ALBERT

Description: To explore the distinct genotypic and phenotypic states of melanoma tumors, we applied single-cell RNA sequencing (RNA-seq) to 4645 single cells isolated from 19 patients, profiling malignant, immune, stromal, and endothelial cells. Malignant cells within the same tumor displayed transcriptional heterogeneity associated with the cell cycle, spatial context, and a drug-resistance program. In particular, all tumors harbored malignant cells from two distinct transcriptional cell states, such that tumors characterized by high levels of the MITF transcription factor also contained cells with low MITF and elevated levels of the AXL kinase. Single-cell analyses suggested distinct tumor microenvironmental patterns, including cell-to-cell interactions. Analysis of tumor-infiltrating T cells revealed exhaustion programs, their connection to T cell activation and clonal expansion, and their variability across patients. Overall, we begin to unravel the cellular ecosystem of tumors and how single-cell genomics offers insights with implications for both targeted and immune therapies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tirosh, Itay -- Izar, Benjamin -- Prakadan, Sanjay M -- Wadsworth, Marc H 2nd -- Treacy, Daniel -- Trombetta, John J -- Rotem, Asaf -- Rodman, Christopher -- Lian, Christine -- Murphy, George -- Fallahi-Sichani, Mohammad -- Dutton-Regester, Ken -- Lin, Jia-Ren -- Cohen, Ofir -- Shah, Parin -- Lu, Diana -- Genshaft, Alex S -- Hughes, Travis K -- Ziegler, Carly G K -- Kazer, Samuel W -- Gaillard, Aleth -- Kolb, Kellie E -- Villani, Alexandra-Chloe -- Johannessen, Cory M -- Andreev, Aleksandr Y -- Van Allen, Eliezer M -- Bertagnolli, Monica -- Sorger, Peter K -- Sullivan, Ryan J -- Flaherty, Keith T -- Frederick, Dennie T -- Jane-Valbuena, Judit -- Yoon, Charles H -- Rozenblatt-Rosen, Orit -- Shalek, Alex K -- Regev, Aviv -- Garraway, Levi A -- 1U24CA180922/CA/NCI NIH HHS/ -- DP2 OD020839/OD/NIH HHS/ -- K99 CA194163/CA/NCI NIH HHS/ -- K99CA194163/CA/NCI NIH HHS/ -- P01CA163222/CA/NCI NIH HHS/ -- P30-CA14051/CA/NCI NIH HHS/ -- P50GM107618/GM/NIGMS NIH HHS/ -- R35CA197737/CA/NCI NIH HHS/ -- U54CA112962/CA/NCI NIH HHS/ -- Howard Hughes Medical Institute/ -- New York, N.Y. -- Science. 2016 Apr 8;352(6282):189-96. doi: 10.1126/science.aad0501.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215, USA. Center for Cancer Precision Medicine, Dana-Farber Cancer Institute, Boston, MA 02215, USA. bizar@partners.org aregev@broadinstitute.org levi_garraway@dfci.harvard.edu. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. Institute for Medical Engineering and Science, Massachusetts Institute of Technology (MIT), Cambridge, MA 02139, USA. Department of Chemistry, MIT, Cambridge, MA 02142, USA. Ragon Institute of Massachusetts General Hospital, MIT and Harvard University, Cambridge, MA 02139, USA. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215, USA. Center for Cancer Precision Medicine, Dana-Farber Cancer Institute, Boston, MA 02215, USA. ; Department of Pathology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115, USA. ; Program in Therapeutic Sciences, Department of Systems Biology, Harvard Medical School, Boston, MA 02115, USA. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215, USA. Department of Genetics and Computational Biology, QIMR Berghofer Medical Research Institute, Brisbane, Queensland, Australia. ; HMS LINCS Center and Laboratory of Systems Pharmacology, Harvard Medical School, Boston, MA 02115, USA. ; Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215, USA. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. Institute for Medical Engineering and Science, Massachusetts Institute of Technology (MIT), Cambridge, MA 02139, USA. Ragon Institute of Massachusetts General Hospital, MIT and Harvard University, Cambridge, MA 02139, USA. Division of Health Sciences and Technology, Harvard Medical School, Boston, MA 02115, USA. ; Department of Surgical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215, USA. Department of Surgical Oncology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115, USA. ; Program in Therapeutic Sciences, Department of Systems Biology, Harvard Medical School, Boston, MA 02115, USA. HMS LINCS Center and Laboratory of Systems Pharmacology, Harvard Medical School, Boston, MA 02115, USA. Ludwig Center at Harvard, Boston, MA 02215, USA. ; Division of Medical Oncology, Massachusetts General Hospital Cancer Center, Boston, MA 02114, USA. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. Institute for Medical Engineering and Science, Massachusetts Institute of Technology (MIT), Cambridge, MA 02139, USA. Department of Chemistry, MIT, Cambridge, MA 02142, USA. Ragon Institute of Massachusetts General Hospital, MIT and Harvard University, Cambridge, MA 02139, USA. Division of Health Sciences and Technology, Harvard Medical School, Boston, MA 02115, USA. Department of Immunology, Massachusetts General Hospital, Boston, MA 02114, USA. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. Department of Biology and Koch Institute, MIT, Boston, MA 02142, USA. Howard Hughes Medical Institute, Chevy Chase, MD 20815, USA. bizar@partners.org aregev@broadinstitute.org levi_garraway@dfci.harvard.edu. ; Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. bizar@partners.org aregev@broadinstitute.org levi_garraway@dfci.harvard.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/27124452" target="_blank"〉PubMed〈/a〉

Description: Computation can be performed in living cells by DNA-encoded circuits that process sensory information and control biological functions. Their construction is time-intensive, requiring manual part assembly and balancing of regulator expression. We describe a design environment, Cello, in which a user writes Verilog code that is automatically transformed into a DNA sequence. Algorithms build a circuit diagram, assign and connect gates, and simulate performance. Reliable circuit design requires the insulation of gates from genetic context, so that they function identically when used in different circuits. We used Cello to design 60 circuits forEscherichia coli(880,000 base pairs of DNA), for which each DNA sequence was built as predicted by the software with no additional tuning. Of these, 45 circuits performed correctly in every output state (up to 10 regulators and 55 parts), and across all circuits 92% of the output states functioned as predicted. Design automation simplifies the incorporation of genetic circuits into biotechnology projects that require decision-making, control, sensing, or spatial organization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nielsen, Alec A K -- Der, Bryan S -- Shin, Jonghyeon -- Vaidyanathan, Prashant -- Paralanov, Vanya -- Strychalski, Elizabeth A -- Ross, David -- Densmore, Douglas -- Voigt, Christopher A -- P50 GM098792/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 2016 Apr 1;352(6281):aac7341. doi: 10.1126/science.aac7341.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Synthetic Biology Center, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA. ; Synthetic Biology Center, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA. Biological Design Center, Department of Biomedical Engineering, Department of Electrical and Computer Engineering, Boston University, Boston, MA 02215, USA. ; Biological Design Center, Department of Biomedical Engineering, Department of Electrical and Computer Engineering, Boston University, Boston, MA 02215, USA. ; Biosystems and Biomaterials Division, Material Measurement Laboratory, National Institute of Standards and Technology, Gaithersburg, MD 20817, USA. ; Synthetic Biology Center, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA. cavoigt@gmail.com.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/27034378" target="_blank"〉PubMed〈/a〉

Description: Sequencing of exomes and genomes has revealed abundant genetic variation affecting the coding sequences of human transcription factors (TFs), but the consequences of such variation remain largely unexplored. We developed a computational, structure-based approach to evaluate TF variants for their impact on DNA binding activity and used universal protein-binding microarrays to assay sequence-specific DNA binding activity across 41 reference and 117 variant alleles found in individuals of diverse ancestries and families with Mendelian diseases. We found 77 variants in 28 genes that affect DNA binding affinity or specificity and identified thousands of rare alleles likely to alter the DNA binding activity of human sequence-specific TFs. Our results suggest that most individuals have unique repertoires of TF DNA binding activities, which may contribute to phenotypic variation.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4825693/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4825693/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barrera, Luis A -- Vedenko, Anastasia -- Kurland, Jesse V -- Rogers, Julia M -- Gisselbrecht, Stephen S -- Rossin, Elizabeth J -- Woodard, Jaie -- Mariani, Luca -- Kock, Kian Hong -- Inukai, Sachi -- Siggers, Trevor -- Shokri, Leila -- Gordan, Raluca -- Sahni, Nidhi -- Cotsapas, Chris -- Hao, Tong -- Yi, Song -- Kellis, Manolis -- Daly, Mark J -- Vidal, Marc -- Hill, David E -- Bulyk, Martha L -- P50 HG004233/HG/NHGRI NIH HHS/ -- R01 HG003985/HG/NHGRI NIH HHS/ -- New York, N.Y. -- Science. 2016 Mar 25;351(6280):1450-4. doi: 10.1126/science.aad2257. Epub 2016 Mar 24.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Genetics, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115, USA. Committee on Higher Degrees in Biophysics, Harvard University, Cambridge, MA 02138, USA. Harvard-MIT Division of Health Sciences and Technology, Harvard Medical School, Boston, MA 02115, USA. Computer Science and Artificial Intelligence Laboratory, Massachusetts Institute of Technology, Cambridge, MA 02139, USA. ; Division of Genetics, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115, USA. ; Division of Genetics, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115, USA. Committee on Higher Degrees in Biophysics, Harvard University, Cambridge, MA 02138, USA. ; Harvard-MIT Division of Health Sciences and Technology, Harvard Medical School, Boston, MA 02115, USA. Analytic and Translational Genetics Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA. Broad Institute of Harvard and MIT, Cambridge, MA 02139, USA. ; Division of Genetics, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115, USA. Program in Biological and Biomedical Sciences, Harvard University, Cambridge, MA 02138, USA. ; Center for Cancer Systems Biology (CCSB), Dana-Farber Cancer Institute, Boston, MA 02215, USA. Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02215, USA. Department of Genetics, Harvard Medical School, Boston, MA 02115, USA. ; Analytic and Translational Genetics Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA. Broad Institute of Harvard and MIT, Cambridge, MA 02139, USA. ; Computer Science and Artificial Intelligence Laboratory, Massachusetts Institute of Technology, Cambridge, MA 02139, USA. Broad Institute of Harvard and MIT, Cambridge, MA 02139, USA. ; Analytic and Translational Genetics Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA. Broad Institute of Harvard and MIT, Cambridge, MA 02139, USA. Center for Human Genetics Research and Center for Computational and Integrative Biology, Massachusetts General Hospital, Boston, MA 02114, USA. ; Division of Genetics, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115, USA. Committee on Higher Degrees in Biophysics, Harvard University, Cambridge, MA 02138, USA. Harvard-MIT Division of Health Sciences and Technology, Harvard Medical School, Boston, MA 02115, USA. Broad Institute of Harvard and MIT, Cambridge, MA 02139, USA. Program in Biological and Biomedical Sciences, Harvard University, Cambridge, MA 02138, USA. Center for Cancer Systems Biology (CCSB), Dana-Farber Cancer Institute, Boston, MA 02215, USA. Department of Pathology, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/27013732" target="_blank"〉PubMed〈/a〉

Description: Recent studies have implicated long noncoding RNAs (lncRNAs) as regulators of many important biological processes. Here we report on the identification and characterization of a lncRNA, lnc13, that harbors a celiac disease-associated haplotype block and represses expression of certain inflammatory genes under homeostatic conditions. Lnc13 regulates gene expression by binding to hnRNPD, a member of a family of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). Upon stimulation, lnc13 levels are reduced, thereby allowing increased expression of the repressed genes. Lnc13 levels are significantly decreased in small intestinal biopsy samples from patients with celiac disease, which suggests that down-regulation of lnc13 may contribute to the inflammation seen in this disease. Furthermore, the lnc13 disease-associated variant binds hnRNPD less efficiently than its wild-type counterpart, thus helping to explain how these single-nucleotide polymorphisms contribute to celiac disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Castellanos-Rubio, Ainara -- Fernandez-Jimenez, Nora -- Kratchmarov, Radomir -- Luo, Xiaobing -- Bhagat, Govind -- Green, Peter H R -- Schneider, Robert -- Kiledjian, Megerditch -- Bilbao, Jose Ramon -- Ghosh, Sankar -- R01-AI093985/AI/NIAID NIH HHS/ -- R01-DK102180/DK/NIDDK NIH HHS/ -- R01-GM067005/GM/NIGMS NIH HHS/ -- R37-AI33443/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 2016 Apr 1;352(6281):91-5. doi: 10.1126/science.aad0467.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, Columbia University, College of Physicians and Surgeons, New York, NY 10032, USA. ; Department of Genetics, Physical Anthropology, and Animal Physiology, University of the Basque Country (UPV-EHU), BioCruces Research Institute, Leioa 48940, Basque Country, Spain. ; Department of Pathology and Cell Biology, Columbia University, College of Physicians and Surgeons, New York, NY 10032, USA. ; Center for Celiac Disease, Department of Medicine, Columbia University, College of Physicians and Surgeons, New York, NY 10032, USA. Alexandria Center for Life Sciences, New York University School of Medicine, New York, NY 10016, USA. ; Alexandria Center for Life Sciences, New York University School of Medicine, New York, NY 10016, USA. ; Department of Cell Biology and Neuroscience, Rutgers, The State University of New Jersey, Piscataway, NJ 08854, USA. ; Department of Microbiology and Immunology, Columbia University, College of Physicians and Surgeons, New York, NY 10032, USA. sg2715@columbia.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/27034373" target="_blank"〉PubMed〈/a〉

