ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (426)
  • Binding Sites
  • American Association for the Advancement of Science (AAAS)  (517)
  • American Chemical Society (ACS)
  • MDPI AG
  • PANGAEA
  • 1985-1989  (517)
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (517)
  • American Chemical Society (ACS)
  • MDPI AG
  • PANGAEA
  • Springer  (3)
Years
Year
  • 1
    facet.materialart.
    Unknown
    Specific recognition of cruciform DNA by nuclear protein HMG1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Expression of functional nerve growth factor receptors after gene transfer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Indole-2-carboxylic acid: a competitive antagonist of potentiation by glycine at the NMDA receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Effects of glucocorticoids and norepinephrine on the excitability in the hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Fibroblasts transformed with v-src show enhanced formation of an inositol tetrakisphosphate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Golf: an olfactory neuron specific-G protein involved in odorant signal transduction (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    Increased expression of DNA cointroduced with nuclear protein in adult rat liver (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    Corticosteroid modulation of hippocampal potentials: increased effect with aging (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    Potassium channels in cardiac cells activated by arachidonic acid and phospholipids (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    Triggering of allostery in an enzyme by a point mutation: ornithine transcarbamoylase (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The origin of allostery is an unanswered question in the evolution of complex regulatory proteins. Anabolic ornithine transcarbamoylase, a trimer of identical subunits, is not an allosteric enzyme per se. However, when the active-site residue arginine-106 of the Escherichia coli enzyme is replaced with a glycine through site-directed mutagenesis, the resultant mutant enzyme manifests substrate cooperativity that is absent in the wild-type enzyme. Both homotropic and heterotropic interactions occur in the mutant enzyme. The initial velocity saturation curves of the substrates, carbamoyl phosphate and L-ornithine, conform to the Hill equation. The observed cooperativity depends on substrate but not enzyme concentration. The finding underscores the possibility that a single mutation of the enzyme in the cell could turn transcarbamoylation into a regulatory junction in the biosynthesis of L-arginine and urea.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kuo, L C -- Zambidis, I -- Caron, C -- DK01721/DK/NIDDK NIH HHS/ -- DK38089/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):522-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry, Metcalf Center for Science and Engineering, Boston University, MA 02215.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2667139" target="_blank"〉PubMed〈/a〉
    Keywords: Allosteric Regulation ; Binding Sites ; Carbamyl Phosphate/metabolism ; Escherichia coli/*enzymology ; Glycine ; Kinetics ; Macromolecular Substances ; *Mutation ; Ornithine/metabolism ; Ornithine Carbamoyltransferase/*genetics/metabolism ; Structure-Activity Relationship ; Zinc/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 11
    facet.materialart.
    Unknown
    The MHC-binding and gp120-binding functions of CD4 are separable (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-18
    Description: CD4 is a cell surface glycoprotein that is thought to interact with nonpolymorphic determinants of class II major histocompatibility (MHC) molecules. CD4 is also the receptor for the human immunodeficiency virus (HIV), binding with high affinity to the HIV-1 envelope glycoprotein, gp120. Homolog-scanning mutagenesis was used to identify CD4 regions that are important in class II MHC binding and to determine whether the gp120 and class II MHC binding sites of CD4 are related. Class II MHC binding was abolished by mutations in each of the first three immunoglobulin-like domains of CD4. The gp120 binding could be abolished without affecting class II MHC binding and vice versa, although at least one mutation examined reduced both functions significantly. These findings indicate that, while there may be overlap between the gp120 and class II MHC binding sites of CD4, these sites are distinct and can be separated. Thus it should be possible to design CD4 analogs that can block HIV infectivity but intrinsically lack the ability to affect the normal immune response by binding to class II MHC molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lamarre, D -- Ashkenazi, A -- Fleury, S -- Smith, D H -- Sekaly, R P -- Capon, D J -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):743-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549633" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, Surface ; Binding Sites ; DNA, Recombinant ; HIV/*metabolism ; HIV Envelope Protein gp120 ; HLA-DP Antigens/immunology ; Histocompatibility Antigens Class II/*immunology ; Humans ; Hybridomas ; Mice ; Molecular Sequence Data ; Mutation ; Receptors, HIV ; Receptors, Virus/genetics/immunology/*metabolism ; Retroviridae Proteins/immunology/*metabolism ; Rosette Formation ; Structure-Activity Relationship ; T-Lymphocytes/immunology/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 12
    facet.materialart.
    Unknown
    The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 13
    facet.materialart.
    Unknown
    The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 14
    facet.materialart.
    Unknown
    Defining the inside and outside of a catalytic RNA molecule (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-21
    Description: Ribozymes are RNA molecules that catalyze biochemical reactions. Fe(II)-EDTA, a solvent-based reagent which cleaves both double- and single-stranded RNA, was used to investigate the structure of the Tetrahymena ribozyme. Regions of cleavage alternate with regions of substantial protection along the entire RNA molecule. In particular, most of the catalytic core shows greatly reduced cleavage. These data constitute experimental evidence that an RNA enzyme, like a protein enzyme, has an interior and an exterior. Determination of positions where the phosphodiester backbone of the RNA is on the inside or on the outside of the molecule provides major constraints for modeling the three-dimensional structure of the Tetrahymena ribozyme. This approach should be generally informative for structured RNA molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Latham, J A -- Cech, T R -- GM 11227-03/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):276-82.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309-0215.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501870" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoradiography ; Base Sequence ; Binding Sites ; Crystallography ; Edetic Acid ; Electrophoresis, Polyacrylamide Gel ; Ferrous Compounds ; Molecular Sequence Data ; Molecular Structure ; *Nucleic Acid Conformation ; *RNA Splicing ; RNA, Catalytic ; RNA, Fungal/analysis ; *RNA, Ribosomal/analysis/metabolism ; RNA, Transfer, Phe/analysis ; Tetrahymena/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 15
    facet.materialart.
