNA) originally detected in myxobacteria has now been found in a clinical isolate of Escherichia coli. Although lacking homology in the primary structure, the E. coli msDNA is similar in secondary structure to the myxobacterial msDNA's, including the 2',5'-phosphodiester linkage between RNA and DNA. A chromosomal DNA fragment responsible for the production of msDNA was cloned in an E. coli K12 strain; its DNA sequence revealed an open reading frame (ORF) of 586 amino acid residues. The ORF shows sequence similarity with retroviral reverse transcriptases and ribonuclease H. Disruption of the ORF blocked msDNA production, indicating that this gene is essential for msDNA synthesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lampson, B C -- Sun, J -- Hsu, M Y -- Vallejo-Ramirez, J -- Inouye, S -- Inouye, M -- F32 GM11970-01A1/GM/NIGMS NIH HHS/ -- GM26843/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1033-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway 08854.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466332" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA Probes ; DNA Restriction Enzymes ; DNA, Bacterial/genetics ; DNA, Single-Stranded/analysis/biosynthesis/*genetics ; Endoribonucleases/genetics ; Escherichia coli/enzymology/*genetics ; Genes, Bacterial ; HIV/enzymology/genetics ; Human T-lymphotropic virus 1/enzymology/genetics ; Molecular Sequence Data ; Myxococcales/genetics ; Nucleic Acid Hybridization ; RNA, Bacterial/analysis/biosynthesis/*genetics ; RNA-Directed DNA Polymerase/*genetics ; Retroviridae/*enzymology/genetics ; Ribonuclease H ; Sequence Homology, Nucleic Acid ; Transformation, Bacterial
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    Publication Date: 1989-12-22
    Description: CD16 is a low-affinity immunoglobulin G (IgG) Fc receptor that is expressed on natural killer (NK) cells, granulocytes, activated macrophages, and some T lymphocytes. Two similar genes, CD16-I and CD16-II, encode membrane glycoproteins that are anchored by phosphatidylinositol (PI)-glycan and transmembrane polypeptides, respectively. The primary structural requirements for PI-linkage were examined by constructing a series of hybrid cDNA molecules. Although both cDNA's have an identical COOH-terminal hydrophobic segment, CD16-I has Ser203 whereas CD16-II has Phe203. Conversion of Phe to Ser in CD16-II permits expression of a PI-glycan-anchored glycoprotein, whereas conversion of Ser to Phe in CD16-I prevents PI-glycan linkage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lanier, L L -- Cwirla, S -- Yu, G -- Testi, R -- Phillips, J H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Becton Dickinson Monoclonal Center, Inc., Mountain View, CA 94043.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531919" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/*genetics ; Antigens, Differentiation/*genetics/metabolism ; Base Sequence ; Cell Line ; Cell Membrane/immunology ; Codon/genetics ; *Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; *Phenylalanine ; Receptors, Fc/*genetics/metabolism ; Receptors, IgG ; *Serine ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-21
    Description: Ribozymes are RNA molecules that catalyze biochemical reactions. Fe(II)-EDTA, a solvent-based reagent which cleaves both double- and single-stranded RNA, was used to investigate the structure of the Tetrahymena ribozyme. Regions of cleavage alternate with regions of substantial protection along the entire RNA molecule. In particular, most of the catalytic core shows greatly reduced cleavage. These data constitute experimental evidence that an RNA enzyme, like a protein enzyme, has an interior and an exterior. Determination of positions where the phosphodiester backbone of the RNA is on the inside or on the outside of the molecule provides major constraints for modeling the three-dimensional structure of the Tetrahymena ribozyme. This approach should be generally informative for structured RNA molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Latham, J A -- Cech, T R -- GM 11227-03/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):276-82.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309-0215.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501870" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoradiography ; Base Sequence ; Binding Sites ; Crystallography ; Edetic Acid ; Electrophoresis, Polyacrylamide Gel ; Ferrous Compounds ; Molecular Sequence Data ; Molecular Structure ; *Nucleic Acid Conformation ; *RNA Splicing ; RNA, Catalytic ; RNA, Fungal/analysis ; *RNA, Ribosomal/analysis/metabolism ; RNA, Transfer, Phe/analysis ; Tetrahymena/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    Publication Date: 1989-05-26
    Description: Spondyloepiphyseal dysplasias (SED) are a heterogeneous group of inherited disorders characterized by disproportionate short stature and pleiotropic involvement of the skeletal and ocular systems. Evidence has suggested that SED may result from structural defects in type II collagen. To confirm the validity of this hypothesis, the structure of the "candidate" type II collagen gene (COL2A1) has been directly examined in a relatively large SED family. Coarse scanning of the gene by Southern blot hybridization identified an abnormal restriction pattern in one of the affected members of the kindred. Analysis of selected genomic fragments, amplified by the polymerase chain reaction, precisely localized the molecular defect and demonstrated that all affected family members carried the same heterozygous single-exon deletion. As a consequence of the mutation, nearly 90 percent of the assembled type II collagen homotrimers are expected to contain one or more procollagen subunits harboring an interstitial deletion of 36 amino acids in the triple helical domain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, B -- Vissing, H -- Ramirez, F -- Rogers, D -- Rimoin, D -- AR-38648/AR/NIAMS NIH HHS/ -- HD-22657/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 May 26;244(4907):978-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, State University of New York Health Science Center, Brooklyn 11203.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543071" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Child, Preschool ; Chromosome Deletion ; Collagen/*genetics ; DNA Restriction Enzymes ; DNA-Directed DNA Polymerase ; Exons ; Female ; Gene Amplification ; Humans ; Macromolecular Substances ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Osteochondrodysplasias/*genetics ; Pedigree ; Procollagen/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    Publication Date: 1989-04-28
    Description: Confirmed infection with HTLV-II (human T cell leukemia virus type II) has been described only in rare cases. The major limitation to serological diagnosis of HTLV-II has been the difficulty of distinguishing HTLV-II from HTLV-I (human T cell leukemia virus type I) infection, because of substantial cross-reactivity between the viruses. A sensitive modification of the polymerase chain reaction method was used to provide unambiguous molecular evidence that a significant proportion of intravenous drug abusers are infected with HTLV, and the majority of these individuals are infected with HTLV-II rather than HTLV-I. Of 23 individuals confirmed by polymerase chain reaction analysis to be infected with HTLV, 21 were identified to be infected with HTLV-II, and 2 were infected with HTLV-I. Molecular identification of an HTLV-II--infected population provides an opportunity to investigate the pathogenicity of HTLV-II in humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, H -- Swanson, P -- Shorty, V S -- Zack, J A -- Rosenblatt, J D -- Chen, I S -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):471-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Diagnostics Division, Abbott Laboratories, North Chicago, IL 60064.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2655084" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; DNA, Viral/analysis ; DNA-Directed DNA Polymerase ; Genes, Viral ; HTLV-I Antibodies/analysis ; HTLV-I Infections/diagnosis/epidemiology/etiology ; HTLV-II Antibodies/*analysis ; HTLV-II Infections/diagnosis/*epidemiology/etiology ; Human T-lymphotropic virus 1/genetics/immunology ; Human T-lymphotropic virus 2/genetics/immunology ; Humans ; Immunoblotting ; Immunoenzyme Techniques ; Louisiana ; Molecular Sequence Data ; Sequence Homology, Nucleic Acid ; Substance-Related Disorders/*complications
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    Publication Date: 1989-07-07
    Description: Basic fibroblast growth factor (bFGF) participates in many processes including early developmental events, angiogenesis, wound healing, and maintenance of neuronal cell viability. A 130-kilodalton protein was isolated on the basis of its ability to specifically bind to bFGF. A complementary DNA clone was isolated with an oligonucleotide probe corresponding to determined amino acid sequences of tryptic peptide fragments of the purified protein. The putative bFGF receptor encoded by this complementary DNA is a transmembrane protein that contains three extracellular immunoglobulin-like domains, an unusual acidic region, and an intracellular tyrosine kinase domain. These domains are arranged in a pattern that is different from that of any growth factor receptor described.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, P L -- Johnson, D E -- Cousens, L S -- Fried, V A -- Williams, L T -- CA 21765/CA/NCI NIH HHS/ -- R01 HL32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):57-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544996" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cells, Cultured ; Chick Embryo ; *Cloning, Molecular ; DNA/*genetics ; Fibroblast Growth Factors/*genetics ; Kinetics ; Mice ; Molecular Sequence Data ; Peptide Fragments/analysis ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Fibroblast Growth Factor ; Recombinant Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    Publication Date: 1989-12-08
    Description: Vascular endothelial growth factor (VEGF) was purified from media conditioned by bovine pituitary folliculostellate cells (FC). VEGF is a heparin-binding growth factor specific for vascular endothelial cells that is able to induce angiogenesis in vivo. Complementary DNA clones for bovine and human VEGF were isolated from cDNA libraries prepared from FC and HL60 leukemia cells, respectively. These cDNAs encode hydrophilic proteins with sequences related to those of the A and B chains of platelet-derived growth factor. DNA sequencing suggests the existence of several molecular species of VEGF. VEGFs are secreted proteins, in contrast to other endothelial cell mitogens such as acidic or basic fibroblast growth factors and platelet-derived endothelial cell growth factor. Human 293 cells transfected with an expression vector containing a bovine or human VEGF cDNA insert secrete an endothelial cell mitogen that behaves like native VEGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Leung, D W -- Cachianes, G -- Kuang, W J -- Goeddel, D V -- Ferrara, N -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1306-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Genetech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479986" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cattle ; Cell Division ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; Gene Library ; Humans ; Lymphokines/genetics/*physiology/secretion ; Molecular Sequence Data ; Neovascularization, Pathologic/*physiopathology ; Sequence Homology, Nucleic Acid ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    Publication Date: 1989-05-05
    Description: An approach based on the polymerase chain reaction has been devised to clone new members of the family of genes encoding guanosine triphosphate-binding protein (G protein)-coupled receptors. Degenerate primers corresponding to consensus sequences of the third and sixth transmembrane segments of available receptors were used to selectively amplify and clone members of this gene family from thyroid complementary DNA. Clones encoding three known receptors and four new putative receptors were obtained. Sequence comparisons established that the new genes belong to the G protein-coupled receptor family. Close structural similarity was observed between one of the putative receptors and the 5HT1a receptor. Two other molecules displayed common sequence characteristics, suggesting that they are members of a new subfamily of receptors with a very short nonglycosylated (extracellular) amino-terminal extension.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Libert, F -- Parmentier, M -- Lefort, A -- Dinsart, C -- Van Sande, J -- Maenhaut, C -- Simons, M J -- Dumont, J E -- Vassart, G -- New York, N.Y. -- Science. 1989 May 5;244(4904):569-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Campus Erasme, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541503" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; DNA/genetics ; DNA-Directed DNA Polymerase ; GTP-Binding Proteins/*metabolism ; *Gene Amplification ; Humans ; Molecular Sequence Data ; Receptors, Adrenergic, alpha/genetics ; Receptors, Adrenergic, beta/genetics ; Receptors, Muscarinic/genetics ; Receptors, Neurokinin-2 ; Receptors, Neurotransmitter/*genetics ; Receptors, Serotonin/genetics ; Sequence Homology, Nucleic Acid ; Thyroid Gland/analysis ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    Publication Date: 1989-11-24
