ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (1,118)
  • American Association for the Advancement of Science (AAAS)  (1,118)
  • American Institute of Physics (AIP)
  • Nature Publishing Group
  • 1985-1989  (426)
  • 1980-1984  (692)
Collection
Publisher
  • American Association for the Advancement of Science (AAAS)  (1,118)
  • American Institute of Physics (AIP)
  • Nature Publishing Group
  • Springer  (15)
Years
Year
  • 1
    Publication Date: 1988-07-15
    Description: Odorant-binding protein (OBP) is found in nasal epithelium, and it selectively binds odorants. Three complementary DNAs encoding rat odorant-binding protein have now been cloned and sequenced. One clone contains an open reading frame predicted to encode an 18,091-dalton protein. RNA blot analysis confirms the localization of OBP messenger RNA in the nasal epithelium. This OBP has 33 percent amino acid identity to alpha 2-microglobulin, a secreted plasma protein. Other members of an alpha 2-microglobulin superfamily bind and transport hydrophobic ligands. Thus, OBP probably binds and carries odorants within the nasal epithelium to putative olfactory receptors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pevsner, J -- Reed, R R -- Feinstein, P G -- Snyder, S H -- DA-00074/DA/NIDA NIH HHS/ -- GM-07626/GM/NIGMS NIH HHS/ -- P01 CA16519-13/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 15;241(4863):336-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388043" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Carrier Proteins/*genetics ; Cloning, Molecular ; Ligands ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Nasal Mucosa/*physiology ; Rats ; *Receptors, Odorant ; Smell/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-10-21
    Description: Synthesis of a small group of highly conserved proteins in response to elevated temperature and other agents that induce stress is a universal feature of prokaryotic and eukaryotic cells. Although correlative evidence suggests that these proteins play a role in enhancing survival during and after stress, there is no direct evidence to support this in mammalian cells. To assess the role of the most highly conserved heat shock protein (hsp) family during heat shock, affinity-purified monoclonal antibodies to hsp70 were introduced into fibroblasts by needle microinjection. In addition to impairing the heat-induced translocation of hsp70 proteins into the nucleus after mild heat shock treatment, injected cells were unable to survive a brief incubation at 45 degrees C. Cells injected with control antibodies survived a similar heat shock. These results indicate that functional hsp70 is required for survival of these cells during and after thermal stress.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riabowol, K T -- Mizzen, L A -- Welch, W J -- GM33551/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Oct 21;242(4877):433-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cold Spring Harbor Laboratory, NY 11724.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3175665" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies/administration & dosage ; Antigen-Antibody Complex ; Cell Survival ; Fibroblasts/cytology ; Heat-Shock Proteins/immunology/*physiology ; *Hot Temperature ; Microinjections ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    Publication Date: 1988-12-16
    Description: Fibroblasts were genetically modified to secrete nerve growth factor (NGF) by infection with a retroviral vector and then implanted into the brains of rats that had surgical lesions of the fimbria-fornix. The grafted cells survived and produced sufficient NGF to prevent the degeneration of cholinergic neurons that would die without treatment. In addition, the protected cholinergic cells sprouted axons that projected in the direction of the cellular source of NGF. These results indicate that a combination of gene transfer and intracerebral grafting may provide an effective treatment for some disorders of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenberg, M B -- Friedmann, T -- Robertson, R C -- Tuszynski, M -- Wolff, J A -- Breakefield, X O -- Gage, F H -- AG06088/AG/NIA NIH HHS/ -- HD20034/HD/NICHD NIH HHS/ -- NS24279/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1575-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, University of California School of Medicine, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201248" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholinesterase/metabolism ; Animals ; Brain/cytology/enzymology/*pathology ; Cell Survival ; DNA/genetics ; Fibroblasts/metabolism/*transplantation ; Genetic Vectors ; Histocytochemistry ; Moloney murine leukemia virus/genetics ; Nerve Growth Factors/genetics/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-06-03
    Description: The proto-oncogene c-fos is expressed in neurons in response to direct stimulation by growth factors and neurotransmitters. In order to determine whether the c-fos protein (Fos) and Fos-related proteins can be induced in response to polysynaptic activation, rat hindlimb motor/sensory cortex was stimulated electrically and Fos expression examined immunohistochemically. Three hours after the onset of stimulation, focal nuclear Fos staining was seen in motor and sensory thalamus, pontine nuclei, globus pallidus, and cerebellum. Moreover, 24-hour water deprivation resulted in Fos expression in paraventricular and supraoptic nuclei. Fos immunohistochemistry therefore provides a cellular method to label polysynaptically activated neurons and thereby map functional pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagar, S M -- Sharp, F R -- Curran, T -- EY05721/EY/NEI NIH HHS/ -- NS24666/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 3;240(4857):1328-31.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of California, San Francisco.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3131879" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/*metabolism ; Cell Nucleus/metabolism ; Cerebellum/metabolism ; Cerebral Cortex/metabolism ; Electric Stimulation ; *Gene Expression Regulation ; Globus Pallidus/metabolism ; Hippocampus/metabolism ; Hypothalamus/metabolism ; Immunohistochemistry ; Motor Cortex/physiology ; Neurons/metabolism ; Pons/metabolism ; Proto-Oncogene Proteins/*genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Thalamus/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-01-01
    Description: Strong steric interactions among proteins on crowded living cell surfaces were revealed by measurements of the equilibrium spatial distributions of proteins in applied potential gradients. The fraction of accessible surface occupied by mobile surface proteins can be accurately represented by including steric exclusion in the statistical thermodynamic analysis of the data. The analyses revealed enhanced, concentration-dependent activity coefficients, implying unanticipated thermodynamic activity even at typical cell surface receptor concentrations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ryan, T A -- Myers, J -- Holowka, D -- Baird, B -- Webb, W W -- AI18306/AI/NIAID NIH HHS/ -- AI22449/AI/NIAID NIH HHS/ -- GM33028/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jan 1;239(4835):61-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physics, Cornell University, Ithaca, NY 14853.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2962287" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Membrane/*physiology ; *Membrane Fluidity ; Membrane Proteins/*physiology ; Rats ; Receptors, Fc/physiology ; Receptors, IgE ; Thermodynamics ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-08-19
    Description: In mammalian cells, the glucocorticoid receptor binds specifically to glucocorticoid response element (GRE) DNA sequences and enhances transcription from linked promoters. It is shown here that derivatives of the glucocorticoid receptor also enhance transcription when expressed in yeast. Receptor-mediated enhancement in yeast was observed in fusions of GRE sequences to the yeast cytochrome c1 (CYC1) promoter; the CYC1 upstream activator sequences were not essential, since enhancement was observed in fusions of GREs to mutant CYC1 promoters retaining only the TATA region and transcription startpoints. It is concluded that the receptor operates by a common, highly conserved mechanism in yeast and mammalian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schena, M -- Yamamoto, K R -- CA20535-12/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Aug 19;241(4868):965-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3043665" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; DNA/metabolism ; *Enhancer Elements, Genetic ; Gene Expression Regulation ; Immunoassay ; Plasmids ; Promoter Regions, Genetic ; Rats ; Receptors, Glucocorticoid/*genetics ; Saccharomyces cerevisiae/*genetics ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-12-09
    Description: Cell types associated with angiotensinogen mRNA in rat brain were identified in individual brain sections by in situ hybridization with tritiated RNA probes or with a sulfur-35--labeled oligonucleotide combined with immunocytochemical detection of either glial fibrillary acidic protein (GFAP) for astrocytes or microtubule-associated protein (MAP-2) for neurons. Autoradiography revealed silver grains clustered primarily over GFAP-reactive soma and processes; most grain clusters were not associated with MAP-2--reactive cells. These results demonstrate that, in contrast to other known neuropeptide precursors, angiotensinogen is synthesized by glia.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stornetta, R L -- Hawelu-Johnson, C L -- Guyenet, P G -- Lynch, K R -- R01 HL33513/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1444-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201232" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensinogen/*biosynthesis/genetics ; Animals ; Astrocytes/*metabolism ; Brain/*metabolism ; Glial Fibrillary Acidic Protein/analysis ; Histocytochemistry ; Microtubule-Associated Proteins/analysis ; Nucleic Acid Hybridization ; RNA, Messenger/analysis/genetics ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    Publication Date: 1988-03-04