    Unknown
    Three-dimensional solution structure of a single zinc finger DNA-binding domain (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: The three-dimensional solution structure of a zinc finger nucleic acid binding motif has been determined by nuclear magnetic resonance (NMR) spectroscopy. Spectra of a synthetic peptide corresponding to a single zinc finger from the Xenopus protein Xfin yielded distance and dihedral angle constraints that were used to generate structures from distance geometry and restrained molecular dynamics calculations. The zinc finger is an independently folded domain with a compact globular structure in which the zinc atom is bound by two cysteine and two histidine ligands. The polypeptide backbone fold consists of a well-defined helix, starting as alpha and ending as 3(10) helix, packed against two beta strands that are arranged in a hairpin structure. A high density of basic and polar amino acid side chains on the exposed face of the helix are probably involved in DNA binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, M S -- Gippert, G P -- Soman, K V -- Case, D A -- Wright, P E -- GM 36643/GM/NIGMS NIH HHS/ -- GM38794/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):635-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2503871" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Cysteine/metabolism ; DNA/*metabolism ; DNA-Binding Proteins/*metabolism ; Histidine/metabolism ; Hydrogen Bonding ; Magnetic Resonance Spectroscopy ; Metalloproteins/*metabolism ; Molecular Sequence Data ; Molecular Structure ; Protein Conformation ; Solutions ; Thermodynamics ; Xenopus ; Zinc/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 16
    facet.materialart.
    Unknown
    Secretion of activin by interstitial cells in the testis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 17
    facet.materialart.
    Unknown
    Atrial natriuretic peptide inhibits a cation channel in renal inner medullary collecting duct cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 18
    facet.materialart.
    Unknown
    Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 19
    facet.materialart.
    Unknown
    Specific block of calcium channel expression by a fragment of dihydropyridine receptor cDNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 20
    facet.materialart.
    Unknown
    Pavlovian conditioning of rat mucosal mast cells to secrete rat mast cell protease II (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 21
    facet.materialart.
    Unknown
    Relation of the amyloid beta protein precursor to heparan sulfate proteoglycans (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 22
    facet.materialart.
    Unknown
    Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 23
    facet.materialart.
    Unknown
    A pertussis toxin-sensitive G protein in hippocampal long-term potentiation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 24
    facet.materialart.
    Unknown
    Quisqualate activates a rapidly inactivating high conductance ionic channel in hippocampal neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 25
    facet.materialart.
    Unknown
    Beta-adrenergic inhibition of cardiac sodium channels by dual G-protein pathways (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 26
    facet.materialart.
    Unknown
    Brain region and gene specificity of neuropeptide gene expression in cultured astrocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 27
    facet.materialart.
    Unknown
    Inescapable versus escapable shock modulates long-term potentiation in the rat hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 28
    facet.materialart.
    Unknown
    Mouse lymph node homing receptor cDNA clone encodes a glycoprotein revealing tandem interaction domains (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-03
    Description: Isolation of a clone encoding the mouse lymph node homing receptor reveals a deduced protein with an unusual protein mosaic architecture, containing a separate carbohydrate-binding (lectin) domain, an epidermal growth factor-like (EGF) domain, and an extracellular precisely duplicated repeat unit, which preserves the motif seen in the homologous repeat structure of complement regulatory proteins and other proteins. The receptor molecule is potentially highly glycosylated, and contains an apparent transmembrane region. Analysis of messenger RNA transcripts reveals a predominantly lymphoid distribution in direct relation to the cell surface expression of the MEL-14 determinant, and the cDNA clone is shown to confer the MEL-14 epitope in heterologous cells. The many novel features, including ubiquitination, embodied in this single receptor molecule form the basis for numerous approaches to the study of cell-cell interactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siegelman, M H -- van de Rijn, M -- Weissman, I L -- AI09022/AI/NIAID NIH HHS/ -- OIG43551/PHS HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1165-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646713" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Base Sequence ; Binding Sites ; Carbohydrate Metabolism ; Cell Membrane/metabolism ; DNA/*genetics ; Epidermal Growth Factor ; Glycosylation ; Lymph Nodes/*metabolism ; Membrane Glycoproteins/*genetics ; Mice ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; Receptors, Lymphocyte Homing ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 29
    facet.materialart.
    Unknown
    Transneuronal transfer of herpes virus from peripheral nerves to cortex and brainstem (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 30
    facet.materialart.
    Unknown
    Structural origins of high-affinity biotin binding to streptavidin (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: The high affinity of the noncovalent interaction between biotin and streptavidin forms the basis for many diagnostic assays that require the formation of an irreversible and specific linkage between biological macromolecules. Comparison of the refined crystal structures of apo and a streptavidin:biotin complex shows that the high affinity results from several factors. These factors include the formation of multiple hydrogen bonds and van der Waals interactions between biotin and the protein, together with the ordering of surface polypeptide loops that bury the biotin in the protein interior. Structural alterations at the biotin binding site produce quaternary changes in the streptavidin tetramer. These changes apparently propagate through cooperative deformations in the twisted beta sheets that link tetramer subunits.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weber, P C -- Ohlendorf, D H -- Wendoloski, J J -- Salemme, F R -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):85-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Central Research & Development Department, E. I. du Pont de Neumours and Company, Inc., Wilmington, DE 19880-0228.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911722" target="_blank"〉PubMed〈/a〉
    Keywords: Bacterial Proteins/*metabolism ; Binding Sites ; Biotin/*metabolism ; Macromolecular Substances ; Models, Molecular ; Protein Conformation ; Streptavidin ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 31
    facet.materialart.
    Unknown
    The role of cis-acting promoter elements in tissue-specific albumin gene expression (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: The mouse albumin gene promoter has six closely spaced binding sites for nuclear proteins that are located between the TATA motif and nucleotide position -170. In vitro transcription with liver or spleen nuclear extracts of templates containing either mutated or polymerized albumin promoter elements establishes a hierarchy of the different protein binding sites for tissue-specific albumin gene transcription. The HNF-1 and C/EBP binding sites strongly activate transcription in a tissue-specific manner. The NF-Y binding site has a lower activation potential and is less specific, being equally efficient in liver and spleen nuclear extracts. The remaining elements are relatively weak activator sites.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Maire, P -- Wuarin, J -- Schibler, U -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):343-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departement de Biologie Moleculaire, Sciences II, Geneva, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2711183" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Carrier Proteins/metabolism/pharmacology ; Cell Nucleus/metabolism ; DNA-Binding Proteins/*metabolism ; Dicarboxylic Acid Transporters ; *Gene Expression Regulation/drug effects ; Liver/metabolism/ultrastructure ; Mice ; Nuclear Proteins/metabolism/pharmacology ; *Promoter Regions, Genetic ; Serum Albumin/*genetics ; Spleen/metabolism/ultrastructure ; Templates, Genetic ; Transcription Factors ; Transcription, Genetic/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 32
    facet.materialart.
    Unknown
    In vitro transcription enhancement by purified derivatives of the glucocorticoid receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 33
    facet.materialart.
    Unknown
    Pathological changes induced in cerebrocortical neurons by phencyclidine and related drugs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 34
    facet.materialart.