    Description: Ciliary neurotrophic factor (CNTF) is one of a small number of proteins with neurotrophic activities distinct from nerve growth factor (NGF). CNTF has now been purified and cloned and the primary structure of CNTF from rabbit sciatic nerve has been determined. Biologically active CNTF has been transiently expressed from a rabbit complementary DNA clone. CNTF is a neural effector without significant sequence homologies to any previously reported protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lin, L F -- Mismer, D -- Lile, J D -- Armes, L G -- Butler, E T 3rd -- Vannice, J L -- Collins, F -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1023-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Protein Chemistry Group, Synergen, Inc., Boulder, CO 80301.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587985" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cell Line ; Ciliary Neurotrophic Factor ; Cloning, Molecular ; DNA/genetics ; Molecular Sequence Data ; Nerve Growth Factors/*genetics ; Nerve Tissue Proteins/biosynthesis/*genetics/isolation & purification ; Rabbits ; Recombinant Proteins/biosynthesis ; Sciatic Nerve/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    Publication Date: 1989-01-13
    Description: In the polymerase chain reaction (PCR), two specific oligonucleotide primers are used to amplify the sequences between them. However, this technique is not suitable for amplifying genes that encode molecules where the 5' portion of the sequences of interest is not known, such as the T cell receptor (TCR) or immunoglobulins. Because of this limitation, a novel technique, anchored polymerase chain reaction (A-PCR), was devised that requires sequence specificity only on the 3' end of the target fragment. It was used to analyze TCR delta chain mRNA's from human peripheral blood gamma delta T cells. Most of these cells had a V delta gene segment not previously described (V delta 3), and the delta chain junctional sequences formed a discrete subpopulation compared with those previously reported.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loh, E Y -- Elliott, J F -- Cwirla, S -- Lanier, L L -- Davis, M M -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):217-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departments of Medicine and Microbiology and Immunology, Stanford University School of Medicine, CA 94305-5402.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463672" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cell Line ; Gene Amplification ; *Genes ; Humans ; Macromolecular Substances ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; RNA-Directed DNA Polymerase ; Receptors, Antigen, T-Cell/*genetics ; T-Lymphocytes/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    Publication Date: 1989-07-28
    Description: A 47-kilodalton neutrophil cytosol factor (NCF-47k), required for activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase superoxide (O2-.) production, is absent in most patients with autosomal recessive chronic granulomatous disease (AR-CGD). NCF-47k cDNAs were cloned from an expression library. The largest clone predicted a 41.9-kD protein that contained an arginine and serine-rich COOH-terminal domain with potential protein kinase C phosphorylation sites. A 33-amino acid segment of NCF-47k shared 49% identity with ras p21 guanosine triphosphatase activating protein. Recombinant NCF-47k restored O2-. -producing activity to AR-CGD neutrophil cytosol in a cell-free assay. Production of active recombinant NCF-47k will enable functional regions of this molecule to be mapped.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lomax, K J -- Leto, T L -- Nunoi, H -- Gallin, J I -- Malech, H L -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):409-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Bacterial Diseases Section, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547247" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Blotting, Northern ; Cloning, Molecular ; DNA/*genetics ; Granulomatous Disease, Chronic/enzymology/*genetics ; Humans ; Immunoblotting ; Molecular Sequence Data ; NADH, NADPH Oxidoreductases/*metabolism ; NADPH Oxidase ; Neutrophils/*metabolism ; Phosphoproteins/*genetics/metabolism ; Phosphorylation ; Recombinant Proteins/genetics/metabolism ; Superoxides/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    Publication Date: 1989-01-13
    Description: An important question in protein folding is whether the natural amino and carboxyl termini and the given order of secondary structure segments are critical to the stability and to the folding pathway of proteins. Here it is shown that two circularly permuted versions of the gene of a single-domain beta alpha barrel enzyme can be expressed in Escherichia coli. The variants are enzymically active and are practically indistinguishable from the original enzyme by several structural and spectroscopic criteria, despite the creation of new termini and the cleavage of a surface loop. This novel genetic approach should be useful for protein folding studies both in vitro and in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Luger, K -- Hommel, U -- Herold, M -- Hofsteenge, J -- Kirschner, K -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):206-10.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Abteilung Biophysikalische Chemie, Universitat Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2643160" target="_blank"〉PubMed〈/a〉
    Keywords: *Aldose-Ketose Isomerases ; Amino Acid Sequence ; Base Sequence ; Carbohydrate Epimerases/*genetics/metabolism ; Circular Dichroism ; *Cloning, Molecular ; Enzyme Stability ; Escherichia coli/*enzymology/genetics ; *Genes ; Genetic Variation ; Kinetics ; Molecular Sequence Data ; *Protein Conformation ; Spectrometry, Fluorescence ; Spectrophotometry, Ultraviolet
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    Publication Date: 1989-08-04
    Description: Complementary DNA clones, encoding the LH-hCG (luteinizing hormone-human choriogonadotropic hormone) receptor were isolated by screening a lambda gt11 library with monoclonal antibodies. The primary structure of the protein was deduced from the DNA sequence analysis; the protein contains 696 amino acids with a putative signal peptide of 27 amino acids. Hydropathy analysis suggests the existence of seven transmembrane domains that show homology with the corresponding regions of other G protein-coupled receptors. Three other types of clones corresponding to shorter proteins were observed, in which the putative transmembrane domain was absent. These probably arose through alternative splicing. RNA blot analysis showed similar patterns in testis and ovary with a major RNA of 4700 nucleotides and several minor species. The messenger RNA was expressed in COS-7 cells, yielding a protein that bound hCG with the same affinity as the testicular receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loosfelt, H -- Misrahi, M -- Atger, M -- Salesse, R -- Vu Hai-Luu Thi, M T -- Jolivet, A -- Guiochon-Mantel, A -- Sar, S -- Jallal, B -- Garnier, J -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):525-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut National de la Sante et de la Recherche Medicale Unite 135, Hopital de Bicetre, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502844" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Membrane/*metabolism ; *Cloning, Molecular ; DNA/*genetics ; Female ; GTP-Binding Proteins/metabolism ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Ovary/analysis ; Protein Sorting Signals/genetics ; RNA, Messenger/analysis/genetics ; Receptors, LH/*genetics/metabolism ; Sequence Homology, Nucleic Acid ; Swine ; Testis/analysis ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: An important control point in gene expression is at the level of messenger RNA (mRNA) stability. The mRNAs of certain regulatory cellular proteins such as oncogenes, cytokines, lymphokines, and transcriptional activators are extremely labile. These messages share a common AUUUA pentamer in their 3' untranslated region, which confers cytoplasmic instability. A cytosolic protein was identified that binds specifically to RNA molecules containing four reiterations of the AUUUA structural element. This protein consists of three subunits and binds rapidly to AUUUA-containing RNA. Such protein-RNA complexes are resistant to the actions of denaturing and reducing agents, demonstrating very stable binding. The time course, stability, and specificity of the protein-AUUUA interaction suggests the possibility that the formation of this complex may target susceptible mRNA for rapid cytoplasmic degradation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malter, J S -- CA01427-01/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):664-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Tulane University School of Medicine, New Orleans, LA 70112.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814487" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Binding, Competitive ; Carrier Proteins/isolation & purification/*metabolism ; Cell Line ; Humans ; Kinetics ; Macromolecular Substances ; Molecular Weight ; *Nucleocytoplasmic Transport Proteins ; RNA, Messenger/*metabolism ; *RNA-Binding Proteins ; Ribonuclease, Pancreatic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    Publication Date: 1989-11-03
    Description: The isolated head fragment of myosin is a motor protein that is able to use energy liberated from the hydrolysis of adenosine triphosphate to cause sliding movement of actin filaments. Expression of a myosin fragment nearly equivalent to the amino-terminal globular head domain, generally referred to as subfragment 1, has been achieved by transforming the eukaryotic organism Dictyostelium discoideum with a plasmid that carries a 2.6-kilobase fragment of the cloned Dictyostelium myosin heavy chain gene under the control of the Dictyostelium actin-15 promoter. The recombinant fragment of the myosin heavy chain was purified 2400-fold from one of the resulting cell lines and was found to be functional by the following criteria: the myosin head fragment copurified with the essential and regulatory myosin light chains, decorated actin filaments, and displayed actin-activated adenosine triphosphatase activity. In addition, motility assays in vitro showed that the recombinant myosin fragment is capable of supporting sliding movement of actin filaments.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Manstein, D J -- Ruppel, K M -- Spudich, J A -- GM 33289/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):656-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2530629" target="_blank"〉PubMed〈/a〉
    Keywords: Actins/genetics ; Cell Line ; Cloning, Molecular ; Dictyostelium/*genetics ; *Gene Expression ; *Genes ; Genetic Vectors ; Molecular Weight ; Myosin Subfragments/*genetics/isolation & purification ; Myosins/genetics/metabolism ; Plasmids ; Promoter Regions, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    Publication Date: 1989-08-18
    Description: Keratinocyte growth factor (KGF) is a human mitogen that is specific for epithelial cells. The complementary DNA sequence of KGF demonstrates that it is a member of the fibroblast growth factor family. The KGF transcript was present in stromal cells derived from epithelial tissues. By comparison with the expression of other epithelial cell mitogens, only KGF, among known human growth factors, has the properties of a stromal mediator of epithelial cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Finch, P W -- Rubin, J S -- Miki, T -- Ron, D -- Aaronson, S A -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):752-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475908" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Division ; Codon ; DNA/genetics/isolation & purification ; Epithelial Cells ; Epithelium/analysis/metabolism ; Fibroblast Growth Factor 10 ; Fibroblast Growth Factor 7 ; *Fibroblast Growth Factors/genetics ; Fibroblasts/metabolism ; Gene Expression Regulation ; Growth Substances/*genetics/physiology ; Humans ; Mesoderm/metabolism ; Mice ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oligonucleotide Probes ; RNA/analysis ; Sequence Homology, Nucleic Acid ; Skin/analysis ; Tissue Distribution ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    Publication Date: 1989-07-07
    Description: Insulin receptor complementary DNA has been cloned from an insulin-resistant individual whose receptors have impaired tyrosine protein kinase activity. One of this individual's alleles has a mutation in which valine is substituted for Gly996, the third glycine in the conserved Gly-X-Gly-X-X-Gly motif in the putative binding site fo adenosine triphosphate. Expression of the mutant receptor by transfection into Chinese hamster ovary cells confirmed that the mutation impairs tyrosine kinase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Odawara, M -- Kadowaki, T -- Yamamoto, R -- Shibasaki, Y -- Tobe, K -- Accili, D -- Bevins, C -- Mikami, Y -- Matsuura, N -- Akanuma, Y -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):66-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544998" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Amino Acid Sequence ; Base Sequence ; Diabetes Mellitus, Type 2/*genetics ; *Genes ; Humans ; Insulin Resistance ; Molecular Sequence Data ; *Mutation ; Protein-Tyrosine Kinases/*genetics ; Receptor, Insulin/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):126.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749249" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; *Computer Communication Networks ; *Computer Systems ; *Information Systems ; *Molecular Biology ; National Institutes of Health (U.S.) ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    Publication Date: 1989-03-31