    Description: Abnormal functional activity induces long-lasting physiological alterations in neural pathways that may play a role in the development of epilepsy. The cellular mechanisms of these alterations are not well understood. One hypothesis is that abnormal activity causes structural reorganization of neural pathways and promotes epileptogenesis. This report provides morphological evidence that synchronous perforant path activation and kindling of limbic pathways induce axonal growth and synaptic reorganization in the hippocampus, in the absence of overt morphological damage. The results show a previously unrecognized anatomic plasticity associated with synchronous activity and development of epileptic seizures in neural pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sutula, T -- He, X X -- Cavazos, J -- Scott, G -- K07-NS00808/NS/NINDS NIH HHS/ -- R29-NS25020/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Mar 4;239(4844):1147-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of Wisconsin, Madison 53792.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2449733" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/ultrastructure ; Cytoplasmic Granules/ultrastructure ; Electric Stimulation ; Electrophysiology ; Hippocampus/physiopathology/*ultrastructure ; Histocytochemistry ; Kindling, Neurologic ; Microscopy, Electron ; Neural Pathways/ultrastructure ; Neurons/ultrastructure ; Rats ; Seizures/*pathology/physiopathology ; Staining and Labeling ; Synapses/*ultrastructure
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-11-18
    Description: A rat kidney messenger RNA that induces a slowly activating, voltage-dependent potassium current on its expression in Xenopus oocytes was identified by combining molecular cloning with an electrophysiological assay. The cloned complementary DNA encodes a novel membrane protein that consists of 130 amino acids with a single putative transmembrane domain. This protein differs from the known ion channel proteins but is involved in the induction of selective permeation of potassium ions by membrane depolarization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takumi, T -- Ohkubo, H -- Nakanishi, S -- New York, N.Y. -- Science. 1988 Nov 18;242(4881):1042-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Immunology, Kyoto University Faculty of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3194754" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cloning, Molecular ; DNA/genetics ; Electric Conductivity ; Membrane Potentials ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Molecular Weight ; Potassium Channels/*physiology ; Rats ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    Publication Date: 1988-07-15
    Description: Daily variation has been found in the length of the polyadenylate tail attached to vasopressin messenger RNA in the suprachiasmatic nuclei, which is the location of an endogenous circadian pacemaker in mammals. No such variation was found in the supraoptic or paraventricular nuclei. This variation in the length of the polyadenylate tail may underlie the circadian rhythm of vasopressin peptide levels in cerebrospinal fluid and is a unique example of a daily rhythm in messenger RNA structure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Robinson, B G -- Frim, D M -- Schwartz, W J -- Majzoub, J A -- 1P50HL36568/HL/NHLBI NIH HHS/ -- R01NS24542/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 15;241(4863):342-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388044" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arginine Vasopressin/*physiology ; Biological Clocks ; Circadian Rhythm ; Gene Expression Regulation ; Poly A/*physiology ; RNA, Messenger/*physiology ; Rats ; Suprachiasmatic Nucleus/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    Publication Date: 1988-06-17
    Description: A technique, in situ transcription, is described, in which reverse transcription of mRNAs is achieved within fixed tissue sections. An oligonucleotide complementary to proopiomelanocortin (POMC) mRNA was used as a primer for the specific synthesis of radiolabeled POMC cDNA in fixed sections of rat pituitary, thus permitting the rapid anatomical localization of POMC mRNA by autoradiography. Intermediate lobe signal intensities were sensitive to dopaminergic drugs, demonstrating that the method can be used for studies of mRNA regulation. The transcripts may also be eluted from tissue sections for a variety of uses, including the identification and cloning of autoradiographically localized cDNAs from small amounts of tissue.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tecott, L H -- Barchas, J D -- Eberwine, J H -- DA-05010/DA/NIDA NIH HHS/ -- MH-23861/MH/NIMH NIH HHS/ -- MH09099/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1661-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Nancy Pritzker Laboratory of Behavioral Neurochemistry, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2454508" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/*biosynthesis ; Deoxycytidine/metabolism ; Electrophoresis, Polyacrylamide Gel ; Nucleic Acid Denaturation ; Nucleic Acid Hybridization ; Oligonucleotides/genetics ; Pituitary Gland/*metabolism ; Pro-Opiomelanocortin/*genetics ; RNA, Messenger/*metabolism ; RNA-Directed DNA Polymerase/metabolism ; Rats ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    Publication Date: 1988-09-23
    Description: The imaging of phosphorescence provides a method for monitoring oxygen distribution within the vascular system of intact tissues. Isolated rat lives were perfused through the portal vein with media containing palladium coproporphyrin, which phosphoresced and was used to image the liver at various perfusion rates. Because oxygen is a powerful quenching agent for phosphors, the transition from well-perfused liver to anoxia (no flow of oxygen) resulted in large increases of phosphorescence. During stepwise restoration of oxygen flow, the phosphorescence images showed marked heterogeneous patterns of tissue reoxygenation, which indicated that there were regional inequalities in oxygen delivery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rumsey, W L -- Vanderkooi, J M -- Wilson, D F -- GM 21524/GM/NIGMS NIH HHS/ -- GM 36393/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1649-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of Pennsylvania School of Medicine, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3420417" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Coproporphyrins ; Liver Circulation ; *Luminescence ; Male ; Oxygen/*analysis ; Palladium ; Perfusion ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-09-02
    Description: When two different mammalian cell types are fused to generate a stable hybrid cell line, genes that are active in only one of the parents are frequently shut off, a phenomenon called extinction. In this study two distinct, complementary mechanisms for such extinction of growth hormone gene expression were identified. In hybrids formed by fusing fibroblasts to pituitary cells, pituitary-specific proteins that bind to the growth hormone promoter were absent. In addition, a negative regulatory element located near the rat growth hormone promoter was specifically activated.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tripputi, P -- Guerin, S L -- Moore, D D -- New York, N.Y. -- Science. 1988 Sep 2;241(4870):1205-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2842865" target="_blank"〉PubMed〈/a〉
    Keywords: Acetyltransferases/genetics ; Animals ; Avian Sarcoma Viruses/genetics ; Chloramphenicol O-Acetyltransferase ; Enhancer Elements, Genetic ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Growth Hormone/*genetics ; Herpesviridae/genetics ; Hybrid Cells/*metabolism ; Hypoxanthine Phosphoribosyltransferase/genetics ; L Cells (Cell Line) ; Mice ; Pituitary Gland/metabolism ; Plasmids ; Promoter Regions, Genetic ; Rats ; Thymidine Kinase/genetics ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    Publication Date: 1988-12-09
    Description: Potassium channels in neurons are linked by guanine nucleotide binding (G) proteins to numerous neurotransmitter receptors. The ability of Go, the predominant G protein in the brain, to stimulate potassium channels was tested in cell-free membrane patches of hippocampal pyramidal neurons. Four distinct types of potassium channels, which were otherwise quiescent, were activated by both isolated brain G0 and recombinant Go alpha. Hence brain Go can couple diverse brain potassium channels to neurotransmitter receptors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉VanDongen, A M -- Codina, J -- Olate, J -- Mattera, R -- Joho, R -- Birnbaumer, L -- Brown, A M -- DK-19318/DK/NIDDK NIH HHS/ -- HL-31154/HL/NHLBI NIH HHS/ -- HL-37044/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1433-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Molecular Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3144040" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Imidodiphosphate/pharmacology ; Animals ; Cattle ; Electric Conductivity ; GTP-Binding Proteins/*pharmacology ; Hippocampus/*physiology ; In Vitro Techniques ; Kinetics ; Macromolecular Substances ; Membrane Potentials/drug effects ; Potassium Channels/drug effects/*physiology ; Pyramidal Tracts/physiology ; Rats ; Recombinant Proteins/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    Publication Date: 1988-09-23