    Unknown
    NCI team remodels key AIDS virus enzyme (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):598.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2669127" target="_blank"〉PubMed〈/a〉
    Keywords: Binding Sites ; Endopeptidases ; HIV/*enzymology ; HIV Protease ; Molecular Structure ; *Protease Inhibitors ; Protein Conformation ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 35
    facet.materialart.
    Unknown
    Structural basis for misaminoacylation by mutant E. coli glutaminyl-tRNA synthetase enzymes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: A single-site mutant of Escherichia coli glutaminyl-synthetase (D235N, GlnRS7) that incorrectly acylates in vivo the amber suppressor supF tyrosine transfer RNA (tRNA(Tyr] with glutamine has been described. Two additional mutant forms of the enzyme showing this misacylation property have now been isolated in vivo (D235G, GlnRS10; I129T, GlnRS15). All three mischarging mutant enzymes still retain a certain degree of tRNA specificity; in vivo they acylate supE glutaminyl tRNA (tRNA(Gln] and supF tRNA(Tyr) but not a number of other suppressor tRNA's. These genetic experiments define two positions in GlnRS where amino acid substitution results in a relaxed specificity of tRNA discrimination. The crystal structure of the GlnRS:tRNA(Gln) complex provides a structural basis for interpreting these data. In the wild-type enzyme Asp235 makes sequence-specific hydrogen bonds through its side chain carboxylate group with base pair G3.C70 in the minor groove of the acceptor stem of the tRNA. This observation implicates base pair 3.70 as one of the identity determinants of tRNA(Gln). Isoleucine 129 is positioned adjacent to the phosphate of nucleotide C74, which forms part of a hairpin structure adopted by the acceptor end of the complexed tRNA molecule. These results identify specific areas in the structure of the complex that are critical to accurate tRNA discrimination by GlnRS.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Perona, J J -- Swanson, R N -- Rould, M A -- Steitz, T A -- Soll, D -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1152-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686030" target="_blank"〉PubMed〈/a〉
    Keywords: Acylation ; Amino Acyl-tRNA Synthetases/genetics/*metabolism ; Aspartic Acid ; Binding Sites ; Crystallization ; Escherichia coli/*enzymology/genetics ; Glutamine/metabolism ; Hydrogen Bonding ; Isoleucine ; Molecular Structure ; *Mutation ; RNA, Transfer, Gln/metabolism ; RNA, Transfer, Tyr ; Structure-Activity Relationship ; Substrate Specificity ; Suppression, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 36
    facet.materialart.
    Unknown
    Factors that predict individual vulnerability to amphetamine self-administration (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 37
    facet.materialart.
    Unknown
    Inhibitors of angiotensin-converting enzyme prevent myointimal proliferation after vascular injury (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 38
    facet.materialart.
    Unknown
    Function of a bacterial activator protein that binds to transcriptional enhancers (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: The nitrogen regulatory (NtrC) protein of enteric bacteria, which binds to sites that have the properties of transcriptional enhancers, is known to activate transcription by a form of RNA polymerase that contains the NtrA protein (sigma 54) as sigma factor (referred to as sigma 54-holoenzyme). In the presence of adenosine triphosphate, the NtrC protein catalyzes isomerization of closed recognition complexes between sigma 54-holoenzyme and the glnA promoter to open complexes in which DNA in the region of the transcription start site is locally denatured. NtrC is not required subsequently for maintenance of open complexes or initiation of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Popham, D L -- Szeto, D -- Keener, J -- Kustu, S -- GM38361/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):629-35.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, Berkley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563595" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/analogs & derivatives/metabolism/pharmacology ; *Bacterial Proteins ; Base Sequence ; Binding Sites ; DNA, Bacterial/metabolism ; DNA-Binding Proteins/*metabolism ; DNA-Directed RNA Polymerases/metabolism ; Deoxyribonuclease I ; *Enhancer Elements, Genetic ; Glutamate-Ammonia Ligase/genetics ; Heparin/pharmacology ; Molecular Sequence Data ; Mutation ; PII Nitrogen Regulatory Proteins ; Phosphorylation ; Promoter Regions, Genetic ; Salmonella typhimurium/*genetics ; Sigma Factor/metabolism ; *Trans-Activators ; Transcription Factors ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 39
    facet.materialart.
    Unknown
    Glial cell diversification in the rat optic nerve (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 40
    facet.materialart.
    Unknown
    Identification of a zinc finger protein that binds to the sterol regulatory element (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: Cholesterol balance in mammalian cells is maintained in part by sterol-mediated repression of gene transcription for the low density lipoprotein receptor and enzymes in the cholesterol biosynthetic pathway. A promoter sequence termed the sterol regulatory element (SRE) is essential for this repression. With the use of an oligonucleotide containing the SRE to screen a human hepatoma complementary DNA expression library, a clone for a DNA binding protein was isolated that binds to the conserved SRE octanucleotide in both a sequence-specific and a single-strand--specific manner. This protein contains seven highly conserved zinc finger repeats that exhibit striking sequence similarity to retroviral nucleic acid binding proteins (NBPs). We have designated the protein "cellular NBP" (CNBP). CNBP is expressed in a wide variety of tissues, is up regulated by sterols, and exhibits binding specificity that correlates with in vivo function. These properties are consistent with a role in sterol-mediated control of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rajavashisth, T B -- Taylor, A K -- Andalibi, A -- Svenson, K L -- Lusis, A J -- HL30568/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):640-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2562787" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Binding Sites ; Carcinoma, Hepatocellular/metabolism ; Cholesterol/biosynthesis ; DNA/*metabolism ; DNA Probes ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation/*drug effects ; Humans ; Hydroxymethylglutaryl CoA Reductases/genetics ; Liver Neoplasms/metabolism ; Metalloproteins/genetics/*metabolism ; Molecular Sequence Data ; Promoter Regions, Genetic ; *RNA-Binding Proteins ; Receptors, LDL/genetics ; *Regulatory Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Sterols/*pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 41
    facet.materialart.
    Unknown
    A genetic polymorphism in the renin gene of Dahl rats cosegregates with blood pressure (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 42
    facet.materialart.
    Unknown
    elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 43
    facet.materialart.
    Unknown
    Autoimmune target in Heymann nephritis is a glycoprotein with homology to the LDL receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 44
    facet.materialart.