    Description: The tpa-1 gene mediates the action of tumor-promoting phorbol esters in the nematode Caenorhabditis elegans. A genomic fragment that constitutes a portion of the tpa-1 gene was cloned by Tc1 transposon tagging and was used as a probe to screen a nematode complementary DNA library. One of the isolated complementary DNA clones had a nucleotide sequence that predicts a polypeptide of 526 amino acids. The predicted amino acid sequence revealed that the predicted tpa-1 protein sequence is highly similar to protein kinase C molecules from various animals, including man.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tabuse, Y -- Nishiwaki, K -- Miwa, J -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1713-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Fundamental Research Laboratories, NEC Corporation, Kawasaki, Kanagawa, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2538925" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Caenorhabditis/*drug effects/genetics ; Cloning, Molecular ; Codon ; DNA/genetics ; DNA Restriction Enzymes ; Drug Resistance/genetics ; Genetic Markers ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Phenotype ; Phorbol Esters/*pharmacology ; Protein Kinase C/*genetics ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    Publication Date: 1989-09-01
    Description: The structure and function of transcription factors of higher plants was studied by isolating cDNA clones encoding a wheat sequence-specific DNA binding protein. A hexameric nucleotide motif, ACGTCA, is located upstream from the TATA box of several plant histone genes. It has been suggested that this motif is essential for efficient transcription of the wheat histone H3 gene. A wheat nuclear protein, HBP-1 (histone DNA binding protein-1), which specifically binds to the hexameric motif, has previously been identified as a putative transcription factor. A cDNA clone encoding HBP-1 has been isolated on the basis of specific binding of HBP-1 to the hexameric motif. The deduced amino acid sequence indicates that HBP-1 contains the leucine zipper motif, which represents a characteristic property of several eukaryotic transcription factors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tabata, T -- Takase, H -- Takayama, S -- Mikami, K -- Nakatsuka, A -- Kawata, T -- Nakayama, T -- Iwabuchi, M -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):965-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Botany, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772648" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA/genetics ; DNA-Binding Proteins/*genetics ; *Genes ; Genes, Regulator ; Histones/*genetics ; Information Systems ; *Leucine ; Methylation ; Molecular Sequence Data ; Nuclear Proteins/*genetics ; Nucleic Acid Hybridization ; Plants/*genetics ; *Transcription, Genetic ; Triticum/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    Publication Date: 1989-10-27
    Description: Allele loss is a hallmark of chromosome regions harboring recessive oncogenes. Lung cancer frequently demonstrates loss of heterozygosity on 17p. Recent evidence suggests that the p53 gene located on 17p13 has many features of such an antioncogene. The p53 gene was frequently mutated or inactivated in all types of human lung cancer. The genetic abnormalities of p53 include gross changes such as homozygous deletions and abnormally sized messenger RNAs along with a variety of point or small mutations, which map to the p53 open reading frame and change amino acid sequence in a region highly conserved between mouse and man. In addition, very low or absent expression of p53 messenger RNA in lung cancer cell lines compared to normal lung was seen. These findings, coupled with the previous demonstration of 17p allele loss in lung cancer, strongly implicate p53 as an anti-oncogene whose disruption is involved in the pathogenesis of human lung cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, T -- Nau, M M -- Chiba, I -- Birrer, M J -- Rosenberg, R K -- Vinocour, M -- Levitt, M -- Pass, H -- Gazdar, A F -- Minna, J D -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):491-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉National Cancer Institute-Navy Medical Oncology Branch, Bethesda, MD 20814.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554494" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Carcinoid Tumor/genetics ; Carcinoma, Non-Small-Cell Lung/genetics ; Carcinoma, Small Cell/genetics ; Chromosomes, Human, Pair 17 ; DNA, Neoplasm/genetics ; Gene Amplification ; Humans ; Lung Neoplasms/*genetics ; Mutation ; Oncogene Proteins/*genetics ; Phosphoproteins/*genetics ; RNA, Messenger/genetics ; RNA, Neoplasm/genetics ; Ribonucleases ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    Publication Date: 1989-08-04
    Description: The pyrimidine analog 5-bromodeoxyuridine (BUdR) competes with thymidine for incorporation into DNA. Substitution of BUdR for thymidine does not significantly affect cell viability but does block cell differentiation in many different lineages. BUdR substitution in a mouse myoblast line blocked myogenic differentiation and extinguished the expression of the myogenic determination gene MyoD1. Forced expression of MyoD1 from a transfected expression vector in a BUdR-substituted myoblast overcame the block to differentiation imposed by BUdR. Activation of BUdR-substituted muscle structural genes and apparently normal differentiation were observed in transfected myoblasts. This shows that BUdR blocks myogenesis at the level of a myogenic regulatory gene, possibly MyoD1, not by directly inhibiting the activation of muscle structural genes. It is consistent with the idea that BUdR selectively blocks a class of regulatory genes, each member of which is important for the development of a different cell lineage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tapscott, S J -- Lassar, A B -- Davis, R L -- Weintraub, H -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):532-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Fred Hutchinson Cancer Research Center, Seattle, WA 98104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547249" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bromodeoxyuridine/metabolism/*pharmacology ; Cell Differentiation/drug effects ; Cell Line ; Creatine Kinase/genetics ; DNA/metabolism ; Desmin/genetics ; Gene Expression Regulation/*drug effects ; Genes ; Mice ; Muscle Proteins/*genetics ; Muscles/*cytology ; Myogenin ; Nuclear Proteins/*genetics ; Plasmids ; RNA, Messenger/genetics ; Repetitive Sequences, Nucleic Acid ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: The contribution of the anticodon to the discrimination between cognate and noncognate tRNAs by Escherichia coli Arg-tRNA synthetase has been investigated by in vitro synthesis and aminoacylation of elongator methionine tRNA (tRNA(mMet) mutants. Substitution of the Arg anticodon CCG for the Met anticodon CAU leads to a dramatic increase in Arg acceptance by tRNA(mMet). A nucleotide (A20) previously identified by others in the dihydrouridine loop of tRNA(Arg)s makes a smaller contribution to the conversion of tRNA(mMet) identity from Met to Arg. The combined anticodon and dihydrouridine loop mutations yield a tRNA(mMet) derivative that is aminoacylated with near-normal kinetics by the Arg-tRNA synthetase.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schulman, L H -- Pelka, H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1595-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology and Cancer, Albert Einstein College of Medicine, Bronx, NY 10461.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688091" target="_blank"〉PubMed〈/a〉
    Keywords: Anticodon/*genetics ; Arginine-tRNA Ligase/metabolism ; Base Sequence ; Escherichia coli/enzymology/genetics ; Kinetics ; Methionine-tRNA Ligase/metabolism ; Molecular Sequence Data ; Nucleic Acid Conformation ; RNA, Transfer/*genetics ; RNA, Transfer, Amino Acid-Specific/*genetics ; RNA, Transfer, Arg/*genetics ; Substrate Specificity ; T-Phages/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    Publication Date: 1989-11-10
    Description: A substitution mutation has been introduced into the c-abl locus of murine embryonic stem cells by homologous recombination between exogenously added DNA and the endogenous gene, and these cells have been used to generate chimeric mice. It is shown that the c-abl mutation was transmitted to progeny by several male chimeras. This work demonstrates the feasibility of germ-line transmission of a mutation introduced into a nonselectable autosomal gene by homologous recombination.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schwartzberg, P L -- Goff, S P -- Robertson, E J -- P01 CA 23767/CA/NCI NIH HHS/ -- R01 HD 25208/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):799-803.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, Columbia University, College of Physicians & Surgeons, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554496" target="_blank"〉PubMed〈/a〉
    Keywords: Abelson murine leukemia virus/*genetics ; Animals ; Blotting, Southern ; Cell Line ; Chimera ; Cloning, Molecular ; *DNA, Recombinant ; Female ; Leukemia Virus, Murine/*genetics ; Male ; Mice ; Mice, Inbred C57BL ; *Mutation ; Oncogenes/*physiology ; Retroviridae Proteins, Oncogenic/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    Publication Date: 1989-03-03
    Description: Isolation of a clone encoding the mouse lymph node homing receptor reveals a deduced protein with an unusual protein mosaic architecture, containing a separate carbohydrate-binding (lectin) domain, an epidermal growth factor-like (EGF) domain, and an extracellular precisely duplicated repeat unit, which preserves the motif seen in the homologous repeat structure of complement regulatory proteins and other proteins. The receptor molecule is potentially highly glycosylated, and contains an apparent transmembrane region. Analysis of messenger RNA transcripts reveals a predominantly lymphoid distribution in direct relation to the cell surface expression of the MEL-14 determinant, and the cDNA clone is shown to confer the MEL-14 epitope in heterologous cells. The many novel features, including ubiquitination, embodied in this single receptor molecule form the basis for numerous approaches to the study of cell-cell interactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siegelman, M H -- van de Rijn, M -- Weissman, I L -- AI09022/AI/NIAID NIH HHS/ -- OIG43551/PHS HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1165-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646713" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Base Sequence ; Binding Sites ; Carbohydrate Metabolism ; Cell Membrane/metabolism ; DNA/*genetics ; Epidermal Growth Factor ; Glycosylation ; Lymph Nodes/*metabolism ; Membrane Glycoproteins/*genetics ; Mice ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; Receptors, Lymphocyte Homing ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-16
    Description: Artificial yeast introns that show cold-sensitive splicing have been constructed. These conditional introns can be inserted into a target gene as an "intron cassette" without disrupting the coding information, allowing expression of the gene to be cold sensitive. Insertion of these intron cassettes rendered the yeast URA3 gene cold sensitive in its expression. The advantage of this intron-mediated control system is that any gene can be converted to a controllable gene by simple insertion of an intron.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yoshimatsu, T -- Nagawa, F -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1346-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Biotechnology Research, Wakunaga Pharmaceutical Co., Ltd., Hiroshima, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544026" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Cold Temperature ; DNA Transposable Elements ; *Gene Expression Regulation ; *Genetic Engineering ; *Introns ; Molecular Sequence Data ; Saccharomyces cerevisiae/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cell Line ; Chloramphenicol O-Acetyltransferase/genetics ; Chromosome Deletion ; *Enhancer Elements, Genetic ; *Genes, Viral ; Hepatitis B virus/*genetics ; Liver/*metabolism ; Molecular Sequence Data ; Mutation ; *Promoter Regions, Genetic ; Simplexvirus/enzymology/genetics ; Thymidine Kinase/genetics ; Transcription, Genetic ; Transfection ; Viral Structural Proteins/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    Publication Date: 1989-06-09
    Description: The neuron-specific protein GAP-43 is associated with the membrane of the nerve growth cone and thus may be important to the activity of this distinctive neuronal structure. Transient transfection of COS and NIH 3T3 cells with appropriate vectors resulted in expression of GAP-43 in these non-neuronal cells; as in neurons, transfected GAP-43 associated with the membrane. In addition, many long fine filopodial processes extended from the periphery of such transfected cells. Stable CHO cell lines expressing GAP-43 also exhibited processes that were more numerous, far longer, and more complex than those of CHO cell lines not transfected or transfected with control plasmids. Thus GAP-43 may directly contribute to growth cone activity by regulating cell membrane structure and enhancing extension of filopodial processes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zuber, M X -- Goodman, D W -- Karns, L R -- Fishman, M C -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1193-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Developmental Biology Laboratory, Massachusetts General Hospital Cancer Center, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658062" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Cell Membrane/*ultrastructure ; Cells, Cultured ; Fluorescent Antibody Technique ; GAP-43 Protein ; Growth Substances/*physiology ; Membrane Proteins/genetics/*physiology ; Mice ; Nerve Tissue Proteins/genetics/*physiology ; Recombinant Proteins/pharmacology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-04-21