Description: The occurrence of Ebola virus (EBOV) in West Africa during 2013-2015 is unprecedented. Early reports suggested that in this outbreak EBOV is mutating twice as fast as previously observed, which indicates the potential for changes in transmissibility and virulence and could render current molecular diagnostics and countermeasures ineffective. We have determined additional full-length sequences from two clusters of imported EBOV infections into Mali, and we show that the nucleotide substitution rate (9.6 x 10(-4) substitutions per site per year) is consistent with rates observed in Central African outbreaks. In addition, overall variation among all genotypes observed remains low. Thus, our data indicate that EBOV is not undergoing rapid evolution in humans during the current outbreak. This finding has important implications for outbreak response and public health decisions and should alleviate several previously raised concerns.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoenen, T -- Safronetz, D -- Groseth, A -- Wollenberg, K R -- Koita, O A -- Diarra, B -- Fall, I S -- Haidara, F C -- Diallo, F -- Sanogo, M -- Sarro, Y S -- Kone, A -- Togo, A C G -- Traore, A -- Kodio, M -- Dosseh, A -- Rosenke, K -- de Wit, E -- Feldmann, F -- Ebihara, H -- Munster, V J -- Zoon, K C -- Feldmann, H -- Sow, S -- Intramural NIH HHS/ -- New York, N.Y. -- Science. 2015 Apr 3;348(6230):117-9. doi: 10.1126/science.aaa5646. Epub 2015 Mar 26.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Virology, Division of Intramural Research, National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH), Hamilton, MT 59840, USA. ; Bioinformatics and Computational Biosciences Branch, NIAID, NIH, Bethesda, MD 20892, USA. ; Center of Research and Training for HIV and Tuberculosis, University of Science, Technique and Technologies of Bamako, Mali. ; World Health Organization Office, Bamako, Mali. ; Centre des Operations d'Urgence, Centre pour le Developpement des Vaccins (CVD-Mali), Centre National d'Appui a la lutte contre la Maladie, Ministere de la Sante et de l'Hygiene Publique, Bamako, Mali. ; World Health Organization Inter-Country Support Team, Ouagadougou, Burkina Faso. ; Rocky Mountain Veterinary Branch, Division of Intramural Research, NIAID, NIH, Hamilton, MT 59840, USA. ; Office of the Scientific Director, NIAID, NIH, Bethesda, MD 20895, USA. ; Laboratory of Virology, Division of Intramural Research, National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH), Hamilton, MT 59840, USA. feldmannh@niaid.nih.gov ssow@medicine.umaryland.edu. ; Centre des Operations d'Urgence, Centre pour le Developpement des Vaccins (CVD-Mali), Centre National d'Appui a la lutte contre la Maladie, Ministere de la Sante et de l'Hygiene Publique, Bamako, Mali. feldmannh@niaid.nih.gov ssow@medicine.umaryland.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/25814067" target="_blank"〉PubMed〈/a〉

Description: DNA strand exchange plays a central role in genetic recombination across all kingdoms of life, but the physical basis for these reactions remains poorly defined. Using single-molecule imaging, we found that bacterial RecA and eukaryotic Rad51 and Dmc1 all stabilize strand exchange intermediates in precise three-nucleotide steps. Each step coincides with an energetic signature (0.3 kBT) that is conserved from bacteria to humans. Triplet recognition is strictly dependent on correct Watson-Crick pairing. Rad51, RecA, and Dmc1 can all step over mismatches, but only Dmc1 can stabilize mismatched triplets. This finding provides insight into why eukaryotes have evolved a meiosis-specific recombinase. We propose that canonical Watson-Crick base triplets serve as the fundamental unit of pairing interactions during DNA recombination.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4580133/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4580133/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, Ja Yil -- Terakawa, Tsuyoshi -- Qi, Zhi -- Steinfeld, Justin B -- Redding, Sy -- Kwon, YoungHo -- Gaines, William A -- Zhao, Weixing -- Sung, Patrick -- Greene, Eric C -- CA146940/CA/NCI NIH HHS/ -- GM074739/GM/NIGMS NIH HHS/ -- R01 CA146940/CA/NCI NIH HHS/ -- R01 ES015252/ES/NIEHS NIH HHS/ -- R01 GM074739/GM/NIGMS NIH HHS/ -- R01ES015252/ES/NIEHS NIH HHS/ -- T32 GM007367/GM/NIGMS NIH HHS/ -- Howard Hughes Medical Institute/ -- New York, N.Y. -- Science. 2015 Aug 28;349(6251):977-81. doi: 10.1126/science.aab2666.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, Columbia University, New York, NY, USA. ; Department of Biochemistry and Molecular Biophysics, Columbia University, New York, NY, USA. Department of Biophysics, Kyoto University, Sakyo, Kyoto, Japan. ; Department of Chemistry, Columbia University, New York, NY, USA. ; Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT, USA. ; Department of Biochemistry and Molecular Biophysics, Columbia University, New York, NY, USA. Howard Hughes Medical Institute, Columbia University, New York, NY, USA. ecg2108@cumc.columbia.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26315438" target="_blank"〉PubMed〈/a〉

Description: Variation in vectorial capacity for human malaria among Anopheles mosquito species is determined by many factors, including behavior, immunity, and life history. To investigate the genomic basis of vectorial capacity and explore new avenues for vector control, we sequenced the genomes of 16 anopheline mosquito species from diverse locations spanning ~100 million years of evolution. Comparative analyses show faster rates of gene gain and loss, elevated gene shuffling on the X chromosome, and more intron losses, relative to Drosophila. Some determinants of vectorial capacity, such as chemosensory genes, do not show elevated turnover but instead diversify through protein-sequence changes. This dynamism of anopheline genes and genomes may contribute to their flexible capacity to take advantage of new ecological niches, including adapting to humans as primary hosts.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4380271/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4380271/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Neafsey, Daniel E -- Waterhouse, Robert M -- Abai, Mohammad R -- Aganezov, Sergey S -- Alekseyev, Max A -- Allen, James E -- Amon, James -- Arca, Bruno -- Arensburger, Peter -- Artemov, Gleb -- Assour, Lauren A -- Basseri, Hamidreza -- Berlin, Aaron -- Birren, Bruce W -- Blandin, Stephanie A -- Brockman, Andrew I -- Burkot, Thomas R -- Burt, Austin -- Chan, Clara S -- Chauve, Cedric -- Chiu, Joanna C -- Christensen, Mikkel -- Costantini, Carlo -- Davidson, Victoria L M -- Deligianni, Elena -- Dottorini, Tania -- Dritsou, Vicky -- Gabriel, Stacey B -- Guelbeogo, Wamdaogo M -- Hall, Andrew B -- Han, Mira V -- Hlaing, Thaung -- Hughes, Daniel S T -- Jenkins, Adam M -- Jiang, Xiaofang -- Jungreis, Irwin -- Kakani, Evdoxia G -- Kamali, Maryam -- Kemppainen, Petri -- Kennedy, Ryan C -- Kirmitzoglou, Ioannis K -- Koekemoer, Lizette L -- Laban, Njoroge -- Langridge, Nicholas -- Lawniczak, Mara K N -- Lirakis, Manolis -- Lobo, Neil F -- Lowy, Ernesto -- MacCallum, Robert M -- Mao, Chunhong -- Maslen, Gareth -- Mbogo, Charles -- McCarthy, Jenny -- Michel, Kristin -- Mitchell, Sara N -- Moore, Wendy -- Murphy, Katherine A -- Naumenko, Anastasia N -- Nolan, Tony -- Novoa, Eva M -- O'Loughlin, Samantha -- Oringanje, Chioma -- Oshaghi, Mohammad A -- Pakpour, Nazzy -- Papathanos, Philippos A -- Peery, Ashley N -- Povelones, Michael -- Prakash, Anil -- Price, David P -- Rajaraman, Ashok -- Reimer, Lisa J -- Rinker, David C -- Rokas, Antonis -- Russell, Tanya L -- Sagnon, N'Fale -- Sharakhova, Maria V -- Shea, Terrance -- Simao, Felipe A -- Simard, Frederic -- Slotman, Michel A -- Somboon, Pradya -- Stegniy, Vladimir -- Struchiner, Claudio J -- Thomas, Gregg W C -- Tojo, Marta -- Topalis, Pantelis -- Tubio, Jose M C -- Unger, Maria F -- Vontas, John -- Walton, Catherine -- Wilding, Craig S -- Willis, Judith H -- Wu, Yi-Chieh -- Yan, Guiyun -- Zdobnov, Evgeny M -- Zhou, Xiaofan -- Catteruccia, Flaminia -- Christophides, George K -- Collins, Frank H -- Cornman, Robert S -- Crisanti, Andrea -- Donnelly, Martin J -- Emrich, Scott J -- Fontaine, Michael C -- Gelbart, William -- Hahn, Matthew W -- Hansen, Immo A -- Howell, Paul I -- Kafatos, Fotis C -- Kellis, Manolis -- Lawson, Daniel -- Louis, Christos -- Luckhart, Shirley -- Muskavitch, Marc A T -- Ribeiro, Jose M -- Riehle, Michael A -- Sharakhov, Igor V -- Tu, Zhijian -- Zwiebel, Laurence J -- Besansky, Nora J -- 092654/Wellcome Trust/United Kingdom -- R01 AI050243/AI/NIAID NIH HHS/ -- R01 AI063508/AI/NIAID NIH HHS/ -- R01 AI073745/AI/NIAID NIH HHS/ -- R01 AI076584/AI/NIAID NIH HHS/ -- R01 AI080799/AI/NIAID NIH HHS/ -- R01 AI104956/AI/NIAID NIH HHS/ -- R21 AI101459/AI/NIAID NIH HHS/ -- R56 AI107263/AI/NIAID NIH HHS/ -- SC1 AI109055/AI/NIAID NIH HHS/ -- U19 AI089686/AI/NIAID NIH HHS/ -- U19 AI110818/AI/NIAID NIH HHS/ -- U41 HG007234/HG/NHGRI NIH HHS/ -- U54 HG003067/HG/NHGRI NIH HHS/ -- New York, N.Y. -- Science. 2015 Jan 2;347(6217):1258522. doi: 10.1126/science.1258522. Epub 2014 Nov 27.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genome Sequencing and Analysis Program, Broad Institute, 415 Main Street, Cambridge, MA 02142, USA. neafsey@broadinstitute.org nbesansk@nd.edu. ; Computer Science and Artificial Intelligence Laboratory, Massachusetts Institute of Technology, 32 Vassar Street, Cambridge, MA 02139, USA. The Broad Institute of Massachusetts Institute of Technology and Harvard, 415 Main Street, Cambridge, MA 02142, USA. Department of Genetic Medicine and Development, University of Geneva Medical School, Rue Michel-Servet 1, 1211 Geneva, Switzerland. Swiss Institute of Bioinformatics, Rue Michel-Servet 1, 1211 Geneva, Switzerland. ; Department of Medical Entomology and Vector Control, School of Public Health and Institute of Health Researches, Tehran University of Medical Sciences, Tehran, Iran. ; George Washington University, Department of Mathematics and Computational Biology Institute, 45085 University Drive, Ashburn, VA 20147, USA. ; European Molecular Biology Laboratory, European Bioinformatics Institute, EMBL-EBI, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK. ; National Vector Borne Disease Control Programme, Ministry of Health, Tafea Province, Vanuatu. ; Department of Public Health and Infectious Diseases, Division of Parasitology, Sapienza University of Rome, Piazzale Aldo Moro 5, 00185 Rome, Italy. ; Department of Biological Sciences, California State Polytechnic-Pomona, 3801 West Temple Avenue, Pomona, CA 91768, USA. ; Tomsk State University, 36 Lenina Avenue, Tomsk, Russia. ; Department of Computer Science and Engineering, Eck Institute for Global Health, 211B Cushing Hall, University of Notre Dame, Notre Dame, IN 46556, USA. ; Genome Sequencing and Analysis Program, Broad Institute, 415 Main Street, Cambridge, MA 02142, USA. ; Inserm, U963, F-67084 Strasbourg, France. CNRS, UPR9022, IBMC, F-67084 Strasbourg, France. ; Department of Life Sciences, Imperial College London, South Kensington Campus, London SW7 2AZ, UK. ; Faculty of Medicine, Health and Molecular Science, Australian Institute of Tropical Health Medicine, James Cook University, Cairns 4870, Australia. ; Department of Life Sciences, Imperial College London, Silwood Park Campus, Ascot SL5 7PY, UK. ; Computer Science and Artificial Intelligence Laboratory, Massachusetts Institute of Technology, 32 Vassar Street, Cambridge, MA 02139, USA. The Broad Institute of Massachusetts Institute of Technology and Harvard, 415 Main Street, Cambridge, MA 02142, USA. ; Department of Mathematics, Simon Fraser University, 8888 University Drive, Burnaby, BC V5A 1S6, Canada. ; Department of Entomology and Nematology, One Shields Avenue, University of California-Davis, Davis, CA 95616, USA. ; Institut de Recherche pour le Developpement, Unites Mixtes de Recherche Maladies Infectieuses et Vecteurs Ecologie, Genetique, Evolution et Controle, 911, Avenue Agropolis, BP 64501 Montpellier, France. ; Division of Biology, Kansas State University, 271 Chalmers Hall, Manhattan, KS 66506, USA. ; Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology, Hellas, Nikolaou Plastira 100 GR-70013, Heraklion, Crete, Greece. ; Centre of Functional Genomics, University of Perugia, Perugia, Italy. ; Genomics Platform, Broad Institute, 415 Main Street, Cambridge, MA 02142, USA. ; Centre National de Recherche et de Formation sur le Paludisme, Ouagadougou 01 BP 2208, Burkina Faso. ; Program of Genetics, Bioinformatics, and Computational Biology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. ; School of Life Sciences, University of Nevada, Las Vegas, NV 89154, USA. ; Department of Medical Research, No. 5 Ziwaka Road, Dagon Township, Yangon 11191, Myanmar. ; European Molecular Biology Laboratory, European Bioinformatics Institute, EMBL-EBI, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK. Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030, USA. ; Boston College, 140 Commonwealth Avenue, Chestnut Hill, MA 02467, USA. ; Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. Program of Genetics, Bioinformatics, and Computational Biology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. ; Harvard School of Public Health, Department of Immunology and Infectious Diseases, Boston, MA 02115, USA. Dipartimento di Medicina Sperimentale e Scienze Biochimiche, Universita degli Studi di Perugia, Perugia, Italy. ; Department of Entomology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. ; Computational Evolutionary Biology Group, Faculty of Life Sciences, University of Manchester, Oxford Road, Manchester M13 9PT, UK. ; Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, CA 94143, USA. ; Department of Life Sciences, Imperial College London, South Kensington Campus, London SW7 2AZ, UK. Bioinformatics Research Laboratory, Department of Biological Sciences, New Campus, University of Cyprus, CY 1678 Nicosia, Cyprus. ; Wits Research Institute for Malaria, Faculty of Health Sciences, and Vector Control Reference Unit, National Institute for Communicable Diseases of the National Health Laboratory Service, Sandringham 2131, Johannesburg, South Africa. ; National Museums of Kenya, P.O. Box 40658-00100, Nairobi, Kenya. ; Department of Biology, University of Crete, 700 13 Heraklion, Greece. ; Eck Institute for Global Health and Department of Biological Sciences, University of Notre Dame, 317 Galvin Life Sciences Building, Notre Dame, IN 46556, USA. ; Virginia Bioinformatics Institute, 1015 Life Science Circle, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. ; Kenya Medical Research Institute-Wellcome Trust Research Programme, Centre for Geographic Medicine Research - Coast, P.O. Box 230-80108, Kilifi, Kenya. ; Harvard School of Public Health, Department of Immunology and Infectious Diseases, Boston, MA 02115, USA. ; Department of Entomology, 1140 East South Campus Drive, Forbes 410, University of Arizona, Tucson, AZ 85721, USA. ; Department of Medical Microbiology and Immunology, School of Medicine, University of California Davis, One Shields Avenue, Davis, CA 95616, USA. ; Department of Life Sciences, Imperial College London, South Kensington Campus, London SW7 2AZ, UK. Centre of Functional Genomics, University of Perugia, Perugia, Italy. ; Department of Pathobiology, University of Pennsylvania School of Veterinary Medicine, 3800 Spruce Street, Philadelphia, PA 19104, USA. ; Regional Medical Research Centre NE, Indian Council of Medical Research, P.O. Box 105, Dibrugarh-786 001, Assam, India. ; Department of Biology, New Mexico State University, Las Cruces, NM 88003, USA. Molecular Biology Program, New Mexico State University, Las Cruces, NM 88003, USA. ; Department of Vector Biology, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool, L3 5QA, UK. ; Center for Human Genetics Research, Vanderbilt University Medical Center, Nashville, TN 37235, USA. ; Center for Human Genetics Research, Vanderbilt University Medical Center, Nashville, TN 37235, USA. Department of Biological Sciences, Vanderbilt University, Nashville, TN 37235, USA. ; Department of Genetic Medicine and Development, University of Geneva Medical School, Rue Michel-Servet 1, 1211 Geneva, Switzerland. Swiss Institute of Bioinformatics, Rue Michel-Servet 1, 1211 Geneva, Switzerland. ; Department of Entomology, Texas A&M University, College Station, TX 77807, USA. ; Department of Parasitology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand. ; Fundacao Oswaldo Cruz, Avenida Brasil 4365, RJ Brazil. Instituto de Medicina Social, Universidade do Estado do Rio de Janeiro, Rio de Janeiro, Brazil. ; School of Informatics and Computing, Indiana University, Bloomington, IN 47405, USA. ; Department of Physiology, School of Medicine, Center for Research in Molecular Medicine and Chronic Diseases, Instituto de Investigaciones Sanitarias, University of Santiago de Compostela, Santiago de Compostela, A Coruna, Spain. ; Wellcome Trust Sanger Institute, Hinxton, Cambridgeshire, CB10 1SA, UK. ; School of Natural Sciences and Psychology, Liverpool John Moores University, Liverpool L3 3AF, UK. ; Department of Cellular Biology, University of Georgia, Athens, GA 30602, USA. ; Computer Science and Artificial Intelligence Laboratory, Massachusetts Institute of Technology, 32 Vassar Street, Cambridge, MA 02139, USA. The Broad Institute of Massachusetts Institute of Technology and Harvard, 415 Main Street, Cambridge, MA 02142, USA. Department of Computer Science, Harvey Mudd College, Claremont, CA 91711, USA. ; Program in Public Health, College of Health Sciences, University of California, Irvine, Hewitt Hall, Irvine, CA 92697, USA. ; Department of Biological Sciences, Vanderbilt University, Nashville, TN 37235, USA. ; Department of Vector Biology, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool, L3 5QA, UK. Malaria Programme, Wellcome Trust Sanger Institute, Cambridge CB10 1SJ, UK. ; Eck Institute for Global Health and Department of Biological Sciences, University of Notre Dame, 317 Galvin Life Sciences Building, Notre Dame, IN 46556, USA. Centre of Evolutionary and Ecological Studies (Marine Evolution and Conservation group), University of Groningen, Nijenborgh 7, NL-9747 AG Groningen, Netherlands. ; Department of Molecular and Cellular Biology, Harvard University, 16 Divinity Avenue, Cambridge, MA 02138, USA. ; Department of Biology, Indiana University, Bloomington, IN 47405, USA. School of Informatics and Computing, Indiana University, Bloomington, IN 47405, USA. ; Centers for Disease Control and Prevention, 1600 Clifton Road NE MSG49, Atlanta, GA 30329, USA. ; Department of Biology, University of Crete, 700 13 Heraklion, Greece. Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology, Hellas, Nikolaou Plastira 100 GR-70013, Heraklion, Crete, Greece. Centre of Functional Genomics, University of Perugia, Perugia, Italy. ; Boston College, 140 Commonwealth Avenue, Chestnut Hill, MA 02467, USA. Biogen Idec, 14 Cambridge Center, Cambridge, MA 02142, USA. ; Laboratory of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases, 12735 Twinbrook Parkway, Rockville, MD 20852, USA. ; Department of Entomology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. Program of Genetics, Bioinformatics, and Computational Biology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. ; Program of Genetics, Bioinformatics, and Computational Biology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA. ; Departments of Biological Sciences and Pharmacology, Institutes for Chemical Biology, Genetics and Global Health, Vanderbilt University and Medical Center, Nashville, TN 37235, USA. ; Eck Institute for Global Health and Department of Biological Sciences, University of Notre Dame, 317 Galvin Life Sciences Building, Notre Dame, IN 46556, USA. neafsey@broadinstitute.org nbesansk@nd.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/25554792" target="_blank"〉PubMed〈/a〉