    Unknown
    Structure of E. coli glutaminyl-tRNA synthetase complexed with tRNA(Gln) and ATP at 2.8 A resolution (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The crystal structure of Escherichia coli glutaminyl-tRNA synthetase (GlnRS) complexed with its cognate glutaminyl transfer RNA (tRNA(Gln] and adenosine triphosphate (ATP) has been derived from a 2.8 angstrom resolution electron density map and the known protein and tRNA sequences. The 63.4-kilodalton monomeric enzyme consists of four domains arranged to give an elongated molecule with an axial ratio greater than 3 to 1. Its interactions with the tRNA extend from the anticodon to the acceptor stem along the entire inside of the L of the tRNA. The complexed tRNA retains the overall conformation of the yeast phenylalanine tRNA (tRNA(Phe] with two major differences: the 3' acceptor strand of tRNA(Gln) makes a hairpin turn toward the inside of the L, with the disruption of the final base pair of the acceptor stem, and the anticodon loop adopts a conformation not seen in any of the previously determined tRNA structures. Specific recognition elements identified so far include (i) enzyme contacts with the 2-amino groups of guanine via the tRNA minor groove in the acceptor stem at G2 and G3; (ii) interactions between the enzyme and the anticodon nucleotides; and (iii) the ability of the nucleotides G73 and U1.A72 of the cognate tRNA to assume a conformation stabilized by the protein at a lower free energy cost than noncognate sequences. The central domain of this synthetase binds ATP, glutamine, and the acceptor end of the tRNA as well as making specific interactions with the acceptor stem.2+t is〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rould, M A -- Perona, J J -- Soll, D -- Steitz, T A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1135-42.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479982" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/*metabolism ; Amino Acyl-tRNA Synthetases/genetics/*metabolism ; Anticodon ; Base Composition ; Base Sequence ; Binding Sites ; Biological Evolution ; Chemistry, Physical ; Crystallization ; Escherichia coli/*enzymology/genetics ; Molecular Sequence Data ; Molecular Structure ; Nucleic Acid Conformation ; Physicochemical Phenomena ; RNA, Bacterial/*metabolism ; RNA, Fungal ; RNA, Transfer, Amino Acid-Specific/*metabolism ; RNA, Transfer, Gln/*metabolism ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 45
    facet.materialart.
    Unknown
    Treatment with tin prevents the development of hypertension in spontaneously hypertensive rats (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 46
    facet.materialart.
    Unknown
    Tonic activation of NMDA receptors by ambient glutamate enhances excitability of neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 47
    facet.materialart.
    Unknown
    High-level recombinant gene expression in rabbit endothelial cells transduced by retroviral vectors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 48
    facet.materialart.
    Unknown
    The neostriatal mosaic: striatal patch-matrix organization is related to cortical lamination (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 49
    facet.materialart.
    Unknown
    Identification of a thyroid hormone receptor that is pituitary-specific (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 50
    facet.materialart.
    Unknown
    Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 51
    facet.materialart.
    Unknown
    Control of enzyme activity by an engineered disulfide bond (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-10
    Description: A novel approach to the control of enzyme catalysis is presented in which a disulfide bond engineered into the active-site cleft of bacteriophage T4 lysozyme is capable of switching the activity on and off. Two cysteines (Thr21----Cys and Thr142----Cys) were introduced by oligonucleotide-directed mutagenesis into the active-site cleft. These cysteines spontaneously formed a disulfide bond under oxidative conditions in vitro, and the catalytic activity of the oxidized (cross-linked) T4 lysozyme was completely lost. On exposure to reducing agent, however, the disulfide bond was rapidly broken, and the reduced (non-cross-linked) lysozyme was restored to full activity. Thus an enzyme has been engineered such that redox potential can be used to control catalytic activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matsumura, M -- Matthews, B W -- GM21967/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):792-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Molecular Biology, University of Oregon, Eugene 97403.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2916125" target="_blank"〉PubMed〈/a〉
    Keywords: Binding Sites ; Chromatography, High Pressure Liquid ; DNA Mutational Analysis ; *Disulfides ; Models, Molecular ; Muramidase/*physiology ; *Protein Engineering ; Recombinant Proteins ; Structure-Activity Relationship ; T-Phages/enzymology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 52
    facet.materialart.
    Unknown
    The EGF receptor kinase substrate p35 in the floor plate of the embryonic rat CNS (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 53
    facet.materialart.
    Unknown
    Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 54
    facet.materialart.
    Unknown
    Novel sites of expression of functional angiotensin II receptors in the late gestation fetus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 55
    facet.materialart.
    Unknown
    Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: The cloning of genes encoding mammalian DNA binding transcription factors for RNA polymerase II has provided the opportunity to analyze the structure and function of these proteins. This review summarizes recent studies that define structural domains for DNA binding and transcriptional activation functions in sequence-specific transcription factors. The mechanisms by which these factors may activate transcriptional initiation and by which they may be regulated to achieve differential gene expression are also discussed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mitchell, P J -- Tjian, R -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):371-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2667136" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Binding Sites ; Cloning, Molecular ; DNA-Binding Proteins/*genetics/metabolism ; Gene Expression Regulation ; Molecular Sequence Data ; Protein Processing, Post-Translational ; RNA Polymerase II/*genetics/metabolism ; Repetitive Sequences, Nucleic Acid ; Transcription Factors/*genetics/metabolism ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 56
    facet.materialart.
    Unknown
    DNA looping generated by DNA bending protein IHF and the two domains of lambda integrase (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-23
    Description: The multiprotein-DNA complexes that participate in bacteriophage lambda site-specific recombination were used to study the combined effect of protein-induced bending and protein-mediated looping of DNA. The protein integrase (Int) is a monomer with two autonomous DNA binding domains of different sequence specificity. Stimulation of Int binding and cleavage at the low affinity core-type DNA sites required interactions with the high affinity arm-type sites and depended on simultaneous binding of the sequence-specific DNA bending protein IHF (integration host factor). The bivalent DNA binding protein is positioned at high affinity sites and directed, by a DNA bending protein, to interactions with distant lower affinity sites. Assembly of this complex is independent of protein-protein interactions.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1892171/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1892171/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Moitoso de Vargas, L -- Kim, S -- Landy, A -- AI-13544/AI/NIAID NIH HHS/ -- GM-33928/GM/NIGMS NIH HHS/ -- R01 GM033928/GM/NIGMS NIH HHS/ -- R01 GM062723/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1457-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology and Medicine, Brown University, Providence, RI 02912.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544029" target="_blank"〉PubMed〈/a〉
    Keywords: Bacterial Proteins/metabolism/*pharmacology ; Bacteriophage lambda/enzymology/*genetics ; Binding Sites ; DNA Nucleotidyltransferases/*metabolism ; DNA Restriction Enzymes ; DNA Transposable Elements ; DNA, Bacterial/genetics/*metabolism ; DNA, Viral/genetics/*metabolism ; DNA-Binding Proteins/metabolism ; Integrases ; Integration Host Factors ; Mutation ; Nucleic Acid Conformation/*drug effects ; Recombination, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 57
    facet.materialart.