    Description: The mouse albumin gene promoter has six closely spaced binding sites for nuclear proteins that are located between the TATA motif and nucleotide position -170. In vitro transcription with liver or spleen nuclear extracts of templates containing either mutated or polymerized albumin promoter elements establishes a hierarchy of the different protein binding sites for tissue-specific albumin gene transcription. The HNF-1 and C/EBP binding sites strongly activate transcription in a tissue-specific manner. The NF-Y binding site has a lower activation potential and is less specific, being equally efficient in liver and spleen nuclear extracts. The remaining elements are relatively weak activator sites.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Maire, P -- Wuarin, J -- Schibler, U -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):343-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departement de Biologie Moleculaire, Sciences II, Geneva, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2711183" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Carrier Proteins/metabolism/pharmacology ; Cell Nucleus/metabolism ; DNA-Binding Proteins/*metabolism ; Dicarboxylic Acid Transporters ; *Gene Expression Regulation/drug effects ; Liver/metabolism/ultrastructure ; Mice ; Nuclear Proteins/metabolism/pharmacology ; *Promoter Regions, Genetic ; Serum Albumin/*genetics ; Spleen/metabolism/ultrastructure ; Templates, Genetic ; Transcription Factors ; Transcription, Genetic/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: Parasitic protozoans and helminths pose considerable medical as well as scientific challenges. Investigations of the complex and very different life cycles of these organisms, their adaptation to the obligate parasitic mode of life, and their ability to face the hostile host environment have resulted in many exciting discoveries. Invasion of host erythrocytes by plasmodial sporozoites and intact skin by schistosomal cercariae are outlined as examples of the elaborate mechanisms of parasitism. Isolation and characterization of single protective antigens or subunit vaccines from these two organisms are examined as models for vaccine development. Finally, developments in exploring gene regulation in protozoans and free and parasitic nematodes are briefly outlined.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mahmoud, A A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1015-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Case Western Reserve University School of Medicine, Cleveland, OH 44106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686024" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Eukaryota/genetics/pathogenicity/*physiology ; Gene Expression Regulation ; Helminthiasis/*immunology ; Helminths/genetics/pathogenicity/*physiology ; Humans ; Molecular Sequence Data ; Protozoan Infections/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    Publication Date: 1989-02-17
    Description: The retinoblastoma (Rb) antioncogene encodes a nuclear phosphoprotein, p105-Rb, that forms protein complexes with the adenovirus E1A and SV40 large T oncoproteins. A novel, aberrant Rb protein detected in J82 bladder carcinoma cells was not able to form a complex with E1A and was less stable than p105-Rb. By means of a rapid method for the detection of mutations in Rb mRNA, this defective Rb protein was observed to result from a single point mutation within a splice acceptor sequence in J82 genomic DNA. This mutation eliminates a single exon and 35 amino acids from its encoded protein product.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Horowitz, J M -- Yandell, D W -- Park, S H -- Canning, S -- Whyte, P -- Buchkovich, K -- Harlow, E -- Weinberg, R A -- Dryja, T P -- CA 08131/CA/NCI NIH HHS/ -- CA 13106/CA/NCI NIH HHS/ -- CA 39826/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):937-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2521957" target="_blank"〉PubMed〈/a〉
    Keywords: Adenovirus Early Proteins ; Antigens, Polyomavirus Transforming ; Base Sequence ; DNA-Binding Proteins/metabolism ; Eye Neoplasms/*genetics ; Humans ; Molecular Sequence Data ; *Mutation ; Oncogene Proteins, Viral/metabolism ; *Oncogenes ; Phosphoproteins/*genetics/metabolism ; Retinoblastoma/*genetics ; Retinoblastoma Protein
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    Publication Date: 1989-12-22
    Description: The pituitary hormone thyrotropin, or thyroid-stimulating hormone (TSH), is the main physiological agent that regulates the thyroid gland. The thyrotropin receptor (TSHR) was cloned by selective amplification with the polymerase chain reaction of DNA segments presenting sequence similarity with genes for G protein-coupled receptors. Out of 11 new putative receptor clones obtained from genomic DNA, one had sequence characteristics different from all the others. Although this clone did not hybridize to thyroid transcripts, screening of a dog thyroid complementary DNA (cDNA) library at moderate stringency identified a cDNA encoding a 4.9-kilobase thyroid-specific transcript. The polypeptide encoded by this thyroid-specific transcript consisted of a 398-amino acid residue amino-terminal segment, constituting a putative extracellular domain, connected to a 346-residue carboxyl-terminal domain that contained seven putative transmembrane segments. Expression of the cDNA conferred TSH responsiveness to Xenopus oocytes and Y1 cells and a TSH binding phenotype to COS cells. The TSHR and the receptor for luteinizing hormone-choriogonadotropin constitute a subfamily of G protein-coupled receptors with distinct sequence characteristics.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parmentier, M -- Libert, F -- Maenhaut, C -- Lefort, A -- Gerard, C -- Perret, J -- Van Sande, J -- Dumont, J E -- Vassart, G -- R01-DK21732/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1620-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556796" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Blotting, Northern ; Cell Line ; *Cloning, Molecular ; Cyclic AMP ; Dogs ; Female ; *Genes ; Molecular Sequence Data ; Oocytes/drug effects/metabolism ; Organ Specificity ; Polymerase Chain Reaction/methods ; RNA, Messenger/genetics ; Receptors, Thyrotropin/*genetics ; Thyrotropin/pharmacology ; Transcription, Genetic ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-01
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Perlman, P S -- Butow, R A -- GM 35510/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1106-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Genetics, Ohio State University, Columbus 43210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479980" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; DNA/genetics ; *Introns/genetics ; Molecular Sequence Data ; Proteins/*genetics ; RNA/genetics ; *RNA Splicing/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    Publication Date: 1989-11-10
    Description: Genomic sequencing permits studies of in vivo DNA methylation and protein-DNA interactions, but its use has been limited because of the complexity of the mammalian genome. A newly developed genomic sequencing procedure in which a ligation mediated polymerase chain reaction (PCR) is used generates high quality, reproducible sequence ladders starting with only 1 microgram of uncloned mammalian DNA per reaction. Different sequence ladders can be created simultaneously by inclusion of multiple primers and visualized separately by rehybridization. Relatively little radioactivity is needed for hybridization and exposure times are short. Methylation patterns in genomic DNA are readily detectable; for example, 17 CpG dinucleotides in the 5' region of human X-linked PGK-1 (phosphoglycerate kinase 1) were found to be methylated on an inactive human X chromosome, but unmethylated on an active X chromosome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pfeifer, G P -- Steigerwald, S D -- Mueller, P R -- Wold, B -- Riggs, A D -- AG08196/AG/NIA NIH HHS/ -- GM355262BW/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):810-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Biology Section, Beckman Research Institute of the City of Hope, Duarte, CA 91010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814502" target="_blank"〉PubMed〈/a〉
    Keywords: 5-Methylcytosine ; Animals ; Autoradiography ; Base Sequence ; Cytosine ; DNA/*genetics/metabolism ; Exons ; HeLa Cells ; Humans ; Methylation ; Molecular Sequence Data ; *Nucleic Acid Amplification Techniques ; *Nucleic Acid Hybridization ; Phosphoglycerate Kinase/genetics ; Polymerase Chain Reaction/*methods ; Promoter Regions, Genetic ; X Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    Publication Date: 1989-05-05
    Description: Promonocytic (U1) and T lymphocytic (ACH-2) cell lines chronically infected with human immunodeficiency virus type 1 (HIV-1) constitutively express low levels of virus, but expression can be induced by phorbol esters and cytokines. Whereas ACH-2 cells produce infectious virions, U1 cells produce defective, noninfectious particles. Although 3'-azido-3'-deoxythimidine (AZT) prevented acute HIV infection of susceptible cells, it did not prevent the induction of HIV expression in the infected cell lines. In contrast, interferon alpha (IFN-alpha) inhibited the release of reverse transcriptase and viral antigens into the culture supernatant after phorbol ester stimulation of both cell lines. Further, IFN-alpha suppressed the production or release (or both) of whole HIV virions, but had no effect on the amount of cell-associated viral proteins. Also, after phorbol ester stimulation of ACH-2 cells, IFN-alpha reduced the number of infectious viral particles secreted into the culture supernatant, but had no effect on the infectivity of cell-associated virus. These findings lend support to the combined use of antiviral agents that have action at both the early (AZT) and the late (IFN-alpha) stages of HIV replication.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Poli, G -- Orenstein, J M -- Kinter, A -- Folks, T M -- Fauci, A S -- New York, N.Y. -- Science. 1989 May 5;244(4904):575-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2470148" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/therapy ; Cell Line ; Cell Membrane/microbiology ; Drug Therapy, Combination ; Gene Expression Regulation ; HIV-1/drug effects/*physiology/ultrastructure ; Immunoblotting ; Interferon Type I/administration & dosage/*pharmacology ; Microscopy, Electron ; Monocytes/microbiology ; RNA-Directed DNA Polymerase/metabolism ; Recombinant Proteins ; T-Lymphocytes/microbiology ; Tetradecanoylphorbol Acetate/pharmacology ; Transcription, Genetic ; Vacuoles/microbiology ; Virion/drug effects/physiology/ultrastructure ; Virus Replication/*drug effects ; Zidovudine/administration & dosage/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    Publication Date: 1989-02-03
    Description: The nitrogen regulatory (NtrC) protein of enteric bacteria, which binds to sites that have the properties of transcriptional enhancers, is known to activate transcription by a form of RNA polymerase that contains the NtrA protein (sigma 54) as sigma factor (referred to as sigma 54-holoenzyme). In the presence of adenosine triphosphate, the NtrC protein catalyzes isomerization of closed recognition complexes between sigma 54-holoenzyme and the glnA promoter to open complexes in which DNA in the region of the transcription start site is locally denatured. NtrC is not required subsequently for maintenance of open complexes or initiation of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Popham, D L -- Szeto, D -- Keener, J -- Kustu, S -- GM38361/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):629-35.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, Berkley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563595" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/analogs & derivatives/metabolism/pharmacology ; *Bacterial Proteins ; Base Sequence ; Binding Sites ; DNA, Bacterial/metabolism ; DNA-Binding Proteins/*metabolism ; DNA-Directed RNA Polymerases/metabolism ; Deoxyribonuclease I ; *Enhancer Elements, Genetic ; Glutamate-Ammonia Ligase/genetics ; Heparin/pharmacology ; Molecular Sequence Data ; Mutation ; PII Nitrogen Regulatory Proteins ; Phosphorylation ; Promoter Regions, Genetic ; Salmonella typhimurium/*genetics ; Sigma Factor/metabolism ; *Trans-Activators ; Transcription Factors ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    Publication Date: 1989-09-22