Description: Transcriptional enhancers direct precise on-off patterns of gene expression during development. To explore the basis for this precision, we conducted a high-throughput analysis of the Otx-a enhancer, which mediates expression in the neural plate of Ciona embryos in response to fibroblast growth factor (FGF) signaling and a localized GATA determinant. We provide evidence that enhancer specificity depends on submaximal recognition motifs having reduced binding affinities ("suboptimization"). Native GATA and ETS (FGF) binding sites contain imperfect matches to consensus motifs. Perfect matches mediate robust but ectopic patterns of gene expression. The native sites are not arranged at optimal intervals, and subtle changes in their spacing alter enhancer activity. Multiple tiers of enhancer suboptimization produce specific, but weak, patterns of expression, and we suggest that clusters of weak enhancers, including certain "superenhancers," circumvent this trade-off in specificity and activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Farley, Emma K -- Olson, Katrina M -- Zhang, Wei -- Brandt, Alexander J -- Rokhsar, Daniel S -- Levine, Michael S -- GM46638/GM/NIGMS NIH HHS/ -- NS076542/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 2015 Oct 16;350(6258):325-8. doi: 10.1126/science.aac6948.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cell Biology, Division of Genetics, Genomics and Development, Center for Integrative Genomics, University of California, Berkeley, CA 94720-3200, USA. Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544, USA. msl2@princeton.edu ekfarley@princeton.edu. ; Department of Molecular and Cell Biology, Division of Genetics, Genomics and Development, Center for Integrative Genomics, University of California, Berkeley, CA 94720-3200, USA. Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544, USA. ; Department of Medicine, University of California, San Diego, CA 92093-0688, USA. ; Department of Chemistry, University of California, Berkeley, CA 94720-3200, USA. ; Department of Molecular and Cell Biology, Division of Genetics, Genomics and Development, Center for Integrative Genomics, University of California, Berkeley, CA 94720-3200, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26472909" target="_blank"〉PubMed〈/a〉

Description: The carnivoran giant panda has a specialized bamboo diet, to which its alimentary tract is poorly adapted. Measurements of daily energy expenditure across five captive and three wild pandas averaged 5.2 megajoules (MJ)/day, only 37.7% of the predicted value (13.8 MJ/day). For the wild pandas, the mean was 6.2 MJ/day, or 45% of the mammalian expectation. Pandas achieve this exceptionally low expenditure in part by reduced sizes of several vital organs and low physical activity. In addition, circulating levels of thyroid hormones thyroxine (T4) and triiodothyronine (T3) averaged 46.9 and 64%, respectively, of the levels expected for a eutherian mammal of comparable size. A giant panda-unique mutation in the DUOX2 gene, critical for thyroid hormone synthesis, might explain these low thyroid hormone levels. A combination of morphological, behavioral, physiological, and genetic adaptations, leading to low energy expenditure, likely enables giant pandas to survive on a bamboo diet.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nie, Yonggang -- Speakman, John R -- Wu, Qi -- Zhang, Chenglin -- Hu, Yibo -- Xia, Maohua -- Yan, Li -- Hambly, Catherine -- Wang, Lu -- Wei, Wei -- Zhang, Jinguo -- Wei, Fuwen -- New York, N.Y. -- Science. 2015 Jul 10;349(6244):171-4. doi: 10.1126/science.aab2413.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. ; State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China. Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen, Scotland, UK. ; Beijing Key Laboratory of Captive Wildlife Technologies, Beijing Zoo, Beijing, China. ; Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen, Scotland, UK. ; State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China. ; Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. weifw@ioz.ac.cn.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26160943" target="_blank"〉PubMed〈/a〉

Description: Cytoplasmic aggregation of TDP-43, accompanied by its nuclear clearance, is a key common pathological hallmark of amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). However, a limited understanding of this RNA-binding protein (RBP) impedes the clarification of pathogenic mechanisms underlying TDP-43 proteinopathy. In contrast to RBPs that regulate splicing of conserved exons, we found that TDP-43 repressed the splicing of nonconserved cryptic exons, maintaining intron integrity. When TDP-43 was depleted from mouse embryonic stem cells, these cryptic exons were spliced into messenger RNAs, often disrupting their translation and promoting nonsense-mediated decay. Moreover, enforced repression of cryptic exons prevented cell death in TDP-43-deficient cells. Furthermore, repression of cryptic exons was impaired in ALS-FTD cases, suggesting that this splicing defect could potentially underlie TDP-43 proteinopathy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ling, Jonathan P -- Pletnikova, Olga -- Troncoso, Juan C -- Wong, Philip C -- P50AG05146/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 2015 Aug 7;349(6248):650-5. doi: 10.1126/science.aab0983.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Johns Hopkins University School of Medicine, Baltimore, MD 21205-2196, USA. ; Department of Pathology, Johns Hopkins University School of Medicine, Baltimore, MD 21205-2196, USA. Department of Neurology, Johns Hopkins University School of Medicine, Baltimore, MD 21205-2196, USA. ; Department of Pathology, Johns Hopkins University School of Medicine, Baltimore, MD 21205-2196, USA. Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD 21205-2196, USA. wong@jhmi.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26250685" target="_blank"〉PubMed〈/a〉

Description: Bacterial adaptive immunity uses CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) proteins together with CRISPR transcripts for foreign DNA degradation. In type II CRISPR-Cas systems, activation of Cas9 endonuclease for DNA recognition upon guide RNA binding occurs by an unknown mechanism. Crystal structures of Cas9 bound to single-guide RNA reveal a conformation distinct from both the apo and DNA-bound states, in which the 10-nucleotide RNA "seed" sequence required for initial DNA interrogation is preordered in an A-form conformation. This segment of the guide RNA is essential for Cas9 to form a DNA recognition-competent structure that is poised to engage double-stranded DNA target sequences. We construe this as convergent evolution of a "seed" mechanism reminiscent of that used by Argonaute proteins during RNA interference in eukaryotes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jiang, Fuguo -- Zhou, Kaihong -- Ma, Linlin -- Gressel, Saskia -- Doudna, Jennifer A -- Howard Hughes Medical Institute/ -- New York, N.Y. -- Science. 2015 Jun 26;348(6242):1477-81. doi: 10.1126/science.aab1452.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720, USA. ; Howard Hughes Medical Institute, University of California, Berkeley, CA 94720, USA. ; Max Planck Institute for Biophysical Chemistry, 37077 Gottingen, Germany. ; Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720, USA. Howard Hughes Medical Institute, University of California, Berkeley, CA 94720, USA. California Institute for Quantitative Biosciences, University of California, Berkeley, CA 94720, USA. Department of Chemistry, University of California, Berkeley, CA 94720, USA. Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA. Innovative Genomics Initiative, University of California, Berkeley, CA 94720, USA. doudna@berkeley.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26113724" target="_blank"〉PubMed〈/a〉