    Unknown
    Expression of high-affinity binding of human immunoglobulin E by transfected cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 58
    facet.materialart.
    Unknown
    Structure of complex of synthetic HIV-1 protease with a substrate-based inhibitor at 2.3 A resolution (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The structure of a complex between a peptide inhibitor with the sequence N-acetyl-Thr-Ile-Nle-psi[CH2-NH]-Nle-Gln-Arg.amide (Nle, norleucine) with chemically synthesized HIV-1 (human immunodeficiency virus 1) protease was determined at 2.3 A resolution (R factor of 0.176). Despite the symmetric nature of the unliganded enzyme, the asymmetric inhibitor lies in a single orientation and makes extensive interactions at the interface between the two subunits of the homodimeric protein. Compared with the unliganded enzyme, the protein molecule underwent substantial changes, particularly in an extended region corresponding to the "flaps" (residues 35 to 57 in each chain), where backbone movements as large as 7 A are observed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, M -- Schneider, J -- Sathyanarayana, B K -- Toth, M V -- Marshall, G R -- Clawson, L -- Selk, L -- Kent, S B -- Wlodawer, A -- A-127302/PHS HHS/ -- N01-C0-74101/PHS HHS/ -- SM-24483/SM/CMHS SAMHSA HHS/ -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1149-52.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉NCI-Frederick Cancer Research Facility, BRI-Basic Research Program, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686029" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Binding Sites ; Chemistry, Physical ; Crystallization ; Endopeptidases/*metabolism ; Gene Products, gag/metabolism ; HIV Protease ; HIV-1/*enzymology ; Hydrogen Bonding ; Molecular Sequence Data ; Molecular Structure ; Oligopeptides/*metabolism ; Physicochemical Phenomena ; Protease Inhibitors/*metabolism ; Protein Conformation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 59
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 60
    facet.materialart.
    Unknown
    In vivo footprinting of a muscle specific enhancer by ligation mediated PCR (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-10
    Description: In vivo protein-DNA interactions at the developmentally regulated enhancer of the mouse muscle creatine kinase (MCK) gene were examined by a newly developed polymerase chain reaction (PCR) footprinting procedure. This ligation mediated, single-sided PCR technique permits the exponential amplification of an entire sequence ladder. Several footprints were detected in terminally differentiated muscle cells where the MCK gene is actively transcribed. None were observed in myogenic cells prior to differentiation or in nonmuscle cells. Two footprints appear to correspond to sites that can bind the myogenic regulator MyoD1 in vitro, whereas two others represent muscle specific use of apparently general factors. Because MyoD1 is synthesized by undifferentiated myoblasts, these data imply that additional regulatory mechanisms must restrict the interaction between this protein and its target site prior to differentiation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mueller, P R -- Wold, B -- GM35526/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):780-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814500" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Cell Line ; Creatine Kinase/*genetics ; DNA/*analysis/metabolism ; DNA-Binding Proteins/genetics/metabolism ; *Enhancer Elements, Genetic ; *Gene Amplification ; Gene Expression ; Genes, Regulator ; Mice ; Molecular Sequence Data ; Muscles/*enzymology ; *Polymerase Chain Reaction ; Protein Binding ; Protein Processing, Post-Translational ; Templates, Genetic ; Transcription Factor AP-2 ; Transcription Factors/genetics/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 61
    facet.materialart.
    Unknown
    Regulation of calcium release is gated by calcium current, not gating charge, in cardiac myocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: In skeletal muscle, intramembrane charge movement initiates the processes that lead to the release of calcium from the sarcoplasmic reticulum. In cardiac muscle, in contrast, the similarity of the voltage dependence of developed tension and intracellular calcium transients to that of calcium current suggests that the calcium current may gate the release of calcium. Nevertheless, a mechanism similar to that of skeletal muscle continues to be postulated for cardiac muscle. By using rapid exchange (20 to 50 milliseconds) of the extracellular solutions in rat ventricular myocytes in which the intracellular calcium transients or cell shortening were measured, it has now been shown that the influx of calcium through the calcium channel is a mandatory link in the processes that couple membrane depolarization to the release of calcium. Thus, intramembrane charge movement does not contribute to the release of calcium in heart muscle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nabauer, M -- Callewaert, G -- Cleemann, L -- Morad, M -- R01-HL16152/HL/NHLBI NIH HHS/ -- R01-HL33720/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):800-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Pennsylvania, Department of Physiology, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543067" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Barium/metabolism/pharmacology ; Benzofurans ; Buffers ; Calcium/*metabolism ; Calcium Channels/*physiology ; Dialysis ; Egtazic Acid/pharmacology ; Extracellular Space/metabolism ; Fluorescent Dyes ; Fura-2 ; Heart/drug effects/*physiology ; Heart Ventricles ; Membrane Potentials ; Myocardial Contraction ; Rats ; Sarcoplasmic Reticulum/metabolism ; Sodium/metabolism ; Spectrometry, Fluorescence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 62
    facet.materialart.
    Unknown
    Angiotensin II: does it have a direct obligate role in ovulation? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Naftolin, F -- Andrade-Gordon, P -- Pellicer, A -- Palumbo, A -- Apa, R -- Zreik, T -- Yoon, T K -- DeCherney, A -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):870-1.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Obstetrics and Gynecology, Yale University, New Haven, CT 06510-8063.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772639" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Sarcosine-8-Isoleucine Angiotensin II/pharmacology ; Angiotensin II/*physiology ; Animals ; Chorionic Gonadotropin/pharmacology ; Female ; Gonadotropins, Equine/pharmacology ; *Ovulation ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/analysis ; Receptors, LH/analysis ; Saralasin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 63
    facet.materialart.