    Description: GABAA (gamma-aminobutyric acid A)-benzodiazepine receptors expressed in mammalian cells and assembled from one of three different alpha subunit variants (alpha 1, alpha 2, or alpha 3) in combination with a beta 1 and a gamma 2 subunit display the pharmacological properties of either type I or type II receptor subtypes. These receptors contain high-affinity binding sites for benzodiazepines. However, CL 218 872, 2-oxoquazepam, and methyl beta-carboline-3-carboxylate (beta-CCM) show a temperature-modulated selectivity for alpha 1 subunit-containing receptors. There were no significant differences in the binding of clonazepam, diazepam, Ro 15-1788, or dimethoxy-4-ethyl-beta-carboline-3-carboxylate (DMCM) to all three recombinant receptors. Receptors containing the alpha 3 subunit show greater GABA potentiation of benzodiazepine binding than receptors containing the alpha 1 or alpha 2 subunit, indicating that there are subtypes within the type II class. Thus, diversity in benzodiazepine pharmacology is generated by heterogeneity of the alpha subunit of the GABAA receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pritchett, D B -- Luddens, H -- Seeburg, P H -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1389-92.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Neuroendocrinology, Zentrum fur Molekulare Biologie, Universitat Heidelberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2551039" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Line ; Diazepam/metabolism ; Flumazenil/metabolism ; Flunitrazepam/metabolism ; Humans ; Molecular Weight ; Pyridazines/metabolism ; Receptors, GABA-A/classification/*genetics/metabolism ; Recombinant Proteins/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-02
    Description: Specialized regions of muscle fibers may result from differential gene expression within a single fiber. In order to investigate the range of action of individual nuclei in multinucleated myotubes, C2 myoblasts were transfected to obtain stable cell lines that express a reporter protein that is targeted to the nucleus. Hybrid myotubes were then formed containing one or a few transfected nuclei as well as a large number of nuclei from the parental strain. In order to determine how far the products of a single nucleus extend, transfected nuclei were labeled with [3H]thymidine before fusion and the myotubes were stained to identify the reporter protein. In such myotubes the fusion protein was not confined to its nucleus of origin, but was restricted to nearby nuclei.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ralston, E -- Hall, Z W -- NS 20107/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1066-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, School of Medicine, University of California, San Francisco 94143-0444.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543074" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Cell Nucleus/*metabolism ; Cloning, Molecular ; Cytoplasm/metabolism ; Enhancer Elements, Genetic ; Escherichia coli/genetics ; Fluorescent Antibody Technique ; Gene Expression Regulation ; Globins/genetics ; Mice ; Muscle Proteins/*genetics/metabolism ; Muscles/*ultrastructure ; Plasmids ; Promoter Regions, Genetic ; Receptors, Glucocorticoid/genetics ; Simian virus 40/genetics ; *Transfection ; beta-Galactosidase/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    Publication Date: 1989-08-11
    Description: Cholesterol balance in mammalian cells is maintained in part by sterol-mediated repression of gene transcription for the low density lipoprotein receptor and enzymes in the cholesterol biosynthetic pathway. A promoter sequence termed the sterol regulatory element (SRE) is essential for this repression. With the use of an oligonucleotide containing the SRE to screen a human hepatoma complementary DNA expression library, a clone for a DNA binding protein was isolated that binds to the conserved SRE octanucleotide in both a sequence-specific and a single-strand--specific manner. This protein contains seven highly conserved zinc finger repeats that exhibit striking sequence similarity to retroviral nucleic acid binding proteins (NBPs). We have designated the protein "cellular NBP" (CNBP). CNBP is expressed in a wide variety of tissues, is up regulated by sterols, and exhibits binding specificity that correlates with in vivo function. These properties are consistent with a role in sterol-mediated control of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rajavashisth, T B -- Taylor, A K -- Andalibi, A -- Svenson, K L -- Lusis, A J -- HL30568/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):640-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2562787" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Binding Sites ; Carcinoma, Hepatocellular/metabolism ; Cholesterol/biosynthesis ; DNA/*metabolism ; DNA Probes ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation/*drug effects ; Humans ; Hydroxymethylglutaryl CoA Reductases/genetics ; Liver Neoplasms/metabolism ; Metalloproteins/genetics/*metabolism ; Molecular Sequence Data ; Promoter Regions, Genetic ; *RNA-Binding Proteins ; Receptors, LDL/genetics ; *Regulatory Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Sterols/*pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    Publication Date: 1989-01-27
    Description: Techniques of gene amplification, molecular cloning, and sequence analysis were used to test for the presence of sequences related to human T-lymphotropic virus type I (HTLV-I) in peripheral blood mononuclear cells of six patients with multiple sclerosis (MS) and 20 normal individuals. HTLV-I sequences were detected in all six MS patients and in one individual from the control group by DNA blot analysis and molecular cloning of amplified DNAs. The viral sequence in MS patients were associated with adherent cell populations consisting predominantly of monocytes and macrophages. Molecular cloning and nucleotide sequence analysis indicated that these amplified viral sequences were related to the HTLV-I proviral genome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- Sandberg-Wollheim, M -- Mettus, R V -- Ray, P E -- DeFreitas, E -- Koprowski, H -- CA-10815/CA/NCI NIH HHS/ -- NS-11036/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):529-33.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536193" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Adult ; Base Sequence ; Child ; *Cloning, Molecular ; DNA Restriction Enzymes ; DNA, Viral/*genetics ; Female ; *Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Leukocytes, Mononuclear/analysis/microbiology ; Macrophages/analysis/microbiology ; Male ; Molecular Sequence Data ; Multiple Sclerosis/*microbiology ; Nucleic Acid Hybridization ; Oligonucleotide Probes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):10-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781296" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; DNA, Single-Stranded/genetics ; Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Multiple Sclerosis/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Expression of the c-myc oncogene is deregulated in a variety of malignancies. Rearrangement and mutation of the c-myc locus is a characteristic feature of human Burkitt's lymphoma. Whether deregulation is solely a result of mutation of c-myc or whether it is influenced by the transformed B cell context has not been determined. A translocated and mutated allele of c-myc was stably transfected into fibroblasts. The rearranged allele was expressed indistinguishably from a normal c-myc gene: it had serum-regulated expression, was transcribed with normal promoter preference, and was strongly attenuated. Thus mutations by themselves are insufficient to deregulate c-myc transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richman, A -- Hayday, A -- 40364/PHS HHS/ -- GM 07499/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):494-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Burkitt Lymphoma/genetics ; Cell Line ; Fibroblasts/metabolism ; Gene Expression Regulation, Neoplastic ; Humans ; Mutation ; Oncogenes/*genetics ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-myc ; *Transfection ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: A procedure has been developed for introducing exogenous DNA into mouse eggs by injection of chromosome fragments. Chromosome fragments were dissected from human metaphase spreads and microinjected into the pronuclei of fertilized mouse eggs. Many of the injected eggs subsequently exhibited normal pre- and postimplantation development. Embryos obtained from eggs injected with centromeric fragments retained human centromeric DNA as demonstrated by in situ hybridization analysis. From eggs injected with noncentromeric fragments, a mouse was obtained whose tail tissue exhibited the presence of human DNA. This procedure should facilitate incorporation of very large (more than 10 megabases) DNA fragments into cells and embryos without the need for cloned sequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richa, J -- Lo, C W -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):175-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749254" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blastocyst ; Cell Line ; Centromere ; *Chromosomes, Human ; DNA/*genetics ; Humans ; Metaphase ; Mice ; *Mice, Transgenic ; Microinjections ; Nucleic Acid Hybridization ; Ovum ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    Publication Date: 1989-09-08
    Description: Overlapping complementary DNA clones were isolated from epithelial cell libraries with a genomic DNA segment containing a portion of the putative cystic fibrosis (CF) locus, which is on chromosome 7. Transcripts, approximately 6500 nucleotides in size, were detectable in the tissues affected in patients with CF. The predicted protein consists of two similar motifs, each with (i) a domain having properties consistent with membrane association and (ii) a domain believed to be involved in ATP (adenosine triphosphate) binding. A deletion of three base pairs that results in the omission of a phenylalanine residue at the center of the first predicted nucleotide-binding domain was detected in CF patients.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riordan, J R -- Rommens, J M -- Kerem, B -- Alon, N -- Rozmahel, R -- Grzelczak, Z -- Zielenski, J -- Lok, S -- Plavsic, N -- Chou, J L -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1066-73.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475911" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Biological Transport ; Cloning, Molecular/methods ; Cystic Fibrosis/*genetics/metabolism/pathology ; Cystic Fibrosis Transmembrane Conductance Regulator ; DNA/*isolation & purification ; *Genes ; *Genes, Recessive ; Humans ; Ion Channels/pathology ; Membrane Proteins/*genetics/isolation & purification ; Molecular Sequence Data ; Peptides/*genetics/isolation & purification ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):576, 578.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814484" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Costs and Cost Analysis ; DNA/*genetics ; Human Genome Project/*economics ; Humans ; *Information Systems ; *Internationality ; Japan ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    Publication Date: 1989-09-01
    Description: Phenotypic heterogeneity in the repetitive portion of a human malaria circumsporozoite (CS) protein, a major target of candidate vaccines, has been found. Over 14% of clinical cases of uncomplicated Plasmodium vivax malaria at two sites in western Thailand produced sporozoites immunologically distinct from previously characterized examples of the species. Monoclonal antibodies to the CS protein of other P. vivax isolates and to other species of human and simian malarias did not bind to these nonreactive sporozoites, nor did antibodies from monkeys immunized with a candidate vaccine made from the repeat portion of a New World CS protein. The section of the CS protein gene between the conserved regions I and II of a nonreactive isolate contained a nonapeptide repeat, Ala-Asn-Gly-Ala-Gly-Asn-Gln-Pro-Gly, identical at only three amino acid positions with published nonapeptide sequences. This heterogeneity implies that a P. vivax vaccine based on the CS protein repeat of one isolate will not be universally protective.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenberg, R -- Wirtz, R A -- Lanar, D E -- Sattabongkot, J -- Hall, T -- Waters, A P -- Prasittisuk, C -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):973-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Entomology, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672336" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, Surface/*genetics ; Base Sequence ; Gene Amplification ; *Genes ; Humans ; Malaria/parasitology ; Molecular Sequence Data ; Phenotype ; Plasmodium vivax/*genetics/growth & development ; *Protozoan Proteins ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    Publication Date: 1989-06-23
    Description: Adipsin is a serine protease that is secreted by adipocytes into the bloodstream; it is deficient in several animal models of obesity, representing a striking example of defective gene expression in this disorder. Recombinant mouse adipsin was purified and its biochemical and enzymatic properties were studied in order to elucidate the function of this protein. Activated adipsin has little or no proteolytic activity toward most substrates but has the same activity as human complement factor D, cleaving complement factor B when it is complexed with activated complement component C3. Like authentic factor D, adipsin can activate the alternative pathway of complement, resulting in red blood cell lysis. Decreased (58 to 80 percent) complement factor D activity, relative to lean controls, was observed as a common feature of several experimental models of obesity, including the ob/ob, db/db, and monosodium glutamate (MSG)-injected mouse and the fa/fa rat. These results suggest that adipsin and the alternative pathway of complement may play an unexpected but important role in the regulation of systemic energy balance in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosen, B S -- Cook, K S -- Yaglom, J -- Groves, D L -- Volanakis, J E -- Damm, D -- White, T -- Spiegelman, B M -- DK31403/DK/NIDDK NIH HHS/ -- DK34605/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1483-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734615" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/metabolism ; Amino Acid Sequence ; Animals ; Cell Line ; Complement Activating Enzymes/*metabolism ; Complement Factor D/*metabolism ; Complement Pathway, Alternative ; Cricetinae ; DNA/genetics ; Gene Expression Regulation ; Humans ; Immunoblotting ; Mice ; Molecular Sequence Data ; Obesity/genetics/*immunology/metabolism ; RNA, Messenger/metabolism ; Recombinant Proteins ; Serine Endopeptidases/genetics/isolation & purification/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    Publication Date: 1989-09-08