Description: Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4720525/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4720525/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sigova, Alla A -- Abraham, Brian J -- Ji, Xiong -- Molinie, Benoit -- Hannett, Nancy M -- Guo, Yang Eric -- Jangi, Mohini -- Giallourakis, Cosmas C -- Sharp, Phillip A -- Young, Richard A -- HG002668/HG/NHGRI NIH HHS/ -- R01 HG002668/HG/NHGRI NIH HHS/ -- New York, N.Y. -- Science. 2015 Nov 20;350(6263):978-81. doi: 10.1126/science.aad3346. Epub 2015 Oct 29.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA. ; Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114, USA. ; Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA. David H. Koch Institute for Integrative Cancer Research, Cambridge, MA 02140, USA. ; Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA. Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA. young@wi.mit.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26516199" target="_blank"〉PubMed〈/a〉

Description: Morphinan alkaloids from the opium poppy are used for pain relief. The direction of metabolites to morphinan biosynthesis requires isomerization of (S)- to (R)-reticuline. Characterization of high-reticuline poppy mutants revealed a genetic locus, designated STORR [(S)- to (R)-reticuline] that encodes both cytochrome P450 and oxidoreductase modules, the latter belonging to the aldo-keto reductase family. Metabolite analysis of mutant alleles and heterologous expression demonstrate that the P450 module is responsible for the conversion of (S)-reticuline to 1,2-dehydroreticuline, whereas the oxidoreductase module converts 1,2-dehydroreticuline to (R)-reticuline rather than functioning as a P450 redox partner. Proteomic analysis confirmed that these two modules are contained on a single polypeptide in vivo. This modular assembly implies a selection pressure favoring substrate channeling. The fusion protein STORR may enable microbial-based morphinan production.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Winzer, Thilo -- Kern, Marcelo -- King, Andrew J -- Larson, Tony R -- Teodor, Roxana I -- Donninger, Samantha L -- Li, Yi -- Dowle, Adam A -- Cartwright, Jared -- Bates, Rachel -- Ashford, David -- Thomas, Jerry -- Walker, Carol -- Bowser, Tim A -- Graham, Ian A -- BB/K018809/1/Biotechnology and Biological Sciences Research Council/United Kingdom -- New York, N.Y. -- Science. 2015 Jul 17;349(6245):309-12. doi: 10.1126/science.aab1852. Epub 2015 Jun 25.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Centre for Novel Agricultural Products, Department of Biology, University of York, York YO10 5DD, UK. ; Bioscience Technology Facility, Department of Biology, University of York, York YO10 5DD, UK. ; GlaxoSmithKline, 1061 Mountain Highway, Post Office Box 168, Boronia, Victoria 3155, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26113639" target="_blank"〉PubMed〈/a〉

Description: The 5' leader of the HIV-1 genome contains conserved elements that direct selective packaging of the unspliced, dimeric viral RNA into assembling particles. By using a (2)H-edited nuclear magnetic resonance (NMR) approach, we determined the structure of a 155-nucleotide region of the leader that is independently capable of directing packaging (core encapsidation signal; Psi(CES)). The RNA adopts an unexpected tandem three-way junction structure, in which residues of the major splice donor and translation initiation sites are sequestered by long-range base pairing and guanosines essential for both packaging and high-affinity binding to the cognate Gag protein are exposed in helical junctions. The structure reveals how translation is attenuated, Gag binding promoted, and unspliced dimeric genomes selected, by the RNA conformer that directs packaging.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4492308/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4492308/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Keane, Sarah C -- Heng, Xiao -- Lu, Kun -- Kharytonchyk, Siarhei -- Ramakrishnan, Venkateswaran -- Carter, Gregory -- Barton, Shawn -- Hosic, Azra -- Florwick, Alyssa -- Santos, Justin -- Bolden, Nicholas C -- McCowin, Sayo -- Case, David A -- Johnson, Bruce A -- Salemi, Marco -- Telesnitsky, Alice -- Summers, Michael F -- 2T34 GM008663/GM/NIGMS NIH HHS/ -- P50 GM 103297/GM/NIGMS NIH HHS/ -- P50 GM103297/GM/NIGMS NIH HHS/ -- R01 GM042561/GM/NIGMS NIH HHS/ -- R01 GM42561/GM/NIGMS NIH HHS/ -- Howard Hughes Medical Institute/ -- New York, N.Y. -- Science. 2015 May 22;348(6237):917-21. doi: 10.1126/science.aaa9266.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute (HHMI) and Department of Chemistry and Biochemistry, University of Maryland Baltimore County (UMBC), 1000 Hilltop Circle, Baltimore, MD 21250, USA. ; Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109-5620, USA. ; Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ 08854, USA. ; One Moon Scientific, Incorporated, 839 Grant Avenue, Westfield, NJ 07090, USA, and City University of New York (CUNY) Advanced Science Research Center, 85 St. Nicholas Terrace, New York, NY 10031, USA. ; Department of Pathology, Immunology, and Laboratory Medicine, College of Medicine, and Emerging Pathogens Institute, University of Florida, Gainesville, FL 32610, USA. ; Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109-5620, USA. summers@hhmi.umbc.edu ateles@umich.edu. ; Howard Hughes Medical Institute (HHMI) and Department of Chemistry and Biochemistry, University of Maryland Baltimore County (UMBC), 1000 Hilltop Circle, Baltimore, MD 21250, USA. summers@hhmi.umbc.edu ateles@umich.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/25999508" target="_blank"〉PubMed〈/a〉

Description: The shortage of organs for transplantation is a major barrier to the treatment of organ failure. Although porcine organs are considered promising, their use has been checked by concerns about the transmission of porcine endogenous retroviruses (PERVs) to humans. Here we describe the eradication of all PERVs in a porcine kidney epithelial cell line (PK15). We first determined the PK15 PERV copy number to be 62. Using CRISPR-Cas9, we disrupted all copies of the PERV pol gene and demonstrated a 〉1000-fold reduction in PERV transmission to human cells, using our engineered cells. Our study shows that CRISPR-Cas9 multiplexability can be as high as 62 and demonstrates the possibility that PERVs can be inactivated for clinical application of porcine-to-human xenotransplantation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yang, Luhan -- Guell, Marc -- Niu, Dong -- George, Haydy -- Lesha, Emal -- Grishin, Dennis -- Aach, John -- Shrock, Ellen -- Xu, Weihong -- Poci, Jurgen -- Cortazio, Rebeca -- Wilkinson, Robert A -- Fishman, Jay A -- Church, George -- P50 HG005550/HG/NHGRI NIH HHS/ -- New York, N.Y. -- Science. 2015 Nov 27;350(6264):1101-4. doi: 10.1126/science.aad1191. Epub 2015 Oct 11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Harvard Medical School, Boston, MA, USA. Wyss Institute for Biologically Inspired Engineering, Harvard University, Cambridge, MA, USA. eGenesis Biosciences, Boston, MA 02115, USA. gchurch@genetics.med.harvard.edu luhan.yang@egenesisbio.com. ; Department of Genetics, Harvard Medical School, Boston, MA, USA. Wyss Institute for Biologically Inspired Engineering, Harvard University, Cambridge, MA, USA. eGenesis Biosciences, Boston, MA 02115, USA. ; Department of Genetics, Harvard Medical School, Boston, MA, USA. College of Animal Sciences, Zhejiang University, Hangzhou 310058, China. ; Department of Genetics, Harvard Medical School, Boston, MA, USA. ; Department of Surgery, Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA. ; Transplant Infectious Disease and Compromised Host Program, Massachusetts General Hospital, Boston, MA 02115, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26456528" target="_blank"〉PubMed〈/a〉

Description: Most spontaneous DNA double-strand breaks (DSBs) result from replication-fork breakage. Break-induced replication (BIR), a genome rearrangement-prone repair mechanism that requires the Pol32/POLD3 subunit of eukaryotic DNA Poldelta, was proposed to repair broken forks, but how genome destabilization is avoided was unknown. We show that broken fork repair initially uses error-prone Pol32-dependent synthesis, but that mutagenic synthesis is limited to within a few kilobases from the break by Mus81 endonuclease and a converging fork. Mus81 suppresses template switches between both homologous sequences and diverged human Alu repetitive elements, highlighting its importance for stability of highly repetitive genomes. We propose that lack of a timely converging fork or Mus81 may propel genome instability observed in cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mayle, Ryan -- Campbell, Ian M -- Beck, Christine R -- Yu, Yang -- Wilson, Marenda -- Shaw, Chad A -- Bjergbaek, Lotte -- Lupski, James R -- Ira, Grzegorz -- F31 NS083159/NS/NINDS NIH HHS/ -- GM080600/GM/NIGMS NIH HHS/ -- HG006542/HG/NHGRI NIH HHS/ -- NS058529/NS/NINDS NIH HHS/ -- NS083159/NS/NINDS NIH HHS/ -- R01 GM080600/GM/NIGMS NIH HHS/ -- R01 NS058529/NS/NINDS NIH HHS/ -- U54 HG006542/HG/NHGRI NIH HHS/ -- New York, N.Y. -- Science. 2015 Aug 14;349(6249):742-7. doi: 10.1126/science.aaa8391.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA. ; Department of Molecular Biology and Genetics, University of Aarhus, Aarhus 8000, Denmark. ; Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA. Department of Pediatrics, and Human Genome Sequencing Center, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA. Texas Children's Hospital, Houston, TX 77030, USA. ; Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA. gira@bcm.edu.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/26273056" target="_blank"〉PubMed〈/a〉

Description: The Protoaurignacian culture is pivotal to the debate about the timing of the arrival of modern humans in western Europe and the demise of Neandertals. However, which group is responsible for this culture remains uncertain. We investigated dental remains associated with the Protoaurignacian. The lower deciduous incisor from Riparo Bombrini is modern human, based on its morphology. The upper deciduous incisor from Grotta di Fumane contains ancient mitochondrial DNA of a modern human type. These teeth are the oldest human remains in an Aurignacian-related archaeological context, confirming that by 41,000 calendar years before the present, modern humans bearing Protoaurignacian culture spread into southern Europe. Because the last Neandertals date to 41,030 to 39,260 calendar years before the present, we suggest that the Protoaurignacian triggered the demise of Neandertals in this area.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Benazzi, S -- Slon, V -- Talamo, S -- Negrino, F -- Peresani, M -- Bailey, S E -- Sawyer, S -- Panetta, D -- Vicino, G -- Starnini, E -- Mannino, M A -- Salvadori, P A -- Meyer, M -- Paabo, S -- Hublin, J-J -- New York, N.Y. -- Science. 2015 May 15;348(6236):793-6. doi: 10.1126/science.aaa2773. Epub 2015 Apr 23.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cultural Heritage, University of Bologna, Via degli Ariani 1, 48121 Ravenna, Italy. Department of Human Evolution, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig, Germany. stefano.benazzi@unibo.it. ; Department of Evolutionary Genetics, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig, Germany. ; Department of Human Evolution, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig, Germany. ; Dipartimento di Antichita, Filosofia, Storia e Geografia, Universita di Genova, Via Balbi 2, 16126 Genova, Italy. ; Sezione di Scienze Preistoriche e Antropologiche, Dipartimento di Studi Umanistici, Corso Ercole I d'Este 32, Universita di Ferrara, 44100 Ferrara, Italy. ; Department of Human Evolution, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig, Germany. Center for the Study of Human Origins, Department of Anthropology, New York University, 25 Waverly Place, New York, NY 10003, USA. ; CNR Institute of Clinical Physiology, National Research Council, Via G. Moruzzi 1, 56124 Pisa, Italy. ; Museo Archeologico del Finale, Chiostri di Santa Caterina, 17024 Finale Ligure Borgo, Italy. ; Scuola di Scienze Umanistiche, Dipartimento di Studi Storici, Universita di Torino, via S. Ottavio 20, 10124 Torino, Italy. Museo Preistorico Nazionale dei Balzi Rossi, Via Balzi Rossi 9, 18039 Ventimiglia, Italy.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/25908660" target="_blank"〉PubMed〈/a〉

Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉

Description: Oligonucleotide recognition offers a powerful chemical approach for the sequence-specific binding of double-helical DNA. In the pyrimidine-Hoogsteen model, a binding size of greater than 15 homopurine base pairs affords greater than 30 discrete sequence-specific hydrogen bonds to duplex DNA. Because pyrimidine oligonucleotides limit triple helix formation to homopurine tracts, it is desirable to determine whether oligonucleotides can be used to bind all four base pairs of DNA. A general solution would allow targeting of oligonucleotides (or their analogs) to any given sequence in the human genome. A study of 20 base triplets reveals that the triple helix can be extended from homopurine to mixed sequences. Guanine contained within a pyrimidine oligonucleotide specifically recognizes thymine.adenine base pairs in duplex DNA. Such specificity allows binding at mixed sites in DNA from simian virus 40 and human immunodeficiency virus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Griffin, L C -- Dervan, P B -- GM-35724/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):967-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549639" target="_blank"〉PubMed〈/a〉

Description: Transcriptional activation of the human interleukin-2 (IL-2) gene, like induction of the IL-2 receptor alpha (IL-2R alpha) gene and the type 1 human immunodeficiency virus (HIV-1), is shown to be modulated by a kappa B-like enhancer element. Mutation of a kappa B core sequence identified in the IL-2 promoter (-206 to -195) partially inhibits both mitogen- and HTLV-I Tax-mediated activation of this transcription unit and blocks the specific binding of two inducible cellular factors. These kappa B-specific proteins (80 to 90 and 50 to 55 kilodaltons) similarly interact with the functional kappa B enhancer present in the IL-2R alpha promoter. These data suggest that these kappa B-specific proteins have a role in the coordinate regulation of this growth factor-growth factor receptor gene system that controls T cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoyos, B -- Ballard, D W -- Bohnlein, E -- Siekevitz, M -- Greene, W C -- A127053-01/PHS HHS/ -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):457-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Medical Center, Department of Microbiology, New York, NY 10029.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497518" target="_blank"〉PubMed〈/a〉