    Unknown
    Domain separation in the activation of glycogen phosphorylase a (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The crystal structure of glycogen phosphorylase a complexed with its substrates, orthophosphate and maltopentaose, has been determined and refined at a resolution of 2.8 angstroms. With oligosaccaride bound at the glycogen storage site, the phosphate ion binds at the catalytic site and causes the regulatory and catalytic domains to separate with the loss of stabilizing interactions between them. Homotropic cooperativity between the active sites of the allosteric dimer results from rearrangements in isologous contacts between symmetry-related helices in the subunit interface. The conformational changes in the core of the interface are correlated with those observed on covalent activation by phosphorylation at Ser14 (phosphorylase b----a).〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goldsmith, E J -- Sprang, S R -- Hamlin, R -- Xuong, N H -- Fletterick, R J -- DK31507-05/DK/NIDDK NIH HHS/ -- GM00085-05/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):528-32.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas 75235.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2756432" target="_blank"〉PubMed〈/a〉
    Keywords: Allosteric Site ; Amino Acid Sequence ; Binding Sites ; Catalysis ; Crystallization ; Crystallography ; Enzyme Activation ; Glucosephosphates/metabolism ; Glycogen/metabolism ; Macromolecular Substances ; Molecular Sequence Data ; Molecular Structure ; Oligosaccharides ; Phosphates/metabolism ; Phosphorylase a/*metabolism ; Phosphorylases/*metabolism ; Protein Conformation ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 64
    facet.materialart.
    Unknown
    Mutant potassium channels with altered binding of charybdotoxin, a pore-blocking peptide inhibitor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-22
    Description: The inhibition by charybdotoxin of A-type potassium channels expressed in Xenopus oocytes was studied for several splicing variants of the Drosophila Shaker gene and for several site-directed mutants of this channel. Charybdotoxin blocking affinity is lowered by a factor of 3.5 upon replacing glutamate-422 with glutamine, and by a factor of about 12 upon substituting lysine in this position. Replacement of glutamate-422 by aspartate had no effect on toxin affinity. Thus, the glutamate residue at position 422 of this potassium channel is near or in the externally facing mouth of the potassium conduction pathway, and the positively charged toxin is electrostatically focused toward its blocking site by the negative potential set up by glutamate-422.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacKinnon, R -- Miller, C -- AR 19826/AR/NIAMS NIH HHS/ -- GM 31768/GM/NIGMS NIH HHS/ -- NS 07292/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1382-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Brandeis University, Waltham, MA 02254.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476850" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Binding Sites ; Charybdotoxin ; DNA Mutational Analysis ; Drosophila melanogaster ; Ions ; Membrane Proteins/genetics/metabolism/ultrastructure ; Potassium Channels/*metabolism/ultrastructure ; Scorpion Venoms/*metabolism ; Structure-Activity Relationship ; Transfection ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 65
    facet.materialart.
    Unknown
    The diageotropica mutant of tomato lacks high specific activity auxin binding sites (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: Tomato plants homozygous for the diageotropica (dgt) mutation exhibit morphological and physiological abnormalities which suggest that they are unable to respond to the plant growth hormone auxin (indole-3-acetic acid). The photoaffinity auxin analog [3H]5N3-IAA specifically labels a polypeptide doublet of 40 and 42 kilodaltons in membrane preparations from stems of the parental variety, VFN8, but not from stems of plants containing the dgt mutation. In roots of the mutant plants, however, labeling is indistinguishable from that in VFN8. These data suggest that the two polypeptides are part of a physiologically important auxin receptor system, which is altered in a tissue-specific manner in the mutant.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hicks, G R -- Rayle, D L -- Lomax, T L -- DCB-8718731/DC/NIDCD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245:52-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Botany and Plant Pathology, Oregon State University, Corvallis 97331-2902.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/11537490" target="_blank"〉PubMed〈/a〉
    Keywords: Affinity Labels ; Azides/*metabolism ; Binding Sites ; Hypocotyl/cytology/genetics/metabolism/ultrastructure ; Indoleacetic Acids/*analysis/*metabolism ; Intracellular Membranes/chemistry/metabolism/ultrastructure ; Lycopersicon esculentum/cytology/*genetics/metabolism/ultrastructure ; Microsomes/ultrastructure ; *Mutation ; Photolysis ; *Plant Growth Regulators ; Plant Proteins ; Plant Roots/cytology/genetics/metabolism/ultrastructure ; Receptors, Cell Surface/analysis/genetics/metabolism ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 66
    facet.materialart.
    Unknown
    Protection of dentate hilar cells from prolonged stimulation by intracellular calcium chelation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-13
    Description: Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein-negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Scharfman, H E -- Schwartzkroin, P A -- NS-01744/NS/NINDS NIH HHS/ -- NS-15317/NS/NINDS NIH HHS/ -- NS-18895/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):257-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2508225" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Calcium/*metabolism ; Calcium-Binding Proteins/metabolism ; Egtazic Acid/pharmacology ; Electric Stimulation ; Female ; Hippocampus/cytology/drug effects/*physiology ; In Vitro Techniques ; Neurons/drug effects/physiology ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 67
    facet.materialart.
    Unknown
    Identification by ENDOR of Trp191 as the free-radical site in cytochrome c peroxidase compound ES (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-18
    Description: The chemical identity of the amino acid free-radical site that represents one of the two oxidizing equivalents stored in the H2O2-oxidized intermediate (compound ES) of the mitochondrial heme enzyme, cytochrome c peroxidase (CcP) has been sought for almost a quarter of a century. Site-directed mutagenesis alone cannot yield this answer. Low-temperature 35-gigahertz (Q-band) electron nuclear double resonance (ENDOR) spectroscopy was used to examine compound ES prepared from proteins containing specifically deuterated methionine or tryptophan, as well as the amino acid replacement Trp51----Phe. The results definitely identify the site of the radical in compound ES as tryptophan, most likely Trp191.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sivaraja, M -- Goodin, D B -- Smith, M -- Hoffman, B M -- GM-33804/GM/NIGMS NIH HHS/ -- GM-41049/GM/NIGMS NIH HHS/ -- HL-13531/HL/NHLBI NIH HHS/ -- R01 GM041049/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):738-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry, Northwestern University, Evanston, IL 60208.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549632" target="_blank"〉PubMed〈/a〉
    Keywords: Binding Sites ; *Cytochrome-c Peroxidase/genetics ; Electron Spin Resonance Spectroscopy ; Escherichia coli/enzymology ; Free Radicals ; Mutation ; Oxidation-Reduction ; *Peroxidases/genetics ; Recombinant Proteins ; *Tryptophan
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 68
    facet.materialart.