    Description: An understanding of the basic defect in the inherited disorder cystic fibrosis requires cloning of the cystic fibrosis gene and definition of its protein product. In the absence of direct functional information, chromosomal map position is a guide for locating the gene. Chromosome walking and jumping and complementary DNA hybridization were used to isolate DNA sequences, encompassing more than 500,000 base pairs, from the cystic fibrosis region on the long arm of human chromosome 7. Several transcribed sequences and conserved segments were identified in this cloned region. One of these corresponds to the cystic fibrosis gene and spans approximately 250,000 base pairs of genomic DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rommens, J M -- Iannuzzi, M C -- Kerem, B -- Drumm, M L -- Melmer, G -- Dean, M -- Rozmahel, R -- Cole, J L -- Kennedy, D -- Hidaka, N -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- N01-CO-74102/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1059-65.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772657" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cattle ; Chickens ; *Chromosome Mapping ; *Chromosomes, Human, Pair 7 ; Cloning, Molecular/methods ; Cricetinae ; Cystic Fibrosis/*genetics ; DNA Probes ; Genes, Overlapping ; *Genes, Recessive ; Genetic Markers ; Humans ; Mice ; Nucleic Acid Hybridization ; Restriction Mapping/methods
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    Publication Date: 1989-12-01
    Description: The crystal structure of Escherichia coli glutaminyl-tRNA synthetase (GlnRS) complexed with its cognate glutaminyl transfer RNA (tRNA(Gln] and adenosine triphosphate (ATP) has been derived from a 2.8 angstrom resolution electron density map and the known protein and tRNA sequences. The 63.4-kilodalton monomeric enzyme consists of four domains arranged to give an elongated molecule with an axial ratio greater than 3 to 1. Its interactions with the tRNA extend from the anticodon to the acceptor stem along the entire inside of the L of the tRNA. The complexed tRNA retains the overall conformation of the yeast phenylalanine tRNA (tRNA(Phe] with two major differences: the 3' acceptor strand of tRNA(Gln) makes a hairpin turn toward the inside of the L, with the disruption of the final base pair of the acceptor stem, and the anticodon loop adopts a conformation not seen in any of the previously determined tRNA structures. Specific recognition elements identified so far include (i) enzyme contacts with the 2-amino groups of guanine via the tRNA minor groove in the acceptor stem at G2 and G3; (ii) interactions between the enzyme and the anticodon nucleotides; and (iii) the ability of the nucleotides G73 and U1.A72 of the cognate tRNA to assume a conformation stabilized by the protein at a lower free energy cost than noncognate sequences. The central domain of this synthetase binds ATP, glutamine, and the acceptor end of the tRNA as well as making specific interactions with the acceptor stem.2+t is〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rould, M A -- Perona, J J -- Soll, D -- Steitz, T A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1135-42.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479982" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/*metabolism ; Amino Acyl-tRNA Synthetases/genetics/*metabolism ; Anticodon ; Base Composition ; Base Sequence ; Binding Sites ; Biological Evolution ; Chemistry, Physical ; Crystallization ; Escherichia coli/*enzymology/genetics ; Molecular Sequence Data ; Molecular Structure ; Nucleic Acid Conformation ; Physicochemical Phenomena ; RNA, Bacterial/*metabolism ; RNA, Fungal ; RNA, Transfer, Amino Acid-Specific/*metabolism ; RNA, Transfer, Gln/*metabolism ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    Publication Date: 1989-03-10
    Description: An analysis of the aminoacylation kinetics of unmodified yeast tRNAPhe mutants revealed that five single-stranded nucleotides are important for its recognition by yeast phenylalanyl-tRNA synthetase, provided they were positioned correctly in a properly folded tRNA structure. When four other tRNAs were changed to have these five nucleotides, they became near-normal substrates for the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sampson, J R -- DiRenzo, A B -- Behlen, L S -- Uhlenbeck, O C -- GM 37552/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1363-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646717" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acyl-tRNA Synthetases/*metabolism ; Base Sequence ; Escherichia coli/genetics ; Models, Molecular ; Molecular Sequence Data ; Mutation ; Nucleic Acid Conformation ; Phenylalanine-tRNA Ligase/*metabolism ; Plants/genetics ; RNA, Transfer, Amino Acid-Specific/*genetics ; RNA, Transfer, Phe/*genetics/metabolism ; Schizosaccharomyces/genetics ; Transcription, Genetic ; Triticum/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    Publication Date: 1989-08-11
    Description: The endogenous c-mos product, pp39mos, is required for progesterone-induced meiotic maturation in Xenopus oocytes. Treatment of oocytes with progesterone induced a rapid increase in pp39mos that preceded both the activation of maturation promoting factor (MPF) and germinal vesicle breakdown (GVBD). Microinjection of synthetic mos RNA into oocytes activated MPF and induced GVBD in the absence of progesterone. Thus, the mos proto-oncogene product may qualify as a candidate "initiator" protein of MPF and is at least one of the "triggers" for G2 to M transition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagata, N -- Daar, I -- Oskarsson, M -- Showalter, S D -- Vande Woude, G F -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):643-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉BRI-Basic Research Program, National Cancer Institute, Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474853" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cycloheximide/pharmacology ; Female ; Growth Substances/physiology ; Kinetics ; Maturation-Promoting Factor ; Meiosis/drug effects ; Microinjections ; Oocytes/*physiology ; Progesterone/pharmacology ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*physiology ; Proto-Oncogene Proteins c-mos ; RNA/genetics ; Transcription, Genetic ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    Publication Date: 1989-05-19
    Description: Chemical probing methods have been used to "footprint" 16S ribosomal RNA (rRNA) at each step during the in vitro assembly of twenty 30S subunit ribosomal proteins. These experiments yield information about the location of each protein relative to the structure of 16S rRNA and provide the basis for derivation of a detailed model for the three-dimensional folding of 16S rRNA. Several lines of evidence suggest that protein-dependent conformational changes in 16S rRNA play an important part in the cooperativity of ribosome assembly and in fine-tuning of the conformation and dynamics of 16S rRNA in the 30S subunit.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stern, S -- Powers, T -- Changchien, L M -- Noller, H F -- GM-17129/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):783-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Thimann Laboratories, University of California, Santa Cruz 95064.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658053" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Escherichia coli ; Models, Molecular ; Molecular Sequence Data ; Molecular Structure ; Nucleic Acid Conformation ; RNA, Ribosomal/*metabolism ; RNA, Ribosomal, 16S/*metabolism ; Ribosomal Proteins/*metabolism ; Ribosomes/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    Publication Date: 1989-09-29
    Description: Synapsins are neuronal phosphoproteins that coat synaptic vesicles, bind to the cytoskeleton, and are believed to function in the regulation of neurotransmitter release. Molecular cloning reveals that the synapsins comprise a family of four homologous proteins whose messenger RNA's are generated by differential splicing of transcripts from two genes. Each synapsin is a mosaic composed of homologous amino-terminal domains common to all synapsins and different combinations of distinct carboxyl-terminal domains. Immunocytochemical studies demonstrate that all four synapsins are widely distributed in nerve terminals, but that their relative amounts vary among different kinds of synapses. The structural diversity and differential distribution of the four synapsins suggest common and different roles of each in the integration of distinct signal transduction pathways that modulate neurotransmitter release in various types of neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sudhof, T C -- Czernik, A J -- Kao, H T -- Takei, K -- Johnston, P A -- Horiuchi, A -- Kanazir, S D -- Wagner, M A -- Perin, M S -- De Camilli, P -- AA 06944/AA/NIAAA NIH HHS/ -- MH 39327/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1474-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Dallas, TX.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Molecular Sequence Data ; Nerve Tissue Proteins/*genetics ; Neuropeptides/*genetics ; Phosphoproteins/*genetics ; Sequence Homology, Nucleic Acid ; Structure-Activity Relationship ; Synapsins ; Synaptic Vesicles/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    Publication Date: 1989-02-17
    Description: Salmonella bacteria are capable of entering (invading) and multiplying within eukaryotic cells. Stable adherence to and invasion of epithelial cells by S. choleraesuis and S. typhimurium were found to require de novo synthesis of several new bacterial proteins. This inducible event appears to be a coordinately regulated system dependent on trypsin- and neuraminidase-sensitive structures present on the epithelial cell surface. Mutants of S. choleraesuis and S. typhimurium were unable to synthesize these proteins and did not stably adhere to nor invade eukaryotic cells. Two such S. typhimurium mutants were avirulent in mice, an indication that these proteins are required for Salmonella virulence.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Finlay, B B -- Heffron, F -- Falkow, S -- AI26195/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):940-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical Microbiology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2919285" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Bacterial Adhesion ; Bacterial Proteins/*biosynthesis ; Cell Line ; Epithelium/physiology ; Kinetics ; Methionine/metabolism ; Salmonella/pathogenicity/*physiology ; Sulfur Radioisotopes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    Publication Date: 1989-03-17
    Description: Ornithine decarboxylase (ODC) was converted from a protein with a short intracellular half-life in mammalian cells to a stable protein by truncating 37 residues at its carboxyl terminus. Cells expressing wild-type protein lost ODC activity with a half-life of approximately 1 hour. Cells expressing the truncated protein, however, retained full activity for at least 4 hours. Pulse-chase experiments in which immunoprecipitation and gel electrophoresis were used confirmed the stabilizing effect of the truncation. Thus, a carboxyl-terminal domain is responsible for the rapid intracellular degradation of murine ODC.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ghoda, L -- van Daalen Wetters, T -- Macrae, M -- Ascherman, D -- Coffino, P -- CA 09043/CA/NCI NIH HHS/ -- CA 29048/CA/NCI NIH HHS/ -- CA 47721/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1493-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928784" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Cloning, Molecular ; Mice ; Ornithine Decarboxylase/genetics/*metabolism ; Recombinant Proteins/metabolism ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    Publication Date: 1989-09-22
    Description: Sera from patients with autoimmune diseases often contain antibodies that bind ribonucleoproteins (RNPs). Sera from 30 such patients were found to immunoprecipitate ribonuclease P (RNase P), an RNP enzyme required to process the 5' termini of transfer RNA transcripts in nuclei and mitochondria of eukaryotic cells. All 30 sera also immunoprecipitated the nucleolar Th RNP, indicating that the two RNPs are structurally related. Nucleotide sequence analysis of the Th RNP revealed it was identical to the RNA component of the mitochondrial RNA processing enzyme known as RNase MRP. Antibodies that immunoprecipitated the Th RNP selectively depleted murine and human cell extracts of RNase MRP activity, indicating that the Th and RNase MRP RNPs are identical. Since RNase P and RNase MRP are not associated with each other during biochemical purification, we suggest that these two RNA processing enzymes share a common autoantigenic polypeptide.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gold, H A -- Topper, J N -- Clayton, D A -- Craft, J -- AI 26853/AI/NIAID NIH HHS/ -- GM 33088-19/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1377-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Yale University School of Medicine, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476849" target="_blank"〉PubMed〈/a〉