Description: A novel bacteriophage lambda vector system was used to express in Escherichia coli a combinatorial library of Fab fragments of the mouse antibody repertoire. The system allows rapid and easy identification of monoclonal Fab fragments in a form suitable for genetic manipulation. It was possible to generate, in 2 weeks, large numbers of monoclonal Fab fragments against a transition state analog hapten. The methods described may supersede present-day hybridoma technology and facilitate the production of catalytic and other antibodies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huse, W D -- Sastry, L -- Iverson, S A -- Kang, A S -- Alting-Mees, M -- Burton, D R -- Benkovic, S J -- Lerner, R A -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531466" target="_blank"〉PubMed〈/a〉

Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉

Description: Vascular permeability factor (VPF) is a 40-kilodalton disulfide-linked dimeric glycoprotein that is active in increasing blood vessel permeability, endothelial cell growth, and angiogenesis. These properties suggest that the expression of VPF by tumor cells could contribute to the increased neovascularization and vessel permeability that are associated with tumor vasculature. The cDNA sequence of VPF from human U937 cells was shown to code for a 189-amino acid polypeptide that is similar in structure to the B chain of platelet-derived growth factor (PDGF-B) and other PDGF-B-related proteins. The overall identity with PDGF-B is 18%. However, all eight of the cysteines in PDGF-B were found to be conserved in human VPF, an indication that the folding of the two proteins is probably similar. Clusters of basic amino acids in the COOH-terminal halves of human VPF and PDGF-B are also prevalent. Thus, VPF appears to be related to the PDGF/v-sis family of proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Keck, P J -- Hauser, S D -- Krivi, G -- Sanzo, K -- Warren, T -- Feder, J -- Connolly, D T -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1309-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture and Biochemistry, Monsanto Company, St. Louis, MO 63167.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479987" target="_blank"〉PubMed〈/a〉

Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Klausner, R D -- Harford, J B -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):870-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683086" target="_blank"〉PubMed〈/a〉

Description: The messenger RNAs specifying certain proteins involved in the inflammatory response and certain oncoproteins contain a conserved UA-rich sequence in the 3' untranslated region. This sequence, which is composed of several interspersed repeats of the octanucleotide UUAUUUAU, has been shown to destabilize mRNA in some eukaryotes. However, this effect is not seen when mRNAs are transferred to Xenopus oocytes, which made it possible to separate stability from translational regulation. For interferon, granulocyte-macrophage colony-stimulating factor, and c-fos RNAs, the UA-rich sequence was observed to preclude mRNA translation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kruys, V -- Marinx, O -- Shaw, G -- Deschamps, J -- Huez, G -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):852-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departement de Biologie Moleculaire, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672333" target="_blank"〉PubMed〈/a〉

Description: Bleomycin is a metal- and oxygen-dependent DNA cleaver. The chemistry of DNA damage has been proposed to involve rate-limiting abstraction of the 4'-hydrogen. A DNA fragment has been prepared that contains [4'-2H]thymidine residues of high isotopic content. Primary kinetic isotope effects have been directly observed at individual thymidine residues with DNA sequencing technology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kozarich, J W -- Worth, L Jr -- Frank, B L -- Christner, D F -- Vanderwall, D E -- Stubbe, J -- GM 34454/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1396-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, University of Maryland, College Park, MD 20742.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476851" target="_blank"〉PubMed〈/a〉

Description: Complementary DNA's that encode an adenylyl cyclase were isolated from a bovine brain library. Most of the deduced amino acid sequence of 1134 residues is divisible into two alternating sets of hydrophobic and hydrophilic domains. Each of the two large hydrophobic domains appears to contain six transmembrane spans. Each of the two large hydrophilic domains contains a sequence that is homologous to a single cytoplasmic domain of several guanylyl cyclases; these sequences may represent nucleotide binding sites. An unexpected topographical resemblance between adenylyl cyclase and various plasma membrane channels and transporters was observed. This structural complexity suggests possible, unappreciated functions for this important enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Krupinski, J -- Coussen, F -- Bakalyar, H A -- Tang, W J -- Feinstein, P G -- Orth, K -- Slaughter, C -- Reed, R R -- Gilman, A G -- CA16519/CA/NCI NIH HHS/ -- GM12230/GM/NIGMS NIH HHS/ -- GM34497/GM/NIGMS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1558-64.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas 75235.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472670" target="_blank"〉PubMed〈/a〉

Description: DNA mismatch correction is a strand-specific process involving recognition of noncomplementary Watson-Crick nucleotide pairs and participation of widely separated DNA sites. The Escherichia coli methyl-directed reaction has been reconstituted in a purified system consisting of MutH, MutL, and MutS proteins, DNA helicase II, single-strand DNA binding protein, DNA polymerase III holoenzyme, exonuclease I, DNA ligase, along with ATP (adenosine triphosphate), and the four deoxynucleoside triphosphates. This set of proteins can process seven of the eight base-base mismatches in a strand-specific reaction that is directed by the state of methylation of a single d(GATC) sequence located 1 kilobase from the mispair.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lahue, R S -- Au, K G -- Modrich, P -- F32 GM12684/GM/NIGMS NIH HHS/ -- GM23719/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):160-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2665076" target="_blank"〉PubMed〈/a〉

Description: Branched RNA-linked multicopy single-stranded DNA (msDNA) originally detected in myxobacteria has now been found in a clinical isolate of Escherichia coli. Although lacking homology in the primary structure, the E. coli msDNA is similar in secondary structure to the myxobacterial msDNA's, including the 2',5'-phosphodiester linkage between RNA and DNA. A chromosomal DNA fragment responsible for the production of msDNA was cloned in an E. coli K12 strain; its DNA sequence revealed an open reading frame (ORF) of 586 amino acid residues. The ORF shows sequence similarity with retroviral reverse transcriptases and ribonuclease H. Disruption of the ORF blocked msDNA production, indicating that this gene is essential for msDNA synthesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lampson, B C -- Sun, J -- Hsu, M Y -- Vallejo-Ramirez, J -- Inouye, S -- Inouye, M -- F32 GM11970-01A1/GM/NIGMS NIH HHS/ -- GM26843/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1033-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway 08854.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466332" target="_blank"〉PubMed〈/a〉

Description: CD16 is a low-affinity immunoglobulin G (IgG) Fc receptor that is expressed on natural killer (NK) cells, granulocytes, activated macrophages, and some T lymphocytes. Two similar genes, CD16-I and CD16-II, encode membrane glycoproteins that are anchored by phosphatidylinositol (PI)-glycan and transmembrane polypeptides, respectively. The primary structural requirements for PI-linkage were examined by constructing a series of hybrid cDNA molecules. Although both cDNA's have an identical COOH-terminal hydrophobic segment, CD16-I has Ser203 whereas CD16-II has Phe203. Conversion of Phe to Ser in CD16-II permits expression of a PI-glycan-anchored glycoprotein, whereas conversion of Ser to Phe in CD16-I prevents PI-glycan linkage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lanier, L L -- Cwirla, S -- Yu, G -- Testi, R -- Phillips, J H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Becton Dickinson Monoclonal Center, Inc., Mountain View, CA 94043.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531919" target="_blank"〉PubMed〈/a〉

Description: Ribozymes are RNA molecules that catalyze biochemical reactions. Fe(II)-EDTA, a solvent-based reagent which cleaves both double- and single-stranded RNA, was used to investigate the structure of the Tetrahymena ribozyme. Regions of cleavage alternate with regions of substantial protection along the entire RNA molecule. In particular, most of the catalytic core shows greatly reduced cleavage. These data constitute experimental evidence that an RNA enzyme, like a protein enzyme, has an interior and an exterior. Determination of positions where the phosphodiester backbone of the RNA is on the inside or on the outside of the molecule provides major constraints for modeling the three-dimensional structure of the Tetrahymena ribozyme. This approach should be generally informative for structured RNA molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Latham, J A -- Cech, T R -- GM 11227-03/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):276-82.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309-0215.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501870" target="_blank"〉PubMed〈/a〉

Description: Spondyloepiphyseal dysplasias (SED) are a heterogeneous group of inherited disorders characterized by disproportionate short stature and pleiotropic involvement of the skeletal and ocular systems. Evidence has suggested that SED may result from structural defects in type II collagen. To confirm the validity of this hypothesis, the structure of the "candidate" type II collagen gene (COL2A1) has been directly examined in a relatively large SED family. Coarse scanning of the gene by Southern blot hybridization identified an abnormal restriction pattern in one of the affected members of the kindred. Analysis of selected genomic fragments, amplified by the polymerase chain reaction, precisely localized the molecular defect and demonstrated that all affected family members carried the same heterozygous single-exon deletion. As a consequence of the mutation, nearly 90 percent of the assembled type II collagen homotrimers are expected to contain one or more procollagen subunits harboring an interstitial deletion of 36 amino acids in the triple helical domain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, B -- Vissing, H -- Ramirez, F -- Rogers, D -- Rimoin, D -- AR-38648/AR/NIAMS NIH HHS/ -- HD-22657/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 May 26;244(4907):978-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, State University of New York Health Science Center, Brooklyn 11203.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543071" target="_blank"〉PubMed〈/a〉

Description: Confirmed infection with HTLV-II (human T cell leukemia virus type II) has been described only in rare cases. The major limitation to serological diagnosis of HTLV-II has been the difficulty of distinguishing HTLV-II from HTLV-I (human T cell leukemia virus type I) infection, because of substantial cross-reactivity between the viruses. A sensitive modification of the polymerase chain reaction method was used to provide unambiguous molecular evidence that a significant proportion of intravenous drug abusers are infected with HTLV, and the majority of these individuals are infected with HTLV-II rather than HTLV-I. Of 23 individuals confirmed by polymerase chain reaction analysis to be infected with HTLV, 21 were identified to be infected with HTLV-II, and 2 were infected with HTLV-I. Molecular identification of an HTLV-II--infected population provides an opportunity to investigate the pathogenicity of HTLV-II in humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, H -- Swanson, P -- Shorty, V S -- Zack, J A -- Rosenblatt, J D -- Chen, I S -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):471-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Diagnostics Division, Abbott Laboratories, North Chicago, IL 60064.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2655084" target="_blank"〉PubMed〈/a〉

Description: Basic fibroblast growth factor (bFGF) participates in many processes including early developmental events, angiogenesis, wound healing, and maintenance of neuronal cell viability. A 130-kilodalton protein was isolated on the basis of its ability to specifically bind to bFGF. A complementary DNA clone was isolated with an oligonucleotide probe corresponding to determined amino acid sequences of tryptic peptide fragments of the purified protein. The putative bFGF receptor encoded by this complementary DNA is a transmembrane protein that contains three extracellular immunoglobulin-like domains, an unusual acidic region, and an intracellular tyrosine kinase domain. These domains are arranged in a pattern that is different from that of any growth factor receptor described.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, P L -- Johnson, D E -- Cousens, L S -- Fried, V A -- Williams, L T -- CA 21765/CA/NCI NIH HHS/ -- R01 HL32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):57-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544996" target="_blank"〉PubMed〈/a〉

Description: Vascular endothelial growth factor (VEGF) was purified from media conditioned by bovine pituitary folliculostellate cells (FC). VEGF is a heparin-binding growth factor specific for vascular endothelial cells that is able to induce angiogenesis in vivo. Complementary DNA clones for bovine and human VEGF were isolated from cDNA libraries prepared from FC and HL60 leukemia cells, respectively. These cDNAs encode hydrophilic proteins with sequences related to those of the A and B chains of platelet-derived growth factor. DNA sequencing suggests the existence of several molecular species of VEGF. VEGFs are secreted proteins, in contrast to other endothelial cell mitogens such as acidic or basic fibroblast growth factors and platelet-derived endothelial cell growth factor. Human 293 cells transfected with an expression vector containing a bovine or human VEGF cDNA insert secrete an endothelial cell mitogen that behaves like native VEGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Leung, D W -- Cachianes, G -- Kuang, W J -- Goeddel, D V -- Ferrara, N -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1306-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Genetech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479986" target="_blank"〉PubMed〈/a〉

Description: An approach based on the polymerase chain reaction has been devised to clone new members of the family of genes encoding guanosine triphosphate-binding protein (G protein)-coupled receptors. Degenerate primers corresponding to consensus sequences of the third and sixth transmembrane segments of available receptors were used to selectively amplify and clone members of this gene family from thyroid complementary DNA. Clones encoding three known receptors and four new putative receptors were obtained. Sequence comparisons established that the new genes belong to the G protein-coupled receptor family. Close structural similarity was observed between one of the putative receptors and the 5HT1a receptor. Two other molecules displayed common sequence characteristics, suggesting that they are members of a new subfamily of receptors with a very short nonglycosylated (extracellular) amino-terminal extension.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Libert, F -- Parmentier, M -- Lefort, A -- Dinsart, C -- Van Sande, J -- Maenhaut, C -- Simons, M J -- Dumont, J E -- Vassart, G -- New York, N.Y. -- Science. 1989 May 5;244(4904):569-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Campus Erasme, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541503" target="_blank"〉PubMed〈/a〉