    Unknown
    Selective loss of hippocampal granule cells in the mature rat brain after adrenalectomy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Adrenalectomy of adult male rats resulted in a nearly complete loss of hippocampal granule cells 3 to 4 months after surgery. Nissl and immunocytochemical staining of hippocampal neurons revealed that the granule cell loss was selective; there was no apparent loss of hippocampal pyramidal cells or of gamma-amino butyric acid (GABA)-, somatostatin-, neuropeptide Y-, calcium binding protein-, or parvalbumin-containing hippocampal interneurons. The hippocampal CA1 pyramidal cells of adrenalectomized animals exhibited normal electrophysiological responses to afferent stimulation, whereas responses evoked in the dentate gyrus were severely attenuated. Corticosterone replacement prevented both the adrenalectomy-induced granule cell loss and the attenuated physiological response. Thus, the adrenal glands play a role in maintaining the structural integrity of the normal adult brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sloviter, R S -- Valiquette, G -- Abrams, G M -- Ronk, E C -- Sollas, A L -- Paul, L A -- Neubort, S -- NS18201/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):535-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurology Research Center, Helen Hayes Hospital, New York State Department of Health, West Haverstraw 10993.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911756" target="_blank"〉PubMed〈/a〉
    Keywords: *Adrenalectomy ; Animals ; Annexin A6 ; Calcium-Binding Proteins/analysis ; Corticosterone/pharmacology ; Cytoplasmic Granules ; Electrophysiology ; Evoked Potentials ; Hippocampus/*cytology/drug effects/physiology ; Immunohistochemistry ; Male ; Neurons/cytology/physiology ; Potassium/blood ; Rats ; Sodium/blood ; Weight Gain
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 69
    facet.materialart.
    Unknown
    Hyperpolarizing vasodilators activate ATP-sensitive K+ channels in arterial smooth muscle (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Vasodilators are used clinically for the treatment of hypertension and heart failure. The effects of some vasodilators seem to be mediated by membrane hyperpolarization. The molecular basis of this hyperpolarization has been investigated by examining the properties of single K+ channels in arterial smooth muscle cells. The presence of adenosine triphosphate (ATP)-sensitive K+ channels in these cells was demonstrated at the single channel level. These channels were opened by the hyperpolarizing vasodilator cromakalim and inhibited by the ATP-sensitive K+ channel blocker glibenclamide. Furthermore, in arterial rings the vasorelaxing actions of the drugs diazoxide, cromakalim, and pinacidil and the hyperpolarizing actions of vasoactive intestinal polypeptide and acetylcholine were blocked by inhibitors of the ATP-sensitive K+ channels, suggesting that all these agents may act through a common pathway in smooth muscle by opening ATP-sensitive K+ channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Standen, N B -- Quayle, J M -- Davies, N W -- Brayden, J E -- Huang, Y -- Nelson, M T -- HL 35911/HL/NHLBI NIH HHS/ -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):177-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Leicester, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501869" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholine/pharmacology ; Adenosine Triphosphate/*metabolism ; Animals ; Benzopyrans/antagonists & inhibitors/pharmacology ; Cerebral Arteries ; Cromakalim ; Diazoxide/pharmacology ; Glyburide/pharmacology ; Guanidines/pharmacology ; Mesenteric Arteries ; Muscle, Smooth, Vascular/*metabolism ; Pinacidil ; Potassium Channels/*drug effects/metabolism ; Pyrroles/antagonists & inhibitors/pharmacology ; Rabbits ; Rats ; Tolbutamide/pharmacology ; Vasoactive Intestinal Peptide/pharmacology ; Vasodilator Agents/antagonists & inhibitors/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 70
    facet.materialart.
    Unknown
    NMDA antagonists differentiate epileptogenesis from seizure expression in an in vitro model (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: In an electrographic model of seizures in the hippocampal slice, both of the N-methyl-D-aspartate (NMDA) antagonists 2-amino-5-phosphonovaleric acid and 5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohepten-5,10-imine maleate (MK-801) prevented the progressive development of seizures but did not block previously induced seizures. Thus, a process dependent on the NMDA receptor-ionophore complex establishes a long-lasting, seizure-prone state; thereafter the seizures depend on non-NMDA receptor-ionophore mechanisms. This suggests that there is an important distinction between epileptogenesis and seizure expression and between antiepileptogenic and anticonvulsant pharmacological agents.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stasheff, S F -- Anderson, W W -- Clark, S -- Wilson, W A -- NS 17771/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):648-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Epilepsy Center, Veterans Administration Medical Center, Durham, NC 27705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569762" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate ; Animals ; Anticonvulsants/pharmacology ; Aspartic Acid/*analogs & derivatives/antagonists & inhibitors ; Dibenzocycloheptenes/pharmacology ; *Disease Models, Animal ; Dizocilpine Maleate ; Electric Stimulation ; Electrophysiology ; Epilepsy/*physiopathology ; Evoked Potentials ; Hippocampus/*physiopathology ; In Vitro Techniques ; N-Methylaspartate ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Seizures/*physiopathology ; Valine/analogs & derivatives/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 71
    facet.materialart.
    Unknown
    Calicheamicin gamma 1I and DNA: molecular recognition process responsible for site-specificity (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-12
    Description: Calicheamicin gamma 1I is a recently discovered diyne-ene-containing antitumor antibiotic that cleaves DNA in a double-stranded fashion, a rarity among drugs, at specific sequences. It is proposed that the cutting specificity is due to a combination of the complementarity of the diyne-ene portion of the aglycone with DNA secondary structures and stabilization by association of the thiobenzoate-carbohydrate tail with the minor groove.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zein, N -- Poncin, M -- Nilakantan, R -- Ellestad, G A -- New York, N.Y. -- Science. 1989 May 12;244(4905):697-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cyanamid Company, Medical Research Division, Lederle Laboratories, Pearl River, NY 10965.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2717946" target="_blank"〉PubMed〈/a〉
    Keywords: *Aminoglycosides ; Animals ; Anti-Bacterial Agents/*metabolism ; Antibiotics, Antineoplastic ; Base Sequence ; Benzoates ; Binding Sites ; Carbohydrates ; Cattle ; Computer Simulation ; DNA/*metabolism ; Enediynes ; Models, Molecular ; Molecular Structure ; Nucleic Acid Conformation ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 72
    facet.materialart.