    Description: Antibodies directed against a conserved intracellular segment of the sodium channel alpha subunit slow the inactivation of sodium channels in rat muscle cells. Of four site-directed antibodies tested, only antibodies against the short intracellular segment between homologous transmembrane domains III and IV slowed inactivation, and their effects were blocked by the corresponding peptide antigen. No effects on the voltage dependence of sodium channel activation or of steady-state inactivation were observed, but the rate of onset of the antibody effect and the extent of slowing of inactivation were voltage-dependent. Antibody binding was more rapid at negative potentials, at which sodium channels are not inactivated; antibody-induced slowing of inactivation was greater during depolarizations to more positive membrane potentials. The peptide segment recognized by this antibody appears to participate directly in rapid sodium channel inactivation during large depolarizations and to undergo a conformational change that reduces its accessibility to antibodies as the channel inactivates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Vassilev, P M -- Scheuer, T -- Catterall, W A -- NS 15751/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Washington, School of Medicine, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2458625" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies ; Cytoplasm/analysis ; In Vitro Techniques ; Ion Channels/*metabolism ; Membrane Potentials ; Molecular Sequence Data ; Peptides/*metabolism ; Rats ; Sodium/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-06-17
    Description: Biochemical and electrophysiological studies suggest that adenosine 3',5'-monophosphate (cAMP)-dependent phosphorylation of the nicotinic acetylcholine receptor channel is functionally significant because it modifies the receptor's rate of desensitization to acetylcholine. In studies that support this conclusion researchers have used forskolin to stimulate cAMP-dependent phosphorylation in intact muscle. It is now shown that although forskolin facilitated desensitization in voltage-clamped rat muscle, this effect was not correlated with the abilities of forskolin and forskolin analogs to activate adenylate cyclase or phosphorylate the receptor. Furthermore, elevation of intracellular cAMP or addition of the catalytic subunit of A-kinase failed to alter desensitization. Therefore, in intact skeletal muscle, cAMP-dependent phosphorylation does not modulate desensitization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wagoner, P K -- Pallotta, B S -- GM32211/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1655-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Pharmacology, Glaxo Research Laboratories, Chapel Hill, NC 27599.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2454507" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-3-isobutylxanthine/pharmacology ; Acetylcholine/pharmacology ; Adenylyl Cyclases/metabolism ; Animals ; Bucladesine/pharmacology ; Colforsin/*pharmacology ; Cyclic AMP/analogs & derivatives/*pharmacology ; Electric Conductivity ; Enzyme Activation/drug effects ; Kinetics ; Muscles/*metabolism ; Phosphorylation ; Rats ; Receptors, Cholinergic/drug effects/*physiology ; Torpedo/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    Publication Date: 1988-04-15
    Description: A new type of agonist-binding subunit of rat neuronal nicotinic acetylcholine receptors (nAChRs) was identified. Rat genomic DNA and complementary DNA encoding this subunit (alpha 2) were cloned and analyzed. Complementary DNA expression studies in Xenopus oocytes revealed that the injection of messenger RNAs (mRNAs) for alpha 2 and beta 2 (a neuronal nAChR subunit) led to the generation of a functional nAChR. In contrast to the other known neuronal nAChRs, the receptor produced by the injection of alpha 2 and beta 2 mRNAs was resistant to the alpha-neurotoxin Bgt3.1. In situ hybridization histochemistry showed that alpha 2 mRNA was expressed in a small number of regions, in contrast to the wide distribution of the other known agonist-binding subunits (alpha 3 and alpha 4) mRNAs. These results demonstrate that the alpha 2 subunit differs from other known agonist-binding alpha-subunits of nAChRs in its distribution in the brain and in its pharmacology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wada, K -- Ballivet, M -- Boulter, J -- Connolly, J -- Wada, E -- Deneris, E S -- Swanson, L W -- Heinemann, S -- Patrick, J -- New York, N.Y. -- Science. 1988 Apr 15;240(4850):330-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Salk Institute for Biological Studies, San Diego, CA 92138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2832952" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Brain/*metabolism ; DNA Restriction Enzymes ; Female ; *Genes ; Molecular Sequence Data ; Neurons/metabolism ; Nucleotide Mapping ; Oocytes/metabolism ; Rats ; Receptors, Nicotinic/*genetics/metabolism ; Transcription, Genetic ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-09-09
    Description: The mammalian cerebral cortex is organized into columns of cells with common functional properties. During embryogenesis, cortical neurons are formed deep, near the lateral ventricles, and migrate radially to their final position. This observation led to the suggestion that the cortex consists of radial, ontogenetic units of clonally related neurons. In the experiments reported here, this hypothesis was tested by studying cell lineage in the rat cortex with a retroviral vector carrying the Escherichia coli beta-galactosidase gene, which can be easily visualized. Labeled, clonally related cortical neurons did not occur in simple columnar arrays. Instead, clonally related neurons entered several different radial columns, apparently by migrating along different radial glial fibers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Walsh, C -- Cepko, C L -- EY07331-01/EY/NEI NIH HHS/ -- R01 NS 23021-01/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1342-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3137660" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Movement ; Cerebral Cortex/cytology/*embryology ; Clone Cells ; Neuroglia/physiology ; Rats ; Transfection ; beta-Galactosidase/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-10-07
    Description: Behavioral studies have suggested that muscarinic cholinergic systems have an important role in learning and memory. A muscarinic cholinergic agonist is now shown to affect synaptic plasticity in the CA3 region of the hippocampal slice. Long-term potentiation (LTP) of the mossy fiber-CA3 synapse was blocked by muscarine. Low concentrations of muscarine (1 micromolar) had little effect on low-frequency (0.2 hertz) synaptic stimulation but did significantly reduce the magnitude and probability of induction of LTP. Experiments under voltage clamp showed that muscarine blocked the increase in excitatory synaptic conductance normally associated with LTP at this synapse. These results suggest a possible role for cholinergic systems in synaptic plasticity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Williams, S -- Johnston, D -- HL31164/HL/NHLBI NIH HHS/ -- NS11535/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Oct 7;242(4875):84-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2845578" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Electric Stimulation ; Evoked Potentials/drug effects ; Hippocampus/drug effects/*physiology ; In Vitro Techniques ; Muscarine/*pharmacology ; Neurons/drug effects/*physiology ; Pyramidal Tracts/drug effects/*physiology ; Rats ; Reference Values ; Synapses/physiology ; Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    Publication Date: 1989-05-19
    Description: In skeletal muscle, intramembrane charge movement initiates the processes that lead to the release of calcium from the sarcoplasmic reticulum. In cardiac muscle, in contrast, the similarity of the voltage dependence of developed tension and intracellular calcium transients to that of calcium current suggests that the calcium current may gate the release of calcium. Nevertheless, a mechanism similar to that of skeletal muscle continues to be postulated for cardiac muscle. By using rapid exchange (20 to 50 milliseconds) of the extracellular solutions in rat ventricular myocytes in which the intracellular calcium transients or cell shortening were measured, it has now been shown that the influx of calcium through the calcium channel is a mandatory link in the processes that couple membrane depolarization to the release of calcium. Thus, intramembrane charge movement does not contribute to the release of calcium in heart muscle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nabauer, M -- Callewaert, G -- Cleemann, L -- Morad, M -- R01-HL16152/HL/NHLBI NIH HHS/ -- R01-HL33720/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):800-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Pennsylvania, Department of Physiology, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543067" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Barium/metabolism/pharmacology ; Benzofurans ; Buffers ; Calcium/*metabolism ; Calcium Channels/*physiology ; Dialysis ; Egtazic Acid/pharmacology ; Extracellular Space/metabolism ; Fluorescent Dyes ; Fura-2 ; Heart/drug effects/*physiology ; Heart Ventricles ; Membrane Potentials ; Myocardial Contraction ; Rats ; Sarcoplasmic Reticulum/metabolism ; Sodium/metabolism ; Spectrometry, Fluorescence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    Publication Date: 1989-08-25
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Naftolin, F -- Andrade-Gordon, P -- Pellicer, A -- Palumbo, A -- Apa, R -- Zreik, T -- Yoon, T K -- DeCherney, A -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):870-1.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Obstetrics and Gynecology, Yale University, New Haven, CT 06510-8063.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772639" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Sarcosine-8-Isoleucine Angiotensin II/pharmacology ; Angiotensin II/*physiology ; Animals ; Chorionic Gonadotropin/pharmacology ; Female ; Gonadotropins, Equine/pharmacology ; *Ovulation ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/analysis ; Receptors, LH/analysis ; Saralasin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    Publication Date: 1989-10-13
    Description: Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein-negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Scharfman, H E -- Schwartzkroin, P A -- NS-01744/NS/NINDS NIH HHS/ -- NS-15317/NS/NINDS NIH HHS/ -- NS-18895/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):257-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2508225" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Calcium/*metabolism ; Calcium-Binding Proteins/metabolism ; Egtazic Acid/pharmacology ; Electric Stimulation ; Female ; Hippocampus/cytology/drug effects/*physiology ; In Vitro Techniques ; Neurons/drug effects/physiology ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    Publication Date: 1989-01-27