Description: In the polymerase chain reaction (PCR), two specific oligonucleotide primers are used to amplify the sequences between them. However, this technique is not suitable for amplifying genes that encode molecules where the 5' portion of the sequences of interest is not known, such as the T cell receptor (TCR) or immunoglobulins. Because of this limitation, a novel technique, anchored polymerase chain reaction (A-PCR), was devised that requires sequence specificity only on the 3' end of the target fragment. It was used to analyze TCR delta chain mRNA's from human peripheral blood gamma delta T cells. Most of these cells had a V delta gene segment not previously described (V delta 3), and the delta chain junctional sequences formed a discrete subpopulation compared with those previously reported.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loh, E Y -- Elliott, J F -- Cwirla, S -- Lanier, L L -- Davis, M M -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):217-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departments of Medicine and Microbiology and Immunology, Stanford University School of Medicine, CA 94305-5402.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463672" target="_blank"〉PubMed〈/a〉

Description: A 47-kilodalton neutrophil cytosol factor (NCF-47k), required for activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase superoxide (O2-.) production, is absent in most patients with autosomal recessive chronic granulomatous disease (AR-CGD). NCF-47k cDNAs were cloned from an expression library. The largest clone predicted a 41.9-kD protein that contained an arginine and serine-rich COOH-terminal domain with potential protein kinase C phosphorylation sites. A 33-amino acid segment of NCF-47k shared 49% identity with ras p21 guanosine triphosphatase activating protein. Recombinant NCF-47k restored O2-. -producing activity to AR-CGD neutrophil cytosol in a cell-free assay. Production of active recombinant NCF-47k will enable functional regions of this molecule to be mapped.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lomax, K J -- Leto, T L -- Nunoi, H -- Gallin, J I -- Malech, H L -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):409-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Bacterial Diseases Section, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547247" target="_blank"〉PubMed〈/a〉

Description: An important question in protein folding is whether the natural amino and carboxyl termini and the given order of secondary structure segments are critical to the stability and to the folding pathway of proteins. Here it is shown that two circularly permuted versions of the gene of a single-domain beta alpha barrel enzyme can be expressed in Escherichia coli. The variants are enzymically active and are practically indistinguishable from the original enzyme by several structural and spectroscopic criteria, despite the creation of new termini and the cleavage of a surface loop. This novel genetic approach should be useful for protein folding studies both in vitro and in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Luger, K -- Hommel, U -- Herold, M -- Hofsteenge, J -- Kirschner, K -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):206-10.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Abteilung Biophysikalische Chemie, Universitat Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2643160" target="_blank"〉PubMed〈/a〉

Description: Complementary DNA clones, encoding the LH-hCG (luteinizing hormone-human choriogonadotropic hormone) receptor were isolated by screening a lambda gt11 library with monoclonal antibodies. The primary structure of the protein was deduced from the DNA sequence analysis; the protein contains 696 amino acids with a putative signal peptide of 27 amino acids. Hydropathy analysis suggests the existence of seven transmembrane domains that show homology with the corresponding regions of other G protein-coupled receptors. Three other types of clones corresponding to shorter proteins were observed, in which the putative transmembrane domain was absent. These probably arose through alternative splicing. RNA blot analysis showed similar patterns in testis and ovary with a major RNA of 4700 nucleotides and several minor species. The messenger RNA was expressed in COS-7 cells, yielding a protein that bound hCG with the same affinity as the testicular receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loosfelt, H -- Misrahi, M -- Atger, M -- Salesse, R -- Vu Hai-Luu Thi, M T -- Jolivet, A -- Guiochon-Mantel, A -- Sar, S -- Jallal, B -- Garnier, J -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):525-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut National de la Sante et de la Recherche Medicale Unite 135, Hopital de Bicetre, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502844" target="_blank"〉PubMed〈/a〉

Description: An important control point in gene expression is at the level of messenger RNA (mRNA) stability. The mRNAs of certain regulatory cellular proteins such as oncogenes, cytokines, lymphokines, and transcriptional activators are extremely labile. These messages share a common AUUUA pentamer in their 3' untranslated region, which confers cytoplasmic instability. A cytosolic protein was identified that binds specifically to RNA molecules containing four reiterations of the AUUUA structural element. This protein consists of three subunits and binds rapidly to AUUUA-containing RNA. Such protein-RNA complexes are resistant to the actions of denaturing and reducing agents, demonstrating very stable binding. The time course, stability, and specificity of the protein-AUUUA interaction suggests the possibility that the formation of this complex may target susceptible mRNA for rapid cytoplasmic degradation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malter, J S -- CA01427-01/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):664-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Tulane University School of Medicine, New Orleans, LA 70112.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814487" target="_blank"〉PubMed〈/a〉

Description: Keratinocyte growth factor (KGF) is a human mitogen that is specific for epithelial cells. The complementary DNA sequence of KGF demonstrates that it is a member of the fibroblast growth factor family. The KGF transcript was present in stromal cells derived from epithelial tissues. By comparison with the expression of other epithelial cell mitogens, only KGF, among known human growth factors, has the properties of a stromal mediator of epithelial cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Finch, P W -- Rubin, J S -- Miki, T -- Ron, D -- Aaronson, S A -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):752-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475908" target="_blank"〉PubMed〈/a〉

Description: Insulin receptor complementary DNA has been cloned from an insulin-resistant individual whose receptors have impaired tyrosine protein kinase activity. One of this individual's alleles has a mutation in which valine is substituted for Gly996, the third glycine in the conserved Gly-X-Gly-X-X-Gly motif in the putative binding site fo adenosine triphosphate. Expression of the mutant receptor by transfection into Chinese hamster ovary cells confirmed that the mutation impairs tyrosine kinase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Odawara, M -- Kadowaki, T -- Yamamoto, R -- Shibasaki, Y -- Tobe, K -- Accili, D -- Bevins, C -- Mikami, Y -- Matsuura, N -- Akanuma, Y -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):66-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544998" target="_blank"〉PubMed〈/a〉

Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):126.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749249" target="_blank"〉PubMed〈/a〉

Description: The tpa-1 gene mediates the action of tumor-promoting phorbol esters in the nematode Caenorhabditis elegans. A genomic fragment that constitutes a portion of the tpa-1 gene was cloned by Tc1 transposon tagging and was used as a probe to screen a nematode complementary DNA library. One of the isolated complementary DNA clones had a nucleotide sequence that predicts a polypeptide of 526 amino acids. The predicted amino acid sequence revealed that the predicted tpa-1 protein sequence is highly similar to protein kinase C molecules from various animals, including man.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tabuse, Y -- Nishiwaki, K -- Miwa, J -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1713-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Fundamental Research Laboratories, NEC Corporation, Kawasaki, Kanagawa, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2538925" target="_blank"〉PubMed〈/a〉

Description: The structure and function of transcription factors of higher plants was studied by isolating cDNA clones encoding a wheat sequence-specific DNA binding protein. A hexameric nucleotide motif, ACGTCA, is located upstream from the TATA box of several plant histone genes. It has been suggested that this motif is essential for efficient transcription of the wheat histone H3 gene. A wheat nuclear protein, HBP-1 (histone DNA binding protein-1), which specifically binds to the hexameric motif, has previously been identified as a putative transcription factor. A cDNA clone encoding HBP-1 has been isolated on the basis of specific binding of HBP-1 to the hexameric motif. The deduced amino acid sequence indicates that HBP-1 contains the leucine zipper motif, which represents a characteristic property of several eukaryotic transcription factors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tabata, T -- Takase, H -- Takayama, S -- Mikami, K -- Nakatsuka, A -- Kawata, T -- Nakayama, T -- Iwabuchi, M -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):965-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Botany, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772648" target="_blank"〉PubMed〈/a〉

Description: Allele loss is a hallmark of chromosome regions harboring recessive oncogenes. Lung cancer frequently demonstrates loss of heterozygosity on 17p. Recent evidence suggests that the p53 gene located on 17p13 has many features of such an antioncogene. The p53 gene was frequently mutated or inactivated in all types of human lung cancer. The genetic abnormalities of p53 include gross changes such as homozygous deletions and abnormally sized messenger RNAs along with a variety of point or small mutations, which map to the p53 open reading frame and change amino acid sequence in a region highly conserved between mouse and man. In addition, very low or absent expression of p53 messenger RNA in lung cancer cell lines compared to normal lung was seen. These findings, coupled with the previous demonstration of 17p allele loss in lung cancer, strongly implicate p53 as an anti-oncogene whose disruption is involved in the pathogenesis of human lung cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, T -- Nau, M M -- Chiba, I -- Birrer, M J -- Rosenberg, R K -- Vinocour, M -- Levitt, M -- Pass, H -- Gazdar, A F -- Minna, J D -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):491-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉National Cancer Institute-Navy Medical Oncology Branch, Bethesda, MD 20814.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554494" target="_blank"〉PubMed〈/a〉

Description: The contribution of the anticodon to the discrimination between cognate and noncognate tRNAs by Escherichia coli Arg-tRNA synthetase has been investigated by in vitro synthesis and aminoacylation of elongator methionine tRNA (tRNA(mMet) mutants. Substitution of the Arg anticodon CCG for the Met anticodon CAU leads to a dramatic increase in Arg acceptance by tRNA(mMet). A nucleotide (A20) previously identified by others in the dihydrouridine loop of tRNA(Arg)s makes a smaller contribution to the conversion of tRNA(mMet) identity from Met to Arg. The combined anticodon and dihydrouridine loop mutations yield a tRNA(mMet) derivative that is aminoacylated with near-normal kinetics by the Arg-tRNA synthetase.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schulman, L H -- Pelka, H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1595-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology and Cancer, Albert Einstein College of Medicine, Bronx, NY 10461.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688091" target="_blank"〉PubMed〈/a〉

Description: Isolation of a clone encoding the mouse lymph node homing receptor reveals a deduced protein with an unusual protein mosaic architecture, containing a separate carbohydrate-binding (lectin) domain, an epidermal growth factor-like (EGF) domain, and an extracellular precisely duplicated repeat unit, which preserves the motif seen in the homologous repeat structure of complement regulatory proteins and other proteins. The receptor molecule is potentially highly glycosylated, and contains an apparent transmembrane region. Analysis of messenger RNA transcripts reveals a predominantly lymphoid distribution in direct relation to the cell surface expression of the MEL-14 determinant, and the cDNA clone is shown to confer the MEL-14 epitope in heterologous cells. The many novel features, including ubiquitination, embodied in this single receptor molecule form the basis for numerous approaches to the study of cell-cell interactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siegelman, M H -- van de Rijn, M -- Weissman, I L -- AI09022/AI/NIAID NIH HHS/ -- OIG43551/PHS HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1165-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646713" target="_blank"〉PubMed〈/a〉

Description: Artificial yeast introns that show cold-sensitive splicing have been constructed. These conditional introns can be inserted into a target gene as an "intron cassette" without disrupting the coding information, allowing expression of the gene to be cold sensitive. Insertion of these intron cassettes rendered the yeast URA3 gene cold sensitive in its expression. The advantage of this intron-mediated control system is that any gene can be converted to a controllable gene by simple insertion of an intron.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yoshimatsu, T -- Nagawa, F -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1346-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Biotechnology Research, Wakunaga Pharmaceutical Co., Ltd., Hiroshima, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544026" target="_blank"〉PubMed〈/a〉

Description: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉

Description: The mouse albumin gene promoter has six closely spaced binding sites for nuclear proteins that are located between the TATA motif and nucleotide position -170. In vitro transcription with liver or spleen nuclear extracts of templates containing either mutated or polymerized albumin promoter elements establishes a hierarchy of the different protein binding sites for tissue-specific albumin gene transcription. The HNF-1 and C/EBP binding sites strongly activate transcription in a tissue-specific manner. The NF-Y binding site has a lower activation potential and is less specific, being equally efficient in liver and spleen nuclear extracts. The remaining elements are relatively weak activator sites.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Maire, P -- Wuarin, J -- Schibler, U -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):343-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departement de Biologie Moleculaire, Sciences II, Geneva, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2711183" target="_blank"〉PubMed〈/a〉

Description: Parasitic protozoans and helminths pose considerable medical as well as scientific challenges. Investigations of the complex and very different life cycles of these organisms, their adaptation to the obligate parasitic mode of life, and their ability to face the hostile host environment have resulted in many exciting discoveries. Invasion of host erythrocytes by plasmodial sporozoites and intact skin by schistosomal cercariae are outlined as examples of the elaborate mechanisms of parasitism. Isolation and characterization of single protective antigens or subunit vaccines from these two organisms are examined as models for vaccine development. Finally, developments in exploring gene regulation in protozoans and free and parasitic nematodes are briefly outlined.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mahmoud, A A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1015-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Case Western Reserve University School of Medicine, Cleveland, OH 44106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686024" target="_blank"〉PubMed〈/a〉

Description: The retinoblastoma (Rb) antioncogene encodes a nuclear phosphoprotein, p105-Rb, that forms protein complexes with the adenovirus E1A and SV40 large T oncoproteins. A novel, aberrant Rb protein detected in J82 bladder carcinoma cells was not able to form a complex with E1A and was less stable than p105-Rb. By means of a rapid method for the detection of mutations in Rb mRNA, this defective Rb protein was observed to result from a single point mutation within a splice acceptor sequence in J82 genomic DNA. This mutation eliminates a single exon and 35 amino acids from its encoded protein product.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Horowitz, J M -- Yandell, D W -- Park, S H -- Canning, S -- Whyte, P -- Buchkovich, K -- Harlow, E -- Weinberg, R A -- Dryja, T P -- CA 08131/CA/NCI NIH HHS/ -- CA 13106/CA/NCI NIH HHS/ -- CA 39826/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):937-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2521957" target="_blank"〉PubMed〈/a〉

Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Perlman, P S -- Butow, R A -- GM 35510/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1106-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Genetics, Ohio State University, Columbus 43210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479980" target="_blank"〉PubMed〈/a〉