    Keywords: *Autoantigens ; Base Sequence ; Cell Nucleus/enzymology ; *Endoribonucleases/analysis/immunology ; Humans ; Mitochondria/enzymology ; Molecular Sequence Data ; RNA/analysis ; *RNA Processing, Post-Transcriptional ; Ribonuclease P ; *Ribonucleoproteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: Analysis of crosslinked complexes of M1 RNA, the catalytic RNA subunit of ribonuclease P from Escherichia coli, and transfer RNA precursor substrates has led to the identification of regions in the enzyme and in the substrate that are in close physical proximity to each other. The nucleotide in M1 RNA, residue C92, which participates in a crosslink with the substrate was deleted and the resulting mutant M1 RNA was shown to cleave substrates lacking the 3' terminal CCAUCA sequence at sites several nucleotides away from the normal site of cleavage. The presence or absence of the 3' terminal CCAUCA sequence in transfer RNA precursor substrates markedly affects the way in which these substrates interact with the catalytic RNA in the enzyme-substrate complex. The contacts between wild-type M1 RNA and its substrate are in a region that resembles part of the transfer RNA "E" (exit) site in 23S ribosomal RNA. These data demonstrate that in RNA's with very different cellular functions, there are domains with similar structural and functional properties and that there is a nucleotide in M1 RNA that affects the site of cleavage by the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Guerrier-Takada, C -- Lumelsky, N -- Altman, S -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1578-84.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Yale University, New Haven, CT 06520.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480641" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Endoribonucleases/genetics/*metabolism ; Escherichia coli/enzymology/*genetics ; *Escherichia coli Proteins ; Kinetics ; Molecular Sequence Data ; Nucleic Acid Conformation ; RNA Precursors/genetics ; RNA, Bacterial/*genetics/metabolism ; RNA, Transfer/genetics ; Ribonuclease P ; Substrate Specificity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    Publication Date: 1989-05-05
    Description: Interleukin-2 (IL-2) binds to two distinct receptor molecules, the IL-2 receptor alpha (IL-2R alpha, p55) chain and the newly identified IL-2 receptor beta (IL-2R beta, p70-75) chain. The cDNA encoding the human IL-2R beta chain has now been isolated. The overall primary structure of the IL-2R beta chain shows no apparent homology to other known receptors. Unlike the IL-2R alpha chain, the IL-2R beta chain has a large cytoplasmic region in which a functional domain (or domains) mediating an intracellular signal transduction pathway (or pathways) may be embodied. The cDNA-encoded beta chain binds and internalizes IL-2 when expressed on T lymphoid cells but not fibroblast cells. Furthermore, the cDNA gives rise to the generation of high-affinity IL-2 receptor when co-expressed with the IL-2R alpha chain cDNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hatakeyama, M -- Tsudo, M -- Minamoto, S -- Kono, T -- Doi, T -- Miyata, T -- Miyasaka, M -- Taniguchi, T -- New York, N.Y. -- Science. 1989 May 5;244(4904):551-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785715" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; Cross-Linking Reagents ; DNA/*genetics/isolation & purification ; Fibroblasts/metabolism ; Gene Expression Regulation ; Humans ; Interleukin-2/metabolism ; Leukemia ; Molecular Sequence Data ; Nucleic Acid Hybridization ; RNA, Messenger/genetics ; Receptors, Interleukin-2/*genetics/metabolism ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Signal Transduction ; Succinimides ; T-Lymphocytes/metabolism ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 82
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 83
    Publication Date: 1989-08-18
    Description: Two distinct CD3-associated T cell receptors (TCR alpha beta and TCR gamma delta) are expressed in a mutually exclusive fashion on separate subsets of T lymphocytes. While the specificity of the TCR alpha beta repertoire for major histocompatibility complex (MHC) antigens is well established, the diversity of expressed gamma delta receptors and the ligands they recognize are less well understood. An alloreactive CD3+CD4-CD8- T cell line specific for murine class II MHC (Ia) antigens encoded in the I-E subregion of the H-2 gene complex was identified, and the primary structure of its gamma delta receptor heterodimer was characterized. In contrast to a TCR alpha beta-expressing alloreactive T cell line selected for similar specificity, the TCR gamma delta line displayed broad cross-reactivity for multiple distinct I-E-encoded allogeneic Ia molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matis, L A -- Fry, A M -- Cron, R Q -- Cotterman, M M -- Dick, R F -- Bluestone, J A -- 5-T32AI07090-10/AI/NIAID NIH HHS/ -- CA-14599-15/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):746-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biochemistry and Biophysics, Food and Drug Administration, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2528206" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Antigens, CD3 ; Antigens, Differentiation, T-Lymphocyte/analysis/immunology ; Base Sequence ; Cell Line ; Cloning, Molecular ; Cytotoxicity, Immunologic ; H-2 Antigens/genetics/immunology ; Histocompatibility Antigens Class II/genetics/*immunology ; Hybridomas/immunology ; Immunosorbent Techniques ; Macromolecular Substances ; Mice ; Mice, Nude ; Molecular Sequence Data ; Receptors, Antigen, T-Cell/analysis/genetics/*immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 84
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-23
    Description: Guanosine 5'-triphosphate (GTP)-binding proteins have been implicated in the transport of newly synthesized proteins along the secretory pathway of yeast and mammalian cells. Early vesicle fusion events that follow receptor-mediated endocytosis as measured by three in vitro assays were blocked by guanosine 5'-O-(3-thiotriphosphate) and aluminum fluoride. The effect was specific for guanosine nucleotides and depended on the presence of cytosolic factors. Thus, GTP-binding proteins may also have a role in the transport of molecules along the endocytic pathway.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mayorga, L S -- Diaz, R -- Stahl, P D -- AI 20015/AI/NIAID NIH HHS/ -- CA 12858/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1475-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499930" target="_blank"〉PubMed〈/a〉
    Keywords: Biological Transport/drug effects ; Cell Line ; Cell-Free System ; Cytosol/physiology ; Dinitrophenols/immunology/metabolism ; *Endocytosis/drug effects ; Exocytosis ; GTP-Binding Proteins/*physiology ; Glucuronidase/metabolism ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Immunoglobulin G/metabolism ; Immunosorbent Techniques ; Intracellular Membranes/physiology ; Macrophages/metabolism/ultrastructure ; Membrane Fusion/drug effects ; Organelles/ultrastructure ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 85
    Publication Date: 1989-05-12
    Description: The intervening sequence of the ribosomal RNA precursor of Tetrahymena is a catalytic RNA molecule, or ribozyme. Acting as a sequence-specific endoribonuclease, it cleaves single-stranded RNA substrates with concomitant addition of guanosine. The chemistry of the reaction has now been studied by introduction of a single phosphorothioate in the substrate RNA at the cleavage site. Kinetic studies show no significant effect of this substitution on kcat (rate constant) or Km (Michaelis constant), providing evidence that some step other than the chemical step is rate-limiting. Product analysis reveals that the reaction proceeds with inversion of configuration at phosphorus, consistent with an in-line, SN2 (P) mechanism. Thus, the ribozyme reaction is in the same mechanistic category as the individual displacement reactions catalyzed by protein nucleotidyltransferases, phosphotransferases, and nucleases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McSwiggen, J A -- Cech, T R -- GM28039/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 12;244(4905):679-83.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309-0215.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2470150" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Guanosine/metabolism ; Hydrolysis ; Kinetics ; Molecular Conformation ; Phosphates/metabolism ; Phosphorus ; RNA/*metabolism ; RNA Precursors/*metabolism ; RNA Splicing ; RNA, Catalytic ; RNA, Ribosomal/*metabolism ; Tetrahymena/*genetics ; Thionucleotides/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 86
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 87
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-28
    Description: The cloning of genes encoding mammalian DNA binding transcription factors for RNA polymerase II has provided the opportunity to analyze the structure and function of these proteins. This review summarizes recent studies that define structural domains for DNA binding and transcriptional activation functions in sequence-specific transcription factors. The mechanisms by which these factors may activate transcriptional initiation and by which they may be regulated to achieve differential gene expression are also discussed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mitchell, P J -- Tjian, R -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):371-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2667136" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Binding Sites ; Cloning, Molecular ; DNA-Binding Proteins/*genetics/metabolism ; Gene Expression Regulation ; Molecular Sequence Data ; Protein Processing, Post-Translational ; RNA Polymerase II/*genetics/metabolism ; Repetitive Sequences, Nucleic Acid ; Transcription Factors/*genetics/metabolism ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 88
    Publication Date: 1989-11-17
    Description: The zona pellucida surrounding mouse oocytes is an extracellular matrix composed of three sulfated glycoproteins, ZP1, ZP2, and ZP3. It has been demonstrated that a monoclonal antibody to ZP3 injected into female mice inhibits fertilization by binding to the zona pellucida and blocking sperm penetration. A complementary DNA encoding ZP3 was randomly cleaved and 200- to 1000-base pair fragments were cloned into the expression vector lambda gt11. This epitope library was screened with the aforementioned contraceptive antibody, and the positive clones were used to map the seven-amino acid epitope recognized by the antibody. Female mice were immunized with a synthetic peptide containing this B cell epitope coupled to a carrier protein to provide helper T cell epitopes. The resultant circulating antibodies to ZP3 bound to the zona pellucida of immunized animals and produced long-lasting contraception. The lack of ovarian histopathology or cellular cytotoxicity among the immunized animals may be because of the absence of zona pellucida T cell epitopes in this vaccine.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millar, S E -- Chamow, S M -- Baur, A W -- Oliver, C -- Robey, F -- Dean, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):935-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479101" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens/immunology ; Base Sequence ; Cloning, Molecular ; *Contraception ; *Contraception, Immunologic ; DNA/genetics ; *Egg Proteins ; Epitopes/analysis ; Female ; Glycoproteins/genetics/*immunology ; Male ; *Membrane Glycoproteins ; Mice ; Molecular Sequence Data ; Ovum/*physiology ; Protein Conformation ; RNA, Messenger/genetics ; *Receptors, Cell Surface ; *Vaccination ; Zona Pellucida/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 89
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 90
    Publication Date: 1989-08-11
    Description: Cadherins are a family of Ca2+-dependent intercellular adhesion molecules. Complementary DNAs encoding mouse neural cadherin (N-cadherin) were cloned, and the cell binding specificity of this molecule was examined. Mouse N-cadherin shows 92 percent similarity in amino acid sequence to the chicken homolog, while it shows 49 percent and 43 percent similarity to epithelial cadherin and to placental cadherin of the same species, respectively. In cell binding assays, mouse N-cadherin did not cross-react with other mouse cadherins, but it did cross-react with chicken N-cadherin. The results indicate that each cadherin type confers distinct adhesive specificities on different cells, and also that the specificity of N-cadherin is conserved between mammalian and avian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miyatani, S -- Shimamura, K -- Hatta, M -- Nagafuchi, A -- Nose, A -- Matsunaga, M -- Hatta, K -- Takeichi, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):631-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2762814" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Antigens, Surface/genetics/*physiology ; Base Sequence ; Brain Chemistry ; *Cell Adhesion ; Cell Adhesion Molecules ; Chickens ; Cloning, Molecular ; DNA/genetics ; Embryo, Mammalian ; Embryo, Nonmammalian ; L Cells (Cell Line) ; Mice ; Molecular Sequence Data ; Nerve Tissue/*analysis ; Nucleic Acid Hybridization ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 91