    Description: Adrenalectomy of adult male rats resulted in a nearly complete loss of hippocampal granule cells 3 to 4 months after surgery. Nissl and immunocytochemical staining of hippocampal neurons revealed that the granule cell loss was selective; there was no apparent loss of hippocampal pyramidal cells or of gamma-amino butyric acid (GABA)-, somatostatin-, neuropeptide Y-, calcium binding protein-, or parvalbumin-containing hippocampal interneurons. The hippocampal CA1 pyramidal cells of adrenalectomized animals exhibited normal electrophysiological responses to afferent stimulation, whereas responses evoked in the dentate gyrus were severely attenuated. Corticosterone replacement prevented both the adrenalectomy-induced granule cell loss and the attenuated physiological response. Thus, the adrenal glands play a role in maintaining the structural integrity of the normal adult brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sloviter, R S -- Valiquette, G -- Abrams, G M -- Ronk, E C -- Sollas, A L -- Paul, L A -- Neubort, S -- NS18201/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):535-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurology Research Center, Helen Hayes Hospital, New York State Department of Health, West Haverstraw 10993.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911756" target="_blank"〉PubMed〈/a〉
    Keywords: *Adrenalectomy ; Animals ; Annexin A6 ; Calcium-Binding Proteins/analysis ; Corticosterone/pharmacology ; Cytoplasmic Granules ; Electrophysiology ; Evoked Potentials ; Hippocampus/*cytology/drug effects/physiology ; Immunohistochemistry ; Male ; Neurons/cytology/physiology ; Potassium/blood ; Rats ; Sodium/blood ; Weight Gain
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    Publication Date: 1989-07-14
    Description: Vasodilators are used clinically for the treatment of hypertension and heart failure. The effects of some vasodilators seem to be mediated by membrane hyperpolarization. The molecular basis of this hyperpolarization has been investigated by examining the properties of single K+ channels in arterial smooth muscle cells. The presence of adenosine triphosphate (ATP)-sensitive K+ channels in these cells was demonstrated at the single channel level. These channels were opened by the hyperpolarizing vasodilator cromakalim and inhibited by the ATP-sensitive K+ channel blocker glibenclamide. Furthermore, in arterial rings the vasorelaxing actions of the drugs diazoxide, cromakalim, and pinacidil and the hyperpolarizing actions of vasoactive intestinal polypeptide and acetylcholine were blocked by inhibitors of the ATP-sensitive K+ channels, suggesting that all these agents may act through a common pathway in smooth muscle by opening ATP-sensitive K+ channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Standen, N B -- Quayle, J M -- Davies, N W -- Brayden, J E -- Huang, Y -- Nelson, M T -- HL 35911/HL/NHLBI NIH HHS/ -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):177-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Leicester, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501869" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholine/pharmacology ; Adenosine Triphosphate/*metabolism ; Animals ; Benzopyrans/antagonists & inhibitors/pharmacology ; Cerebral Arteries ; Cromakalim ; Diazoxide/pharmacology ; Glyburide/pharmacology ; Guanidines/pharmacology ; Mesenteric Arteries ; Muscle, Smooth, Vascular/*metabolism ; Pinacidil ; Potassium Channels/*drug effects/metabolism ; Pyrroles/antagonists & inhibitors/pharmacology ; Rabbits ; Rats ; Tolbutamide/pharmacology ; Vasoactive Intestinal Peptide/pharmacology ; Vasodilator Agents/antagonists & inhibitors/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    Publication Date: 1989-08-11
    Description: In an electrographic model of seizures in the hippocampal slice, both of the N-methyl-D-aspartate (NMDA) antagonists 2-amino-5-phosphonovaleric acid and 5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohepten-5,10-imine maleate (MK-801) prevented the progressive development of seizures but did not block previously induced seizures. Thus, a process dependent on the NMDA receptor-ionophore complex establishes a long-lasting, seizure-prone state; thereafter the seizures depend on non-NMDA receptor-ionophore mechanisms. This suggests that there is an important distinction between epileptogenesis and seizure expression and between antiepileptogenic and anticonvulsant pharmacological agents.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stasheff, S F -- Anderson, W W -- Clark, S -- Wilson, W A -- NS 17771/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):648-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Epilepsy Center, Veterans Administration Medical Center, Durham, NC 27705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569762" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate ; Animals ; Anticonvulsants/pharmacology ; Aspartic Acid/*analogs & derivatives/antagonists & inhibitors ; Dibenzocycloheptenes/pharmacology ; *Disease Models, Animal ; Dizocilpine Maleate ; Electric Stimulation ; Electrophysiology ; Epilepsy/*physiopathology ; Evoked Potentials ; Hippocampus/*physiopathology ; In Vitro Techniques ; N-Methylaspartate ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Seizures/*physiopathology ; Valine/analogs & derivatives/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    Publication Date: 1989-03-31
    Description: The discovery that the AP-1 family of enhancer binding factors includes a complex of the cellular Fos (cFos) and cellular Jun (cJun) proteins established a direct and important link between oncogenesis and transcriptional regulation. Homodimeric cJun protein synthesized in vitro is capable of binding selectively to AP-1 recognition sites, whereas the cFos polypeptide is not. When cotranslated, the cFos and cJun proteins can form a stable, heterodimeric complex with the DNA binding properties of AP-1/cJun. The related proteins Jun B and vJun are also able to form DNA binding complexes with cFos. Directed mutagenesis of the cFos protein reveals that a leucine repeat structure is required for binding to cJun, in a manner consistent with the proposed function of the "leucine zipper." A novel domain adjacent to, but distinct from, the leucine repeat of cFos is required for DNA binding by cFos-cJun heterodimers. Thus experimental evidence is presented that leucine repeats can mediate complex formation between heterologous proteins and that promotes further understanding of the molecular mechanisms underlying the function of two proto-oncogene products.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turner, R -- Tjian, R -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1689-94.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494701" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Chromatography, Affinity ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation ; Humans ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Oncogenes ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    Publication Date: 1989-06-02
    Description: Balanced translocations, each involving chromosome 17q11.2, have been described in two patients with von Recklinghausen neurofibromatosis (NF1). To better localize the end points of these translocation events, and the NF1 gene (NF1) itself, human cosmids were isolated and mapped in the immediate vicinity of NF1. One cosmid probe, c11-1F10, demonstrated that both translocation breakpoints, and presumably NF1, are contained within a 600-kilobase Nru I fragment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Connell, P -- Leach, R -- Cawthon, R M -- Culver, M -- Stevens, J -- Viskochil, D -- Fournier, R E -- Rich, D C -- Ledbetter, D H -- White, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1087-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of Utah, Salt Lake City 84132.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543077" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Mapping ; *Chromosomes, Human, Pair 17 ; Cosmids ; DNA Restriction Enzymes ; Deoxyribonucleases, Type II Site-Specific ; Electrophoresis ; Genetic Linkage ; Humans ; Hybrid Cells ; Neurofibromatosis 1/*genetics ; Rats ; *Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    Publication Date: 1989-03-31
    Description: The protein products of the fos and jun proto-oncogenes form a heterodimeric complex that participates in a stable high affinity interaction with DNA elements containing AP-1 binding sites. The effects of deletions and point mutations in Fos and Jun on protein complex formation and DNA binding have been examined. The data suggest that Fos and Jun dimerize via a parallel interaction of helical domains containing a heptad repeat of leucine residues (the leucine zipper). Dimerization is required for DNA binding and results in the appropriate juxtaposition of basic amino acid regions from Fos and Jun, both of which are required for association with DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gentz, R -- Rauscher, F J 3rd -- Abate, C -- Curran, T -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1695-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Oncology, Roche Institute of Molecular Biology, Nutley, NJ 07110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494702" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Cross-Linking Reagents ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Glutaral ; Immunosorbent Techniques ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Protein Conformation ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-07