Description: Genomic sequencing permits studies of in vivo DNA methylation and protein-DNA interactions, but its use has been limited because of the complexity of the mammalian genome. A newly developed genomic sequencing procedure in which a ligation mediated polymerase chain reaction (PCR) is used generates high quality, reproducible sequence ladders starting with only 1 microgram of uncloned mammalian DNA per reaction. Different sequence ladders can be created simultaneously by inclusion of multiple primers and visualized separately by rehybridization. Relatively little radioactivity is needed for hybridization and exposure times are short. Methylation patterns in genomic DNA are readily detectable; for example, 17 CpG dinucleotides in the 5' region of human X-linked PGK-1 (phosphoglycerate kinase 1) were found to be methylated on an inactive human X chromosome, but unmethylated on an active X chromosome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pfeifer, G P -- Steigerwald, S D -- Mueller, P R -- Wold, B -- Riggs, A D -- AG08196/AG/NIA NIH HHS/ -- GM355262BW/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):810-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Biology Section, Beckman Research Institute of the City of Hope, Duarte, CA 91010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814502" target="_blank"〉PubMed〈/a〉

Description: The nitrogen regulatory (NtrC) protein of enteric bacteria, which binds to sites that have the properties of transcriptional enhancers, is known to activate transcription by a form of RNA polymerase that contains the NtrA protein (sigma 54) as sigma factor (referred to as sigma 54-holoenzyme). In the presence of adenosine triphosphate, the NtrC protein catalyzes isomerization of closed recognition complexes between sigma 54-holoenzyme and the glnA promoter to open complexes in which DNA in the region of the transcription start site is locally denatured. NtrC is not required subsequently for maintenance of open complexes or initiation of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Popham, D L -- Szeto, D -- Keener, J -- Kustu, S -- GM38361/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):629-35.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, Berkley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563595" target="_blank"〉PubMed〈/a〉

Description: Cholesterol balance in mammalian cells is maintained in part by sterol-mediated repression of gene transcription for the low density lipoprotein receptor and enzymes in the cholesterol biosynthetic pathway. A promoter sequence termed the sterol regulatory element (SRE) is essential for this repression. With the use of an oligonucleotide containing the SRE to screen a human hepatoma complementary DNA expression library, a clone for a DNA binding protein was isolated that binds to the conserved SRE octanucleotide in both a sequence-specific and a single-strand--specific manner. This protein contains seven highly conserved zinc finger repeats that exhibit striking sequence similarity to retroviral nucleic acid binding proteins (NBPs). We have designated the protein "cellular NBP" (CNBP). CNBP is expressed in a wide variety of tissues, is up regulated by sterols, and exhibits binding specificity that correlates with in vivo function. These properties are consistent with a role in sterol-mediated control of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rajavashisth, T B -- Taylor, A K -- Andalibi, A -- Svenson, K L -- Lusis, A J -- HL30568/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):640-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2562787" target="_blank"〉PubMed〈/a〉

Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉

Description: Techniques of gene amplification, molecular cloning, and sequence analysis were used to test for the presence of sequences related to human T-lymphotropic virus type I (HTLV-I) in peripheral blood mononuclear cells of six patients with multiple sclerosis (MS) and 20 normal individuals. HTLV-I sequences were detected in all six MS patients and in one individual from the control group by DNA blot analysis and molecular cloning of amplified DNAs. The viral sequence in MS patients were associated with adherent cell populations consisting predominantly of monocytes and macrophages. Molecular cloning and nucleotide sequence analysis indicated that these amplified viral sequences were related to the HTLV-I proviral genome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- Sandberg-Wollheim, M -- Mettus, R V -- Ray, P E -- DeFreitas, E -- Koprowski, H -- CA-10815/CA/NCI NIH HHS/ -- NS-11036/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):529-33.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536193" target="_blank"〉PubMed〈/a〉

Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):10-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781296" target="_blank"〉PubMed〈/a〉

Description: Overlapping complementary DNA clones were isolated from epithelial cell libraries with a genomic DNA segment containing a portion of the putative cystic fibrosis (CF) locus, which is on chromosome 7. Transcripts, approximately 6500 nucleotides in size, were detectable in the tissues affected in patients with CF. The predicted protein consists of two similar motifs, each with (i) a domain having properties consistent with membrane association and (ii) a domain believed to be involved in ATP (adenosine triphosphate) binding. A deletion of three base pairs that results in the omission of a phenylalanine residue at the center of the first predicted nucleotide-binding domain was detected in CF patients.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riordan, J R -- Rommens, J M -- Kerem, B -- Alon, N -- Rozmahel, R -- Grzelczak, Z -- Zielenski, J -- Lok, S -- Plavsic, N -- Chou, J L -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1066-73.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475911" target="_blank"〉PubMed〈/a〉

Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):576, 578.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814484" target="_blank"〉PubMed〈/a〉

Description: Phenotypic heterogeneity in the repetitive portion of a human malaria circumsporozoite (CS) protein, a major target of candidate vaccines, has been found. Over 14% of clinical cases of uncomplicated Plasmodium vivax malaria at two sites in western Thailand produced sporozoites immunologically distinct from previously characterized examples of the species. Monoclonal antibodies to the CS protein of other P. vivax isolates and to other species of human and simian malarias did not bind to these nonreactive sporozoites, nor did antibodies from monkeys immunized with a candidate vaccine made from the repeat portion of a New World CS protein. The section of the CS protein gene between the conserved regions I and II of a nonreactive isolate contained a nonapeptide repeat, Ala-Asn-Gly-Ala-Gly-Asn-Gln-Pro-Gly, identical at only three amino acid positions with published nonapeptide sequences. This heterogeneity implies that a P. vivax vaccine based on the CS protein repeat of one isolate will not be universally protective.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenberg, R -- Wirtz, R A -- Lanar, D E -- Sattabongkot, J -- Hall, T -- Waters, A P -- Prasittisuk, C -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):973-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Entomology, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672336" target="_blank"〉PubMed〈/a〉

Description: An understanding of the basic defect in the inherited disorder cystic fibrosis requires cloning of the cystic fibrosis gene and definition of its protein product. In the absence of direct functional information, chromosomal map position is a guide for locating the gene. Chromosome walking and jumping and complementary DNA hybridization were used to isolate DNA sequences, encompassing more than 500,000 base pairs, from the cystic fibrosis region on the long arm of human chromosome 7. Several transcribed sequences and conserved segments were identified in this cloned region. One of these corresponds to the cystic fibrosis gene and spans approximately 250,000 base pairs of genomic DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rommens, J M -- Iannuzzi, M C -- Kerem, B -- Drumm, M L -- Melmer, G -- Dean, M -- Rozmahel, R -- Cole, J L -- Kennedy, D -- Hidaka, N -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- N01-CO-74102/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1059-65.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772657" target="_blank"〉PubMed〈/a〉

Description: The crystal structure of Escherichia coli glutaminyl-tRNA synthetase (GlnRS) complexed with its cognate glutaminyl transfer RNA (tRNA(Gln] and adenosine triphosphate (ATP) has been derived from a 2.8 angstrom resolution electron density map and the known protein and tRNA sequences. The 63.4-kilodalton monomeric enzyme consists of four domains arranged to give an elongated molecule with an axial ratio greater than 3 to 1. Its interactions with the tRNA extend from the anticodon to the acceptor stem along the entire inside of the L of the tRNA. The complexed tRNA retains the overall conformation of the yeast phenylalanine tRNA (tRNA(Phe] with two major differences: the 3' acceptor strand of tRNA(Gln) makes a hairpin turn toward the inside of the L, with the disruption of the final base pair of the acceptor stem, and the anticodon loop adopts a conformation not seen in any of the previously determined tRNA structures. Specific recognition elements identified so far include (i) enzyme contacts with the 2-amino groups of guanine via the tRNA minor groove in the acceptor stem at G2 and G3; (ii) interactions between the enzyme and the anticodon nucleotides; and (iii) the ability of the nucleotides G73 and U1.A72 of the cognate tRNA to assume a conformation stabilized by the protein at a lower free energy cost than noncognate sequences. The central domain of this synthetase binds ATP, glutamine, and the acceptor end of the tRNA as well as making specific interactions with the acceptor stem.2+t is〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rould, M A -- Perona, J J -- Soll, D -- Steitz, T A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1135-42.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479982" target="_blank"〉PubMed〈/a〉

Description: An analysis of the aminoacylation kinetics of unmodified yeast tRNAPhe mutants revealed that five single-stranded nucleotides are important for its recognition by yeast phenylalanyl-tRNA synthetase, provided they were positioned correctly in a properly folded tRNA structure. When four other tRNAs were changed to have these five nucleotides, they became near-normal substrates for the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sampson, J R -- DiRenzo, A B -- Behlen, L S -- Uhlenbeck, O C -- GM 37552/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1363-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646717" target="_blank"〉PubMed〈/a〉

Description: The endogenous c-mos product, pp39mos, is required for progesterone-induced meiotic maturation in Xenopus oocytes. Treatment of oocytes with progesterone induced a rapid increase in pp39mos that preceded both the activation of maturation promoting factor (MPF) and germinal vesicle breakdown (GVBD). Microinjection of synthetic mos RNA into oocytes activated MPF and induced GVBD in the absence of progesterone. Thus, the mos proto-oncogene product may qualify as a candidate "initiator" protein of MPF and is at least one of the "triggers" for G2 to M transition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagata, N -- Daar, I -- Oskarsson, M -- Showalter, S D -- Vande Woude, G F -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):643-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉BRI-Basic Research Program, National Cancer Institute, Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474853" target="_blank"〉PubMed〈/a〉

Description: Chemical probing methods have been used to "footprint" 16S ribosomal RNA (rRNA) at each step during the in vitro assembly of twenty 30S subunit ribosomal proteins. These experiments yield information about the location of each protein relative to the structure of 16S rRNA and provide the basis for derivation of a detailed model for the three-dimensional folding of 16S rRNA. Several lines of evidence suggest that protein-dependent conformational changes in 16S rRNA play an important part in the cooperativity of ribosome assembly and in fine-tuning of the conformation and dynamics of 16S rRNA in the 30S subunit.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stern, S -- Powers, T -- Changchien, L M -- Noller, H F -- GM-17129/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):783-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Thimann Laboratories, University of California, Santa Cruz 95064.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658053" target="_blank"〉PubMed〈/a〉

Description: Synapsins are neuronal phosphoproteins that coat synaptic vesicles, bind to the cytoskeleton, and are believed to function in the regulation of neurotransmitter release. Molecular cloning reveals that the synapsins comprise a family of four homologous proteins whose messenger RNA's are generated by differential splicing of transcripts from two genes. Each synapsin is a mosaic composed of homologous amino-terminal domains common to all synapsins and different combinations of distinct carboxyl-terminal domains. Immunocytochemical studies demonstrate that all four synapsins are widely distributed in nerve terminals, but that their relative amounts vary among different kinds of synapses. The structural diversity and differential distribution of the four synapsins suggest common and different roles of each in the integration of distinct signal transduction pathways that modulate neurotransmitter release in various types of neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sudhof, T C -- Czernik, A J -- Kao, H T -- Takei, K -- Johnston, P A -- Horiuchi, A -- Kanazir, S D -- Wagner, M A -- Perin, M S -- De Camilli, P -- AA 06944/AA/NIAAA NIH HHS/ -- MH 39327/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1474-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Dallas, TX.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506642" target="_blank"〉PubMed〈/a〉

Description: Sera from patients with autoimmune diseases often contain antibodies that bind ribonucleoproteins (RNPs). Sera from 30 such patients were found to immunoprecipitate ribonuclease P (RNase P), an RNP enzyme required to process the 5' termini of transfer RNA transcripts in nuclei and mitochondria of eukaryotic cells. All 30 sera also immunoprecipitated the nucleolar Th RNP, indicating that the two RNPs are structurally related. Nucleotide sequence analysis of the Th RNP revealed it was identical to the RNA component of the mitochondrial RNA processing enzyme known as RNase MRP. Antibodies that immunoprecipitated the Th RNP selectively depleted murine and human cell extracts of RNase MRP activity, indicating that the Th and RNase MRP RNPs are identical. Since RNase P and RNase MRP are not associated with each other during biochemical purification, we suggest that these two RNA processing enzymes share a common autoantigenic polypeptide.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gold, H A -- Topper, J N -- Clayton, D A -- Craft, J -- AI 26853/AI/NIAID NIH HHS/ -- GM 33088-19/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1377-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Yale University School of Medicine, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476849" target="_blank"〉PubMed〈/a〉

Description: Analysis of crosslinked complexes of M1 RNA, the catalytic RNA subunit of ribonuclease P from Escherichia coli, and transfer RNA precursor substrates has led to the identification of regions in the enzyme and in the substrate that are in close physical proximity to each other. The nucleotide in M1 RNA, residue C92, which participates in a crosslink with the substrate was deleted and the resulting mutant M1 RNA was shown to cleave substrates lacking the 3' terminal CCAUCA sequence at sites several nucleotides away from the normal site of cleavage. The presence or absence of the 3' terminal CCAUCA sequence in transfer RNA precursor substrates markedly affects the way in which these substrates interact with the catalytic RNA in the enzyme-substrate complex. The contacts between wild-type M1 RNA and its substrate are in a region that resembles part of the transfer RNA "E" (exit) site in 23S ribosomal RNA. These data demonstrate that in RNA's with very different cellular functions, there are domains with similar structural and functional properties and that there is a nucleotide in M1 RNA that affects the site of cleavage by the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Guerrier-Takada, C -- Lumelsky, N -- Altman, S -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1578-84.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Yale University, New Haven, CT 06520.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480641" target="_blank"〉PubMed〈/a〉