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 92
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: In vivo protein-DNA interactions at the developmentally regulated enhancer of the mouse muscle creatine kinase (MCK) gene were examined by a newly developed polymerase chain reaction (PCR) footprinting procedure. This ligation mediated, single-sided PCR technique permits the exponential amplification of an entire sequence ladder. Several footprints were detected in terminally differentiated muscle cells where the MCK gene is actively transcribed. None were observed in myogenic cells prior to differentiation or in nonmuscle cells. Two footprints appear to correspond to sites that can bind the myogenic regulator MyoD1 in vitro, whereas two others represent muscle specific use of apparently general factors. Because MyoD1 is synthesized by undifferentiated myoblasts, these data imply that additional regulatory mechanisms must restrict the interaction between this protein and its target site prior to differentiation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mueller, P R -- Wold, B -- GM35526/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):780-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814500" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Cell Line ; Creatine Kinase/*genetics ; DNA/*analysis/metabolism ; DNA-Binding Proteins/genetics/metabolism ; *Enhancer Elements, Genetic ; *Gene Amplification ; Gene Expression ; Genes, Regulator ; Mice ; Molecular Sequence Data ; Muscles/*enzymology ; *Polymerase Chain Reaction ; Protein Binding ; Protein Processing, Post-Translational ; Templates, Genetic ; Transcription Factor AP-2 ; Transcription Factors/genetics/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 93
    Publication Date: 1989-08-25
    Description: Blue cone monochromacy is a rare X-linked disorder of color vision characterized by the absence of both red and green cone sensitivities. In 12 of 12 families carrying this trait, alterations are observed in the red and green visual pigment gene cluster. The alterations fall into two classes. One class arose from the wild type by a two-step pathway consisting of unequal homologous recombination and point mutation. The second class arose by nonhomologous deletion of genomic DNA adjacent to the red and green pigment gene cluster. These deletions define a 579-base pair region that is located 4 kilobases upstream of the red pigment gene and 43 kilobases upstream of the nearest green pigment gene; this 579-base pair region is essential for the activity of both pigment genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nathans, J -- Davenport, C M -- Maumenee, I H -- Lewis, R A -- Hejtmancik, J F -- Litt, M -- Lovrien, E -- Weleber, R -- Bachynski, B -- Zwas, F -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):831-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology and Genetics, Wilmer Ophthalmologic Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2788922" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Adult ; Base Sequence ; Child ; Child, Preschool ; Chromosome Deletion ; Color Vision Defects/*genetics ; DNA/analysis ; Female ; Humans ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Retinal Pigments/genetics ; Thalassemia/genetics ; X Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 94
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: The adult form of Tay-Sachs disease, adult GM2 gangliosidosis, is an autosomal recessive disorder that results from mutations in the alpha chain of beta-hexosaminidase A. This disorder, like infantile Tay-Sachs disease, is more frequent in the Ashkenazi Jewish population. A point mutation in the alpha-chain gene was identified that results in the substitution of Gly with Ser in eight Ashkenazi adult GM2 gangliosidosis patients from five different families. This amino acid substitution was shown to depress drastically the catalytic activity of the alpha chain after expression in COS-1 cells. All of these patients proved to be compound heterozygotes of the allele with the Gly to Ser change and one of the two Ashkenazi infantile Tay-Sachs alleles. These findings will aid in the diagnosis and understanding of beta-hexosaminidase A deficiency disorders.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Navon, R -- Proia, R L -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1471-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genetics and Biochemistry Branch, National Institute of Diabetes, Digestive, and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2522679" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; Humans ; Jews ; Pedigree ; RNA, Messenger/genetics ; Structure-Activity Relationship ; Tay-Sachs Disease/*genetics ; beta-N-Acetylhexosaminidases/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 95
    Publication Date: 1989-04-28
    Description: A strategy was devised for identifying regions of the mouse genome that are transcriptionally active in a temporally and spatially restricted manner during development. The approach is based on the introduction into embryonic stem cells of two types of lacZ reporter constructs that can be activated by flanking mouse genomic sequences. Embryonic stem cells containing the lacZ constructs were used to produce chimaeric mice. Developmental regulation of lacZ expression occurred at a high frequency. Molecular cloning of the flanking endogenous genes and introduction of these potential insertional mutations into the mouse germ line should provide an efficient means of identifying and mutating novel genes important for the control of mammalian development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gossler, A -- Joyner, A L -- Rossant, J -- Skarnes, W C -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):463-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Hospital Research Institute, Division of Molecular and Developmental Biology, Toronto, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497519" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Chimera ; Cloning, Molecular ; Embryo, Mammalian/*metabolism ; Galactosidases/*genetics ; *Gene Expression Regulation ; Genetic Vectors ; Germ Cells ; Heat-Shock Proteins/genetics ; Male ; Mice ; Promoter Regions, Genetic ; Stem Cells/*metabolism ; Transfection ; Transformation, Genetic ; beta-Galactosidase/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 96
    Publication Date: 1989-11-03
    Description: Transcription of the yeast CYC1 promoter fused to a sequence lacking guanosine residues provided a rapid, sensitive assay of initiation by RNA polymerase II in yeast extracts. Initiation was enhanced by yeast and mammalian activator proteins. The adenoviral major late promoter fused to the G-minus sequence was transcribed in yeast extracts with an efficiency comparable to that observed in HeLa extracts, showing that promoters as well as transcription factors are functionally interchangeable across species. Initiation occurred at different sites, approximately 30 and 63 to 69 base pairs downstream of the TATA element of the adenoviral promoter in HeLa and yeast extracts, respectively, distances characteristic of initiation in the two systems in vivo. A component of the transcription system and not the promoter sequence determines the distance to the initiation site.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lue, N F -- Flanagan, P M -- Sugimoto, K -- Kornberg, R D -- GM36659/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):661-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Beckman Laboratories, Fairchild Center, Stanford School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510298" target="_blank"〉PubMed〈/a〉
    Keywords: Adenoviruses, Human/*genetics ; Base Sequence ; GTP-Binding Proteins/genetics ; *Genes, Fungal ; HeLa Cells/metabolism ; Humans ; Molecular Sequence Data ; Oligonucleotide Probes ; *Promoter Regions, Genetic ; RNA Polymerase II/*metabolism ; Saccharomyces cerevisiae/enzymology/*genetics ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 97
    Publication Date: 1989-06-23
    Description: In prokaryotes and eukaryotes mobile genetic elements frequently disrupt the highly conservative structures of chromosomes, which are responsible for storage of genetic information. The factors determining the site for integration of such elements are still unknown. Transfer RNA (tRNA) genes are associated in a highly significant manner with different putative mobile genetic elements in the cellular slime mold Dictyostelium discoideum. These results suggest that tRNA genes in D. discoideum, and probably tRNA genes generally in lower eukaryotes, may function as genomic landmarks for the integration of different transposable elements in a strictly position-specific manner.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marschalek, R -- Brechner, T -- Amon-Bohm, E -- Dingermann, T -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1493-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Biochemie der Medizinischen Fakultat, Universitat Erlangen-Nurnberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2567533" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Chromosome Mapping ; Dictyostelium/*genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oligonucleotide Probes ; Polymorphism, Restriction Fragment Length ; RNA, Transfer/*genetics ; RNA, Transfer, Glu/genetics ; RNA, Transfer, Lys/genetics ; RNA, Transfer, Val/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 98
    Publication Date: 1989-12-22
    Description: Granulocyte and natural killer (NK) cell Fc receptors for immunoglobulin G (CD16) differ in only a few amino acids, yet have phosphatidylinositol glycan (PIG) or polypeptide membrane anchors, respectively. Mutagenesis shows that anchoring is regulated by a serine residue near the PIG anchor attachment site in the extracellular domain. The NK cell isoform was not expressed on the surface of COS cells unless cotransfected with a subunit that was expressed in NK cells and that was identical to the gamma subunit of the high affinity IgE Fc receptor (Fc epsilon RI). However, the CD16 sequence and not expression of the gamma subunit is dominant in regulating PIG reanchoring.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hibbs, M L -- Selvaraj, P -- Carpen, O -- Springer, T A -- Kuster, H -- Jouvin, M H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531918" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/genetics ; Antigens, Differentiation/*genetics ; Cell Line ; Cell Membrane/immunology ; Flow Cytometry ; *Gene Expression Regulation ; Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Immunoglobulin G ; Killer Cells, Natural/immunology ; L Cells (Cell Line)/immunology ; Mice ; Mutation ; RNA, Messenger/genetics/isolation & purification ; Receptors, Fc/*genetics ; Receptors, IgG ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 99
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hiesel, R -- Wissinger, B -- Schuster, W -- Brennicke, A -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1632-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Genbiologische Forschung, Berlin, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480644" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA, Mitochondrial/genetics ; Electron Transport Complex IV/*genetics ; *Genes, Plant ; Humans ; Mitochondria/*enzymology ; Molecular Sequence Data ; Plants/enzymology/*genetics ; RNA/*genetics ; RNA Processing, Post-Transcriptional ; RNA, Messenger/genetics ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 100
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-02
    Description: Cell fusion (syncytium formation) is a major cytopathic effect of infection by human immunodeficiency virus (HIV) and may also represent an important mechanism of CD4+ T-cell depletion in individuals infected with HIV. Syncytium formation requires the interaction of CD4 on the surface of uninfected cells with HIV envelope glycoprotein gp120 expressed on HIV-infected cells. However, several observations suggest that molecules other than CD4 play a role in HIV-induced cell fusion. The leukocyte adhesion receptor LFA-1 is involved in a broad range of leukocyte interactions mediated by diverse receptor-ligand systems including CD4-class II major histocompatibility complex (MHC) molecules. Possible mimicry of class II MHC molecules by gp120 in its interaction with CD4 prompted an examination of the role of LFA-1 in HIV-induced cell fusion. A monoclonal antibody against LFA-1 completely inhibited HIV-induced syncytium formation. The antibody did not block binding of gp120 to CD4. This demonstrates that a molecule other than CD4 is also involved in cell fusion mediated by HIV.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hildreth, J E -- Orentas, R J -- 5T32CA09243/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1075-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543075" target="_blank"〉PubMed〈/a〉
    Keywords: Antibodies, Monoclonal ; Antigens, Differentiation/immunology/*physiology ; Antigens, Differentiation, T-Lymphocyte/immunology ; Cell Fusion ; Cell Line ; Cytopathogenic Effect, Viral ; HIV/immunology/*physiology ; HIV Envelope Protein gp120 ; Histocompatibility Antigens Class II/immunology ; Humans ; Lymphocyte Function-Associated Antigen-1 ; Phytohemagglutinins/pharmacology ; Retroviridae Proteins/immunology ; T-Lymphocytes/immunology/*microbiology ; Viral Envelope Proteins/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...