    Description: The linker histones (H1, H5, H1 degrees) are involved in the condensation of chromatin into the 30-nanometer fiber. This supranucleosome organization correlates with the resting state of chromatin, and it is therefore possible that the linker histones play an active role in the control of chromatin activity. The effect of H5 has been directly determined by expression of an inducible transfected H5 gene in rat sarcoma cells, which do not produce H5. Transfection resulted in the reversible inhibition of DNA replication and arrest of cells in G1, at which time H5 concentrations approached that of terminally differentiated avian erythrocytes. The arrest of proliferation was accompanied by specific changes in gene expression probably related to the cell cycle block. The selectivity of these effects suggest that H5 plays an active role in the control of DNA replication and cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, J M -- Wiaderkiewicz, R -- Ruiz-Carrillo, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):68-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cancer Research Center, Laval University School of Medicine, L'Hotel-Dieu du Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740916" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Cycle ; Cell Division ; Cell Line ; Chickens ; DNA/*biosynthesis ; *DNA Replication ; Histones/genetics/*physiology ; Rats ; Receptors, Glucocorticoid/biosynthesis ; Recombinant Proteins/pharmacology ; Sarcoma, Experimental ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: The beta-amyloid protein is progressively deposited in Alzheimer's disease as vascular amyloid and as the amyloid cores of neuritic plaques. Contrary to its metabolically inert appearance, this peptide may have biological activity. To evaluate this possibility, a peptide ligand homologous to the first 28 residues of the beta-amyloid protein (beta 1-28) was tested in cultures of hippocampal pyramidal neurons for neurotrophic or neurotoxic effects. The beta 1-28 appeared to have neurotrophic activity because it enhanced neuronal survival under the culture conditions examined. This finding may help elucidate the sequence of events leading to plaque formation and neuronal damage in Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Whitson, J S -- Selkoe, D J -- Cotman, C W -- AG00538/AG/NIA NIH HHS/ -- AG07918/AG/NIA NIH HHS/ -- MH19691/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1488-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928783" target="_blank"〉PubMed〈/a〉
    Keywords: Amyloid/*pharmacology ; *Amyloid beta-Peptides ; *Amyloid beta-Protein Precursor ; Animals ; Cell Adhesion/drug effects ; Cell Survival ; Cells, Cultured ; Hippocampus/*cytology/embryology ; Neurons/cytology ; Peptide Fragments/*pharmacology ; Rats ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: Neural connections were established in cocultures of rat visual cortex (VC) and lateral geniculate nucleus (LGN), which were isolated in early infancy. Morphological and electrophysiological studies showed that the cortical laminar organization of afferent and efferent connections in the coculture preparations was similar to that in the adult VC. The results indicate the existence of intrinsic mechanisms in VC and LGN that guide the formation of synaptic connections with the appropriate targets.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamoto, N -- Kurotani, T -- Toyama, K -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):192-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Kyoto Prefectural School of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749258" target="_blank"〉PubMed〈/a〉
    Keywords: Afferent Pathways/physiology ; Animals ; Axons/physiology ; Culture Techniques ; Efferent Pathways/physiology ; Electrophysiology ; Geniculate Bodies/cytology/*physiology ; Organ Culture Techniques ; Rats ; Rats, Inbred Strains ; Synapses/physiology ; Visual Cortex/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: The periaqueductal gray matter of the mesencephalon (PAG) subserves a variety of diverse autonomic functions and also appears to be a site for opiate action in the induction of immunosuppression. Microinjections of morphine into the PAG, but not into other opiate receptor-containing neuroanatomical sites, result in a rapid suppression of natural killer (NK) cell activity. The NK cell suppression can be blocked by prior peripheral administration of the opiate antagonist naltrexone. These findings demonstrate that certain central actions of opiates that produce changes in NK cell function are mediated through opiate receptors in the PAG and identify a brain region involved in opiate regulation of immune function.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weber, R J -- Pert, A -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):188-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Medicinal Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749256" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immune Tolerance ; Killer Cells, Natural/drug effects/immunology ; Male ; Mesencephalon/drug effects/*immunology ; Microinjections ; Morphine/administration & dosage/antagonists & inhibitors/*pharmacology ; Naltrexone/pharmacology ; Rats ; Rats, Inbred F344
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    Publication Date: 1988-05-20
    Description: A central hypothesis in transplantation biology is that resident leukocytes expressing class II histocompatibility antigens may determine the immunogenicity of an organ. By means of a novel method to deplete the kidney of resident leukocytes, essential fatty acid deficiency (EFAD), this hypothesis was tested in an intact, vascular organ. Kidneys subjected to EFAD and thus depleted of resident Ia-positive macrophages survived and functioned when transplanted across a major histocompatibility antigen barrier in the absence of immunosuppression of the recipient. Control allografts were rejected promptly. Allografts from donors subjected to EFAD normalized their lipid composition and were repopulated with host macrophages by 5 days. Administration of Ia-positive cells at the time of transplantation established that the resident leukocyte depletion induced by EFAD was responsible for the protective effect. These observations may provide insights into the mechanisms underlying tissue immunogenicity and the population of normal tissues with resident leukocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schreiner, G F -- Flye, W -- Brunt, E -- Korber, K -- Lefkowith, J B -- New York, N.Y. -- Science. 1988 May 20;240(4855):1032-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3285468" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Fatty Acids, Essential/*physiology ; *Graft Rejection ; Kidney/physiology ; *Kidney Transplantation ; Liver/analysis ; Macrophages/physiology ; Phospholipids/analysis ; Rats ; Rats, Inbred BUF ; Rats, Inbred Lew ; Transplantation, Homologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    Publication Date: 1988-07-08
    Description: The amyloid beta protein peptide is a major constituent of amyloid plaque cores in Alzheimer's disease and is apparently derived from a higher molecular weight precursor. It is now shown that the core protein of a heparan sulfate proteoglycan secreted from a nerve cell line (PC12) has an amino acid sequence and a size very similar to those of the amyloid beta protein precursor and that these molecules are antigenically related. This amyloid beta protein precursor-related protein is not found in the conditioned medium of a variant cell line (F3 PC12) that does not secrete heparan sulfate proteoglycan. The synaptic localization and metabolism of this class of proteoglycans are consistent with its potential involvement in central nervous system dysfunction.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, D -- Schroeder, R -- LaCorbiere, M -- Saitoh, T -- Cole, G -- AG 05131/AG/NIA NIH HHS/ -- F2 AG 05424A/AG/NIA NIH HHS/ -- NS 09658/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 8;241(4862):223-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Salk Institute for Biological Studies, San Diego, CA 92138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2968652" target="_blank"〉PubMed〈/a〉
    Keywords: Alzheimer Disease/*metabolism ; Amino Acid Sequence ; Amyloid/*metabolism ; Amyloid beta-Peptides ; Animals ; Cell Line ; Chondroitin Sulfate Proteoglycans/*metabolism ; Chromatography, High Pressure Liquid ; Glycosaminoglycans/*metabolism ; Heparan Sulfate Proteoglycans ; Heparitin Sulfate/*metabolism ; Immunologic Techniques ; Peptide Fragments ; Proteoglycans/*metabolism ; Rats ; Viral Core Proteins/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    Publication Date: 1988-10-14
    Description: The signal sequence of simian virus 40 (SV40) large T-antigen for translocation into the nucleus is composed of positively charged amino acids Lys-Lys-Lys-Arg-Lys. Rabbit antibodies to a synthetic peptide containing the negatively charged amino acid sequence Asp-Asp-Asp-Glu-Asp were obtained. Indirect immunofluorescence of the antigens recognized by the antibody was punctate at the nuclear rim or the nuclear surface, depending on the plane of focus. The antibody blocked transport of nuclear proteins into the nucleus. The antigens recognized by the antibody were predominantly localized to the nuclear pores.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yoneda, Y -- Imamoto-Sonobe, N -- Matsuoka, Y -- Iwamoto, R -- Kiho, Y -- Uchida, T -- New York, N.Y. -- Science. 1988 Oct 14;242(4876):275-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3051382" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens/immunology ; Antigens, Polyomavirus Transforming ; Biological Transport ; Cell Line ; Cell Nucleus/*metabolism ; Fluorescent Antibody Technique ; Humans ; Molecular Sequence Data ; Nuclear Proteins/*metabolism ; Nucleoplasmins ; Oligopeptides/immunology/*physiology ; *Phosphoproteins ; Protein Sorting Signals/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Derome-Tremblay, M -- Nathan, C -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):991.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922597" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Fenfluramine/administration & dosage/therapeutic use/*toxicity ; Humans ; Obesity/drug therapy ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    Publication Date: 1989-01-13