Description: Interleukin-2 (IL-2) binds to two distinct receptor molecules, the IL-2 receptor alpha (IL-2R alpha, p55) chain and the newly identified IL-2 receptor beta (IL-2R beta, p70-75) chain. The cDNA encoding the human IL-2R beta chain has now been isolated. The overall primary structure of the IL-2R beta chain shows no apparent homology to other known receptors. Unlike the IL-2R alpha chain, the IL-2R beta chain has a large cytoplasmic region in which a functional domain (or domains) mediating an intracellular signal transduction pathway (or pathways) may be embodied. The cDNA-encoded beta chain binds and internalizes IL-2 when expressed on T lymphoid cells but not fibroblast cells. Furthermore, the cDNA gives rise to the generation of high-affinity IL-2 receptor when co-expressed with the IL-2R alpha chain cDNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hatakeyama, M -- Tsudo, M -- Minamoto, S -- Kono, T -- Doi, T -- Miyata, T -- Miyasaka, M -- Taniguchi, T -- New York, N.Y. -- Science. 1989 May 5;244(4904):551-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785715" target="_blank"〉PubMed〈/a〉

Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉

Description: Two distinct CD3-associated T cell receptors (TCR alpha beta and TCR gamma delta) are expressed in a mutually exclusive fashion on separate subsets of T lymphocytes. While the specificity of the TCR alpha beta repertoire for major histocompatibility complex (MHC) antigens is well established, the diversity of expressed gamma delta receptors and the ligands they recognize are less well understood. An alloreactive CD3+CD4-CD8- T cell line specific for murine class II MHC (Ia) antigens encoded in the I-E subregion of the H-2 gene complex was identified, and the primary structure of its gamma delta receptor heterodimer was characterized. In contrast to a TCR alpha beta-expressing alloreactive T cell line selected for similar specificity, the TCR gamma delta line displayed broad cross-reactivity for multiple distinct I-E-encoded allogeneic Ia molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matis, L A -- Fry, A M -- Cron, R Q -- Cotterman, M M -- Dick, R F -- Bluestone, J A -- 5-T32AI07090-10/AI/NIAID NIH HHS/ -- CA-14599-15/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):746-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biochemistry and Biophysics, Food and Drug Administration, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2528206" target="_blank"〉PubMed〈/a〉

Description: The intervening sequence of the ribosomal RNA precursor of Tetrahymena is a catalytic RNA molecule, or ribozyme. Acting as a sequence-specific endoribonuclease, it cleaves single-stranded RNA substrates with concomitant addition of guanosine. The chemistry of the reaction has now been studied by introduction of a single phosphorothioate in the substrate RNA at the cleavage site. Kinetic studies show no significant effect of this substitution on kcat (rate constant) or Km (Michaelis constant), providing evidence that some step other than the chemical step is rate-limiting. Product analysis reveals that the reaction proceeds with inversion of configuration at phosphorus, consistent with an in-line, SN2 (P) mechanism. Thus, the ribozyme reaction is in the same mechanistic category as the individual displacement reactions catalyzed by protein nucleotidyltransferases, phosphotransferases, and nucleases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McSwiggen, J A -- Cech, T R -- GM28039/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 12;244(4905):679-83.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309-0215.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2470150" target="_blank"〉PubMed〈/a〉

Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉

Description: The cloning of genes encoding mammalian DNA binding transcription factors for RNA polymerase II has provided the opportunity to analyze the structure and function of these proteins. This review summarizes recent studies that define structural domains for DNA binding and transcriptional activation functions in sequence-specific transcription factors. The mechanisms by which these factors may activate transcriptional initiation and by which they may be regulated to achieve differential gene expression are also discussed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mitchell, P J -- Tjian, R -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):371-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2667136" target="_blank"〉PubMed〈/a〉

Description: The zona pellucida surrounding mouse oocytes is an extracellular matrix composed of three sulfated glycoproteins, ZP1, ZP2, and ZP3. It has been demonstrated that a monoclonal antibody to ZP3 injected into female mice inhibits fertilization by binding to the zona pellucida and blocking sperm penetration. A complementary DNA encoding ZP3 was randomly cleaved and 200- to 1000-base pair fragments were cloned into the expression vector lambda gt11. This epitope library was screened with the aforementioned contraceptive antibody, and the positive clones were used to map the seven-amino acid epitope recognized by the antibody. Female mice were immunized with a synthetic peptide containing this B cell epitope coupled to a carrier protein to provide helper T cell epitopes. The resultant circulating antibodies to ZP3 bound to the zona pellucida of immunized animals and produced long-lasting contraception. The lack of ovarian histopathology or cellular cytotoxicity among the immunized animals may be because of the absence of zona pellucida T cell epitopes in this vaccine.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millar, S E -- Chamow, S M -- Baur, A W -- Oliver, C -- Robey, F -- Dean, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):935-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479101" target="_blank"〉PubMed〈/a〉

Description: Cadherins are a family of Ca2+-dependent intercellular adhesion molecules. Complementary DNAs encoding mouse neural cadherin (N-cadherin) were cloned, and the cell binding specificity of this molecule was examined. Mouse N-cadherin shows 92 percent similarity in amino acid sequence to the chicken homolog, while it shows 49 percent and 43 percent similarity to epithelial cadherin and to placental cadherin of the same species, respectively. In cell binding assays, mouse N-cadherin did not cross-react with other mouse cadherins, but it did cross-react with chicken N-cadherin. The results indicate that each cadherin type confers distinct adhesive specificities on different cells, and also that the specificity of N-cadherin is conserved between mammalian and avian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miyatani, S -- Shimamura, K -- Hatta, M -- Nagafuchi, A -- Nose, A -- Matsunaga, M -- Hatta, K -- Takeichi, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):631-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2762814" target="_blank"〉PubMed〈/a〉

Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉

Description: In vivo protein-DNA interactions at the developmentally regulated enhancer of the mouse muscle creatine kinase (MCK) gene were examined by a newly developed polymerase chain reaction (PCR) footprinting procedure. This ligation mediated, single-sided PCR technique permits the exponential amplification of an entire sequence ladder. Several footprints were detected in terminally differentiated muscle cells where the MCK gene is actively transcribed. None were observed in myogenic cells prior to differentiation or in nonmuscle cells. Two footprints appear to correspond to sites that can bind the myogenic regulator MyoD1 in vitro, whereas two others represent muscle specific use of apparently general factors. Because MyoD1 is synthesized by undifferentiated myoblasts, these data imply that additional regulatory mechanisms must restrict the interaction between this protein and its target site prior to differentiation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mueller, P R -- Wold, B -- GM35526/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):780-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814500" target="_blank"〉PubMed〈/a〉

Description: Blue cone monochromacy is a rare X-linked disorder of color vision characterized by the absence of both red and green cone sensitivities. In 12 of 12 families carrying this trait, alterations are observed in the red and green visual pigment gene cluster. The alterations fall into two classes. One class arose from the wild type by a two-step pathway consisting of unequal homologous recombination and point mutation. The second class arose by nonhomologous deletion of genomic DNA adjacent to the red and green pigment gene cluster. These deletions define a 579-base pair region that is located 4 kilobases upstream of the red pigment gene and 43 kilobases upstream of the nearest green pigment gene; this 579-base pair region is essential for the activity of both pigment genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nathans, J -- Davenport, C M -- Maumenee, I H -- Lewis, R A -- Hejtmancik, J F -- Litt, M -- Lovrien, E -- Weleber, R -- Bachynski, B -- Zwas, F -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):831-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology and Genetics, Wilmer Ophthalmologic Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2788922" target="_blank"〉PubMed〈/a〉

Description: The adult form of Tay-Sachs disease, adult GM2 gangliosidosis, is an autosomal recessive disorder that results from mutations in the alpha chain of beta-hexosaminidase A. This disorder, like infantile Tay-Sachs disease, is more frequent in the Ashkenazi Jewish population. A point mutation in the alpha-chain gene was identified that results in the substitution of Gly with Ser in eight Ashkenazi adult GM2 gangliosidosis patients from five different families. This amino acid substitution was shown to depress drastically the catalytic activity of the alpha chain after expression in COS-1 cells. All of these patients proved to be compound heterozygotes of the allele with the Gly to Ser change and one of the two Ashkenazi infantile Tay-Sachs alleles. These findings will aid in the diagnosis and understanding of beta-hexosaminidase A deficiency disorders.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Navon, R -- Proia, R L -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1471-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genetics and Biochemistry Branch, National Institute of Diabetes, Digestive, and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2522679" target="_blank"〉PubMed〈/a〉

Description: Transcription of the yeast CYC1 promoter fused to a sequence lacking guanosine residues provided a rapid, sensitive assay of initiation by RNA polymerase II in yeast extracts. Initiation was enhanced by yeast and mammalian activator proteins. The adenoviral major late promoter fused to the G-minus sequence was transcribed in yeast extracts with an efficiency comparable to that observed in HeLa extracts, showing that promoters as well as transcription factors are functionally interchangeable across species. Initiation occurred at different sites, approximately 30 and 63 to 69 base pairs downstream of the TATA element of the adenoviral promoter in HeLa and yeast extracts, respectively, distances characteristic of initiation in the two systems in vivo. A component of the transcription system and not the promoter sequence determines the distance to the initiation site.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lue, N F -- Flanagan, P M -- Sugimoto, K -- Kornberg, R D -- GM36659/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):661-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Beckman Laboratories, Fairchild Center, Stanford School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510298" target="_blank"〉PubMed〈/a〉

Description: In prokaryotes and eukaryotes mobile genetic elements frequently disrupt the highly conservative structures of chromosomes, which are responsible for storage of genetic information. The factors determining the site for integration of such elements are still unknown. Transfer RNA (tRNA) genes are associated in a highly significant manner with different putative mobile genetic elements in the cellular slime mold Dictyostelium discoideum. These results suggest that tRNA genes in D. discoideum, and probably tRNA genes generally in lower eukaryotes, may function as genomic landmarks for the integration of different transposable elements in a strictly position-specific manner.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marschalek, R -- Brechner, T -- Amon-Bohm, E -- Dingermann, T -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1493-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Biochemie der Medizinischen Fakultat, Universitat Erlangen-Nurnberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2567533" target="_blank"〉PubMed〈/a〉

Description: Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hiesel, R -- Wissinger, B -- Schuster, W -- Brennicke, A -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1632-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Genbiologische Forschung, Berlin, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480644" target="_blank"〉PubMed〈/a〉

Description: Differential gene expression in the mother cell chamber of sporulating cells of Bacillus subtilis is determined in part by an RNA polymerase sigma factor called sigma K (or sigma 27). The sigma K factor was assigned as the product of the sporulation gene spoIVCB on the basis of the partial aminoterminal amino acid sequence of the purified protein. The spoIVCB gene is now shown to be a truncated gene capable of specifying only the amino terminal half of sigma K. The carboxyl terminal half is specified by another sporulation gene, spoIIIC, to which spoIVCB becomes joined inframe at an intermediate stage of sporulation by site-specific recombination within a 5-base pair repeated sequence. Juxtaposition of spoIVCB and spoIIIC need not be reversible in that the mother cell and its chromosome are discarded at the end of the developmental cycle. The rearrangement of chromosomal DNA could account for the presence of sigma K selectively in the mother cell and may be a precedent for the generation of cell type-specific regulatory proteins in other developmental systems where cells undergo terminal differentiation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stragier, P -- Kunkel, B -- Kroos, L -- Losick, R -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):507-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cellular and Developmental Biology, Harvard University, Cambridge, MA 02138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536191" target="_blank"〉PubMed〈/a〉

Description: Joining of V-, D-, and J-region gene segments during DNA rearrangements within all antigen receptor genes involves recognition of the same highly conserved heptamernonamer sequences flanking each segment. In order to investigate the possibility that recognition of these conserved sequences may sometimes permit intergenic joining of segments among different antigen receptor genes, DNA of normal human lymphoid tissues was examined by polymerase chain reaction amplification for the presence of chimeric gamma-delta T cell receptor gene rearrangements. These studies detected V gamma-(D delta)-J delta and V delta-(D delta)-J gamma rearrangements in thymus, peripheral blood, and tonsil. Analysis of thymus RNA indicated that many of these rearrangements are expressed as V gamma-(D delta)-J delta-C delta and V delta-(D delta)-J gamma-C gamma transcripts. Most transcripts (19 of 20 complementary DNA clones studied) are appropriately spliced and show correct open translational reading frames across the V-(D)-J junctions. Thus, chimeric antigen receptor genes are generated in a subset of normal lymphoid cells, probably as a result of chromosomal translocations, and such genes may possibly contribute to increased diversity within the antigen receptor repertoire.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tycko, B -- Palmer, J D -- Sklar, J -- CA38621/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1242-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2551037" target="_blank"〉PubMed〈/a〉

Description: The insulin receptor has an intrinsic tyrosine kinase activity that is essential for signal transduction. A mutant insulin receptor gene lacking almost the entire kinase domain has been identified in an individual with type A insulin resistance and acanthosis nigricans. Insulin binding to the erythrocytes or cultured fibroblasts from this individual was normal. However receptor autophosphorylation and tyrosine kinase activity toward an exogenous substrate were reduced in partially purified insulin receptors from the proband's lymphocytes that had been transformed by Epstein-Barr virus. The insulin resistance associated with this mutated gene was inherited by the proband from her mother as an apparently autosomal dominant trait. Thus a deletion in one allele of the insulin receptor gene may be at least partly responsible for some instances of insulin-resistant diabetes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Taira, M -- Hashimoto, N -- Shimada, F -- Suzuki, Y -- Kanatsuka, A -- Nakamura, F -- Ebina, Y -- Tatibana, M -- Makino, H -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):63-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Second Department of Internal Medicine, Chiba University School of Medicine, Inohana, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544997" target="_blank"〉PubMed〈/a〉