    Description: A cellular sheath, the perineurium, forms a protective barrier around fascicles of nerve fibers throughout the peripheral nervous system. In a study to determine the cellular origin of perineurium, a culture system was used in which perineurium forms after purified populations of sensory neurons, Schwann cells, and fibroblasts are recombined. Before recombination, the Schwann cells or the fibroblasts were labeled by infection with a defective recombinant retrovirus whose gene product, beta-galactosidase, is histochemically detectable in the progeny of infected cells. Perineurial cells were labeled when fibroblasts had been infected but not when Schwann cells had been infected. Thus, perineurium arises from fibroblasts in vitro and, by implication, in vivo as well.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bunge, M B -- Wood, P M -- Tynan, L B -- Bates, M L -- Sanes, J R -- NS09923/NS/NINDS NIH HHS/ -- NS22828/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):229-31.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492115" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/ultrastructure ; Cell Transformation, Viral ; Cells, Cultured ; *Connective Tissue Cells ; Fetus ; Fibroblasts/*cytology ; Ganglia, Spinal/*cytology ; Genes ; Neurons/*cytology ; Rats ; Retroviridae/enzymology/*genetics ; Schwann Cells/cytology ; beta-Galactosidase/analysis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 82
    Publication Date: 1989-10-20
    Description: A 73-kilodalton (kD) intracellular protein was found to bind to peptide regions that target intracellular proteins for lysosomal degradation in response to serum withdrawal. This protein cross-reacted with a monoclonal antibody raised to a member of the 70-kD heat shock protein (hsp70) family, and sequences of two internal peptides of the 73-kD protein confirm that it is a member of this family. In response to serum withdrawal, the intracellular concentration of the 73-kD protein increased severalfold. In the presence of adenosine 5'-triphosphate (ATP) and MgCl2, the 73-kD protein enhanced protein degradation in two different cell-free assays for lysosomal proteolysis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chiang, H L -- Terlecky, S R -- Plant, C P -- Dice, J F -- AG06116/AG/NIA NIH HHS/ -- DK07542/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):382-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Tufts University School of Medicine, Boston, MA 02111.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799391" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Heat-Shock Proteins/genetics/*physiology ; Immunoblotting ; Lysosomes/*metabolism ; Molecular Sequence Data ; Rats ; Ribonuclease, Pancreatic/genetics/*metabolism ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 83
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-22
    Description: A plasma membrane form of guanylate cyclase is a cell surface receptor for atrial natriuretic peptide (ANP). In response to ANP binding, the receptor-enzyme produces increased amounts of the second messenger, guanosine 3',5'-monophosphate. Maximal activation of the cyclase requires the presence of adenosine 5'-triphosphate (ATP) or nonhydrolyzable ATP analogs. The intracellular region of the receptor contains at least two domains with homology to other proteins, one possessing sequence similarity to protein kinase catalytic domains, the other to regions of unknown function in a cytoplasmic form of guanylate cyclase and in adenylate cyclase. It is now shown that the protein kinase-like domain functions as a regulatory element and that the second domain possesses catalytic activity. When the kinase-like domain was removed by deletion mutagenesis, the resulting ANP receptor retained guanylate cyclase activity, but this activity was independent of ANP and its stimulation by ATP was markedly reduced. A model for signal transduction is suggested in which binding of ANP to the extracellular domain of its receptor initiates a conformational change in the protein kinase-like domain, resulting in derepression of guanylate cyclase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chinkers, M -- Garbers, D L -- GM31362/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1392-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2571188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Atrial Natriuretic Factor/*physiology ; Cyclic GMP/physiology ; DNA Mutational Analysis ; Guanylate Cyclase/metabolism ; Magnesium/physiology ; Protein Kinases/*physiology ; Rats ; Receptors, Atrial Natriuretic Factor ; Receptors, Cell Surface/*physiology/ultrastructure ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 84
    Publication Date: 1989-03-03
    Description: Gap junctions in the early amphibian embryo may play a fundamental role in the regulation of differentiation by mediating the cell-to-cell transfer of chemical signals. A complementary DNA encoding a gap junction present in Xenopus oocytes and early embryos has now been cloned and sequenced. This protein sequence is homologous to the well-characterized gap junction structural proteins rat connexin32 and connexin43. RNA blot analysis of total Xenopus oocyte RNA showed hybridization to a single 1.6-kilobase band. This messenger RNA is abundant in oocytes, decreases to levels below the sensitivity of our assay by stage 15 (18 hours), and is not detectable in RNA from a number of adult organs. To confirm that the oocyte cDNA encodes a gap junction channel, the protein was over expressed in Xenopus oocytes by injection of RNA synthesized in vitro. Pairs of RNA-injected oocytes formed many more time- and voltage-sensitive cell-cell channels than water-injected pairs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ebihara, L -- Beyer, E C -- Swenson, K I -- Paul, D L -- Goodenough, D A -- GM18974/GM/NIGMS NIH HHS/ -- GM37751/GM/NIGMS NIH HHS/ -- HL28958-06/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1194-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466337" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cell Communication ; *Cloning, Molecular ; Connexins ; DNA Probes ; Electric Conductivity ; Female ; Gene Expression Regulation ; Intercellular Junctions/physiology ; Membrane Proteins/*genetics/physiology ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oocytes/analysis/physiology ; RNA/analysis ; RNA, Messenger/analysis ; Rats ; Tissue Distribution ; Xenopus/*embryology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 85
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-08-12
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roof, D J -- Heth, C A -- EY05790/EY/NEI NIH HHS/ -- EY06514/EY/NEI NIH HHS/ -- New York, N.Y. -- Science. 1988 Aug 12;241(4867):845-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Berman-Gund Laboratory, Harvard Medical School, Massachusetts Eye and Ear Infirmary, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3136548" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Darkness ; GTP-Binding Proteins/*biosynthesis ; Light ; Membrane Proteins/*biosynthesis/isolation & purification ; Photoreceptor Cells/*metabolism ; Rats ; Rats, Inbred Strains ; Rod Cell Outer Segment/*metabolism/radiation effects ; Species Specificity ; Transducin
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 86
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-03
    Description: Calcium channels mediate the generation of action potentials, pacemaking, excitation-contraction coupling, and secretion and signal integration in muscle, secretory, and neuronal cells. The physiological regulation of the L-type calcium channel is thought to be mediated primarily by guanine nucleotide-binding proteins (G proteins). A low molecular weight endogenous peptide has been isolated and purified from rat brain. This peptide regulates up and down the cardiac and neuronal calcium channels, respectively. In cardiac myocytes, the peptide-induced enhancement of the L-type calcium current had a slow onset (half-time approximately 75 seconds), occurred via a G protein-independent mechanism, and could not be inhibited by alpha 1-adrenergic, beta-adrenergic, or angiotensin II blockers. In neuronal cells, on the other hand, the negative effect had a rapid onset (half-time less than 500 milliseconds) and was observed on both T-type and L-type calcium channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Callewaert, G -- Hanbauer, I -- Morad, M -- HL16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):663-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, School of Medicine, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536955" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/antagonists & inhibitors ; Animals ; Brain Chemistry ; Calcium Channels/drug effects/*physiology ; Cell Line ; Cell Membrane/metabolism ; Chromatography, High Pressure Liquid ; Electric Conductivity ; GTP-Binding Proteins/physiology ; Guinea Pigs ; Heart/*physiology ; Hippocampus/metabolism ; Mice ; Neuroblastoma ; Neurons/*physiology ; Nitrendipine/metabolism ; Peptide Fragments ; Peptides/isolation & purification/*pharmacology ; Rats ; Serine Endopeptidases/metabolism ; Sympatholytics/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 87
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: Exogenous cholecystokinin (CCK) decreases food intake and causes satiety in animals and man. However, it has not been established that endogenous CCK causes satiety or whether the response is mediated by peripheral-type (CCK-A) or brain-type (CCK-B) receptors. The development of potent and selective antagonists for CCK-A (MK-329) and CCK-B (L-365,260) receptors now allows these issues to be addressed. The CCK-A antagonist MK-329 and the CCK-B antagonist L-365,260 increased food intake in partially satiated rats and postponed the onset of satiety; however, L-365,260 was 100 times more potent than MK-329 in increasing feeding and preventing satiety. These results suggest that endogenous CCK causes satiety by an agonist action on CCK-B receptors in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dourish, C T -- Rycroft, W -- Iversen, S D -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1509-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Merck Sharp & Dohme Research Laboratories, Neuroscience Research Center, Terlings Park, Harlow, Essex, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781294" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Benzodiazepines/pharmacology ; Benzodiazepinones/pharmacology ; Brain/drug effects/*physiology ; Cholecystokinin/antagonists & inhibitors/*physiology ; Devazepide ; Male ; *Phenylurea Compounds ; Rats ; Rats, Inbred Strains ; Receptors, Cholecystokinin/drug effects/*physiology ; Satiation/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 88
    Publication Date: 1989-06-30
    Description: The mammalian hippocampal formation appears to play a major role in the generation of internal representations of spatial relationships. In rats, this role is reflected in the spatially selective discharge of hippocampal pyramidal cells. The principal metric for coding spatial relationships might be the organism's own movements in space, that is, the spatial relationship between two locations is coded in terms of the movements executed in getting from one to the other. Thus, information from the motor programming systems (or "motor set") may contribute to coding of spatial location by hippocampal neurons. Spatially selective discharge of hippocampal neurons was abolished under conditions of restraint in which the animal had learned that locomotion was impossible. Therefore, hippocampal neuronal activity may reflect the association of movements with their spatial consequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foster, T C -- Castro, C A -- McNaughton, B L -- NS20331/NS/NINDS NIH HHS/ -- T32-HD07288/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1580-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Colorado, Boulder 80303.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740902" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electroencephalography ; Electrophysiology ; Hippocampus/*physiology ; Motor Activity/*physiology ; Neurons/*physiology ; Rats ; Restraint, Physical ; Space Perception/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 89
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-18
    Description: Nerve growth factor (NGF) produced by telencephalic neurons provides critical trophic support for cholinergic neurons of the basal forebrain. In situ hybridization and nuclease protection analyses demonstrate that limbic seizures dramatically increase the amount of messenger RNA for NGF in the neurons of the hippocampal dentate gyrus within 1 hour of seizure onset and in broadly distributed neocortical and olfactory forebrain neurons some hours later. The increased messenger RNA species is indistinguishable from messenger RNA for transcript B of the beta subunit of NGF from mouse submandibular gland. Thus, the expression of a known growth factor is affected by unusual physiological activity, suggesting one route through which trophic interactions between neurons in adult brain can be modified.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gall, C M -- Isackson, P J -- NS00915/NS/NINDS NIH HHS/ -- NS24747/NS/NINDS NIH HHS/ -- NS26748/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):758-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Neurobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549634" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoradiography ; Endonucleases ; Gene Expression Regulation ; Guinea Pigs ; Hippocampus/physiopathology ; Limbic System/*physiopathology ; Mice ; Nerve Growth Factors/*genetics ; Neurons/*metabolism ; Nucleic Acid Hybridization ; RNA Probes ; RNA, Messenger/*biosynthesis ; Rats ; Seizures/*metabolism ; Single-Strand Specific DNA and RNA Endonucleases ; Telencephalon/metabolism ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 90
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gehlsen, K -- Engvall, E -- Dillner, L -- Ruoslahti, E -- Goodman, S -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):342-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526967" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Glioma ; Humans ; Isoenzymes/analysis ; Laminin/metabolism ; Rats ; Receptors, Immunologic/*analysis ; Receptors, Laminin ; *Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 91
    Publication Date: 1989-07-07
    Description: A prominent feature of diabetes mellitus is the inability of insulin to appropriately increase the transport of glucose into target tissues. The contributions of different glucose transport proteins to insulin resistance in rats with streptozotocin-induced diabetes was evaluated. A glucose transporter messenger RNA and its cognate protein that are exclusively expressed in muscle and adipose tissue were specifically depleted in diabetic animals, and these effects were reversed after insulin therapy; a different glucose transporter and its messenger RNA that exhibit a less restricted tissue distribution were not specifically modulated in this way. Depletion of the muscle- and adipose-specific glucose transporter species correlates with and may account for the major portion of cellular insulin resistance in diabetes in these animals.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Garvey, W T -- Huecksteadt, T P -- Birnbaum, M J -- DK 38765/DK/NIDDK NIH HHS/ -- DK 39519/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):60-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section of Endocrinology and Metabolism, VA Medical Center, Indianapolis, IN.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2662408" target="_blank"〉PubMed〈/a〉
    Keywords: 3-O-Methylglucose ; Adipose Tissue/metabolism ; Animals ; Blood Glucose/metabolism ; Brain/metabolism ; Diabetes Mellitus, Experimental/drug therapy/*metabolism ; Insulin/*therapeutic use ; Male ; Methylglucosides/metabolism ; Monosaccharide Transport Proteins/*biosynthesis/genetics ; Muscles/metabolism ; Organ Specificity ; RNA, Messenger/genetics ; Rats ; Rats, Inbred Strains ; Reference Values ; *Suppression, Genetic ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 92
    Publication Date: 1989-05-19
    Description: Brain injury induced by fluid percussion in rats caused a marked elevation in extracellular glutamate and aspartate adjacent to the trauma site. This increase in excitatory amino acids was related to the severity of the injury and was associated with a reduction in cellular bioenergetic state and intracellular free magnesium. Treatment with the noncompetitive N-methyl-D-aspartate (NMDA) antagonist dextrophan or the competitive antagonist 3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid limited the resultant neurological dysfunction; dextrorphan treatment also improved the bioenergetic state after trauma and increased the intracellular free magnesium. Thus, excitatory amino acids contribute to delayed tissue damage after brain trauma; NMDA antagonists may be of benefit in treating acute head injury.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Faden, A I -- Demediuk, P -- Panter, S S -- Vink, R -- New York, N.Y. -- Science. 1989 May 19;244(4906):798-800.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of California, San Francisco.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2567056" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/analogs & derivatives/antagonists & inhibitors/*metabolism ; Binding, Competitive ; Brain/drug effects/metabolism ; Brain Injuries/drug therapy/*metabolism ; Dextrorphan/pharmacology/therapeutic use ; Glutamates/*metabolism ; Glutamic Acid ; Magnesium/metabolism ; Magnetic Resonance Spectroscopy ; Male ; N-Methylaspartate ; Phosphates/metabolism ; Phosphocreatine/metabolism ; Piperazines/pharmacology/therapeutic use ; Rats ; Rats, Inbred Strains ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/drug effects/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 93
    Publication Date: 1988-04-22
    Description: These studies were set up to determine whether those oncogenes participating in the initiation of mammary carcinogenesis (for example, ras oncogenes) play a direct role in the outcome of events associated with the late stages of tumor development such as loss of hormone dependency. Mammary carcinomas induced by a single carcinogenic insult in pubescent rats was selected as an in vivo model system with direct relevance to human breast cancer. Acquisition of hormone-independent growth in these carcinogen-induced tumors was found to be independent of the activation of ras oncogenes during the early stages of carcinogenesis. In agreement with these observations, introduction of a human ras oncogene into human MCF-7 breast carcinoma cells did not abrogate their hormonal dependency for growth in vivo. These findings suggest that those events responsible for the critical stages of breast cancer development occur independently and in an uncoordinated manner.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sukumar, S -- Carney, W P -- Barbacid, M -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Apr 22;240(4851):524-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Developmental Oncology Section, Basic Research Program, Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3282307" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Breast Neoplasms/*physiopathology ; Cell Line ; Estrogens/*physiology ; Gene Expression Regulation ; *Genes, ras ; Humans ; Mammary Neoplasms, Experimental/*physiopathology ; Methylnitrosourea ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Rats ; Receptors, Estrogen/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 94
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-08-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1988 Aug 19;241(4868):903-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3043664" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/*metabolism ; Female ; Humans ; Male ; Menopause/*physiology ; Mice ; Pituitary Hormone-Releasing Hormones/*biosynthesis ; Puberty/*physiology ; Rats ; Sexual Maturation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 95
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-09-09
    Description: A karyotypic analysis was performed on seven independently derived clones of primary rat embryo cells transformed by the ras oncogene plus the cooperating oncogene myc. The transfected oncogenes were sometimes present in amplified copy number, with heterogeneity in the levels of amplification. Some chromosomal features, such as aberrantly banding regions and double-minute chromosomes, typical of cells carrying amplified genes, were also seen in three of the seven cell lines. Underlying this heterogeneity there was an unexpected finding. All seven lines showed a common integration site for ras on the q arm of rat chromosome 3 (3q12), though some lines also had other sites of integration. In four of the lines integration of ras was accompanied by deletion of the p arm of chromosome 3 or its possible translocation to chromosome 12.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKenna, W G -- Nakahara, K -- Muschel, R J -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1325-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiation Oncology, University of Pennsylvania School of Medicine, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3045971" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chromosome Mapping ; Gene Amplification ; *Genes, ras ; Oncogenes ; Rats ; Recombination, Genetic ; Transformation, Genetic ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 96
    Publication Date: 1988-10-14
    Description: Suspensions of thymocytes from young rats were incubated with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which resulted in a sustained increase in cytosolic free Ca2+ concentration followed by DNA fragmentation and loss of cell viability. Both the Ca2+ increase and DNA fragmentation were prevented in cells treated with the inhibitor of protein synthesis, cycloheximide, and DNA fragmentation and cell killing were not detected when cells were incubated in a "Ca2+-free" medium or pretreated with high concentrations of the calcium probe, quin-2 tetraacetoxymethyl ester. These results indicate that TCDD can kill immature thymocytes by initiating a suicide process similar to that previously described for glucocorticoid hormones.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McConkey, D J -- Hartzell, P -- Duddy, S K -- Hakansson, H -- Orrenius, S -- New York, N.Y. -- Science. 1988 Oct 14;242(4876):256-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Toxicology, Karolinska Institutet, Stockholm, Sweden.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3262923" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines ; Animals ; Calcium/metabolism/*pharmacology ; Cell Survival/drug effects ; Cycloheximide/pharmacology ; Cytosol/metabolism ; DNA/metabolism ; Deoxyribonuclease I/*metabolism ; Dioxins/*pharmacology ; Enzyme Activation/drug effects ; Fluorescent Dyes ; Glucocorticoids/pharmacology ; Kinetics ; Rats ; T-Lymphocytes/drug effects ; Tetrachlorodibenzodioxin/*pharmacology ; Thymus Gland/*drug effects/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 97
    Publication Date: 1988-02-12
    Description: In rats, an environmental manipulation occurring early in life resulted in changes in the adrenocortical axis that persisted throughout the entire life of the animals and attenuated certain deficits associated with aging. Rats handled during infancy had a permanent increase in concentrations of receptors for glucocorticoids in the hippocampus, a critical region in the negative-feedback inhibition of adrenocortical activity. Increased receptor concentrations led to greater hippocampal sensitivity to glucocorticoids and enhanced negative-feedback efficacy in the handled rats. Thus, at all ages tested, rats that were not handled secreted more glucocorticoids in response to stress than did handled rats. At later ages, nonhandled rats also showed elevated basal glucocorticoid levels, with the result that there was a greater cumulative exposure to glucocorticoids in nonhandled rats. Increased exposure to adrenal glucocorticoids can accelerate hippocampal neuron loss and cognitive impairments in aging. Hippocampal cell loss and pronounced spatial memory deficits emerged with age in the nonhandled rats, but were almost absent in the handled rats. Previous work showed that glucocorticoid hypersecretion, hippocampal neuron death, and cognitive impairments form a complex degenerative cascade of aging in the rat. The present study shows that a subtle manipulation early in life can retard the emergence of this cascade.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Meaney, M J -- Aitken, D H -- van Berkel, C -- Bhatnagar, S -- Sapolsky, R M -- AG-06633/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1988 Feb 12;239(4841 Pt 1):766-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Faculty of Medicine, McGill University, Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3340858" target="_blank"〉PubMed〈/a〉
    Keywords: Aging ; Animals ; Animals, Newborn ; Dexamethasone/metabolism ; *Handling (Psychology) ; Hippocampus/*growth & development/physiology/physiopathology ; Learning ; Memory ; Rats ; Receptors, Glucocorticoid/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 98
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-04-29
    Description: The kinetics of calcium release by inositol 1,4,5-trisphosphate (IP3) in permeabilized rat basophilic leukemia cells were studied to obtain insight into the molecular mechanism of action of this intracellular messenger of the phosphoinositide cascade. Calcium release from intracellular storage sites was monitored with fura-2, a fluorescent indicator. The dependence of the rate of calcium release on the concentration of added IP3 in the 4 to 40 nM range showed that channel opening requires the binding of at least three molecules of IP3. Channel opening occurred in the absence of added adenosine triphosphate, indicating that IP3 acts directly on the channel or on a protein that gates it. The channels were opened by IP3 in less than 4 seconds. The highly cooperative opening of calcium channels by nanomolar concentrations of IP3 enables cells to detect and amplify very small changes in the concentration of this messenger in response to hormonal, sensory, and growth control stimuli.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Meyer, T -- Holowka, D -- Stryer, L -- AI22449/AI/NIAID NIH HHS/ -- GM24032/GM/NIGMS NIH HHS/ -- GM30387/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Apr 29;240(4852):653-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Sherman Fairchild Center, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2452482" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Basophils ; Benzofurans ; Calcimycin/pharmacology ; Calcium/*metabolism ; Cell Membrane Permeability ; Cytoplasm/metabolism ; Fluorescent Dyes ; Fura-2 ; Inositol 1,4,5-Trisphosphate ; Inositol Phosphates/metabolism/*pharmacology ; Ion Channels/drug effects/*metabolism ; Kinetics ; Leukemia, Experimental/metabolism ; Rats ; Spectrometry, Fluorescence ; Sugar Phosphates/*pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 99
    Publication Date: 1988-06-17
    Description: The specificity of complex formation between cytochrome b5 (cyt b5) and cytochrome c (cyt c) is believed to involve the formation of salt linkages between specific carboxylic acid residues of cyt b5 with lysine residues on cyt c. Site-directed mutagenesis was used to alter the specified acidic residues of cyt b5 to the corresponding amide analogues, which resulted in a lower affinity for complex formation with cyt c. The dissociation of the complex under high pressure resulted in specific volume changes, the magnitude of which reflected the degree of solvation of the acidic residues in the proposed protein-protein interface.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rodgers, K K -- Pochapsky, T C -- Sligar, S G -- GM 31756/GM/NIGMS NIH HHS/ -- GM 33775/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1657-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Illinois, Urbana 61801.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2837825" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cytochrome b Group/genetics/*metabolism ; Cytochrome c Group/*metabolism ; Cytochromes b5 ; Hydrogen Bonding ; Hydrogen-Ion Concentration ; Hydrostatic Pressure ; Macromolecular Substances ; Mutation ; Protein Conformation ; Rats ; Solubility ; Thermodynamics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 100
    Publication Date: 1988-10-14
    Description: A survey of rat tissues by RNA analysis, aimed at uncovering the physiological function of the parathyroid hormone-like peptide (PTH-LP) associated with hypercalcemia of malignancy, revealed the presence of a 1.5-kilobase messenger RNA encoding this peptide in lactating mammary glands. PTH-LP messenger RNA is expressed in mammary tissue only during lactation; it appears and disappears rapidly (2 to 4 hours) as a function of the sucking stimulus. The identity of this messenger RNA was confirmed by cloning the rat PTH-LP complementary DNA, which predicts a peptide with strong similarity to the human homolog. Moreover, extracts from lactating mammary tissue stimulated parathyroid hormone-dependent adenylate cyclase. These findings suggest that PTH-LP plays a physiological role in lactation, possibly as a hormone for the mobilization or transfer (or both) of calcium to the milk.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Thiede, M A -- Rodan, G A -- New York, N.Y. -- Science. 1988 Oct 14;242(4876):278-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Bone Biology and Osteoporosis Research, Merck Sharp & Dohme Research Laboratories, West Point, PA 19486.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3175653" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Calcium/*metabolism ; Cloning, Molecular ; DNA/genetics ; Female ; *Gene Expression Regulation ; Humans ; Lactation/*metabolism ; Mammary Glands, Animal/*metabolism ; Molecular Sequence Data ; Neoplasm Proteins/*genetics/physiology ; Parathyroid Hormone-Related Protein ; Pregnancy ; RNA, Messenger/genetics/*metabolism ; Rats ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...