    Unknown
    Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The discovery that the AP-1 family of enhancer binding factors includes a complex of the cellular Fos (cFos) and cellular Jun (cJun) proteins established a direct and important link between oncogenesis and transcriptional regulation. Homodimeric cJun protein synthesized in vitro is capable of binding selectively to AP-1 recognition sites, whereas the cFos polypeptide is not. When cotranslated, the cFos and cJun proteins can form a stable, heterodimeric complex with the DNA binding properties of AP-1/cJun. The related proteins Jun B and vJun are also able to form DNA binding complexes with cFos. Directed mutagenesis of the cFos protein reveals that a leucine repeat structure is required for binding to cJun, in a manner consistent with the proposed function of the "leucine zipper." A novel domain adjacent to, but distinct from, the leucine repeat of cFos is required for DNA binding by cFos-cJun heterodimers. Thus experimental evidence is presented that leucine repeats can mediate complex formation between heterologous proteins and that promotes further understanding of the molecular mechanisms underlying the function of two proto-oncogene products.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turner, R -- Tjian, R -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1689-94.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494701" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Chromatography, Affinity ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation ; Humans ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Oncogenes ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 73
    facet.materialart.
    Unknown
    The cholinergic neuronal differentiation factor from heart cells is identical to leukemia inhibitory factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 74
    facet.materialart.
    Unknown
    Two NF1 translocations map within a 600-kilobase segment of 17q11.2 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-02
    Description: Balanced translocations, each involving chromosome 17q11.2, have been described in two patients with von Recklinghausen neurofibromatosis (NF1). To better localize the end points of these translocation events, and the NF1 gene (NF1) itself, human cosmids were isolated and mapped in the immediate vicinity of NF1. One cosmid probe, c11-1F10, demonstrated that both translocation breakpoints, and presumably NF1, are contained within a 600-kilobase Nru I fragment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Connell, P -- Leach, R -- Cawthon, R M -- Culver, M -- Stevens, J -- Viskochil, D -- Fournier, R E -- Rich, D C -- Ledbetter, D H -- White, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1087-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of Utah, Salt Lake City 84132.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543077" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Mapping ; *Chromosomes, Human, Pair 17 ; Cosmids ; DNA Restriction Enzymes ; Deoxyribonucleases, Type II Site-Specific ; Electrophoresis ; Genetic Linkage ; Humans ; Hybrid Cells ; Neurofibromatosis 1/*genetics ; Rats ; *Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 75
    facet.materialart.
    Unknown
    Parallel association of Fos and Jun leucine zippers juxtaposes DNA binding domains (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The protein products of the fos and jun proto-oncogenes form a heterodimeric complex that participates in a stable high affinity interaction with DNA elements containing AP-1 binding sites. The effects of deletions and point mutations in Fos and Jun on protein complex formation and DNA binding have been examined. The data suggest that Fos and Jun dimerize via a parallel interaction of helical domains containing a heptad repeat of leucine residues (the leucine zipper). Dimerization is required for DNA binding and results in the appropriate juxtaposition of basic amino acid regions from Fos and Jun, both of which are required for association with DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gentz, R -- Rauscher, F J 3rd -- Abate, C -- Curran, T -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1695-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Oncology, Roche Institute of Molecular Biology, Nutley, NJ 07110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494702" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Cross-Linking Reagents ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Glutaral ; Immunosorbent Techniques ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Protein Conformation ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 76
    facet.materialart.
    Unknown
    Histone H5 in the control of DNA synthesis and cell proliferation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: The linker histones (H1, H5, H1 degrees) are involved in the condensation of chromatin into the 30-nanometer fiber. This supranucleosome organization correlates with the resting state of chromatin, and it is therefore possible that the linker histones play an active role in the control of chromatin activity. The effect of H5 has been directly determined by expression of an inducible transfected H5 gene in rat sarcoma cells, which do not produce H5. Transfection resulted in the reversible inhibition of DNA replication and arrest of cells in G1, at which time H5 concentrations approached that of terminally differentiated avian erythrocytes. The arrest of proliferation was accompanied by specific changes in gene expression probably related to the cell cycle block. The selectivity of these effects suggest that H5 plays an active role in the control of DNA replication and cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, J M -- Wiaderkiewicz, R -- Ruiz-Carrillo, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):68-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cancer Research Center, Laval University School of Medicine, L'Hotel-Dieu du Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740916" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Cycle ; Cell Division ; Cell Line ; Chickens ; DNA/*biosynthesis ; *DNA Replication ; Histones/genetics/*physiology ; Rats ; Receptors, Glucocorticoid/biosynthesis ; Recombinant Proteins/pharmacology ; Sarcoma, Experimental ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 77
    facet.materialart.
    Unknown
    Direct Bronsted analysis of the restoration of activity to a mutant enzyme by exogenous amines (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: A true Bronsted analysis of proton transfer in an enzyme mechanism is made possible by the chemical rescue of an inactive mutant of aspartate aminotransferase, where the endogenous general base, Lys258, is replaced with Ala by site-directed mutagenesis. Catalytic activity is restored to this inactive mutant by exogenous amines. The eleven amines studied generate a Bronsted correlation with beta of 0.4 for the transamination of cysteine sulfinate, when steric effects are included in the regression analysis. Localized mutagenesis thus allows the classical Bronsted analysis of transition-state structure to be applied to enzyme-catalyzed reactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Toney, M D -- Kirsch, J F -- GM07232/GM/NIGMS NIH HHS/ -- GM35393/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1485-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2538921" target="_blank"〉PubMed〈/a〉
    Keywords: Amines ; Aspartate Aminotransferases/*metabolism ; Binding Sites ; Catalysis ; Escherichia coli/enzymology ; Kinetics ; Lysine ; Mutation ; Protons
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 78
    facet.materialart.
    Unknown
    The structure of the "second genetic code" (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Waldrop, M M -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1122.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479981" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acyl-tRNA Synthetases/*metabolism ; Binding Sites ; Escherichia coli/*enzymology/genetics ; Molecular Structure ; RNA, Bacterial/*metabolism ; RNA, Transfer, Amino Acid-Specific/*metabolism ; RNA, Transfer, Gln/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 79
    facet.materialart.
    Unknown
    Molecular modeling of the HIV-1 protease and its substrate binding site (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-17
    Description: The human immunodeficiency virus (HIV-1) encodes a protease that is essential for viral replication and is a member of the aspartic protease family. The recently determined three-dimensional structure of the related protease from Rous sarcoma virus has been used to model the smaller HIV-1 dimer. The active site has been analyzed by comparison to the structure of the aspartic protease, rhizopuspepsin, complexed with a peptide inhibitor. The HIV-1 protease is predicted to interact with seven residues of the protein substrate. This information can be used to design protease inhibitors and possible antiviral drugs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weber, I T -- Miller, M -- Jaskolski, M -- Leis, J -- Skalka, A M -- Wlodawer, A -- CA-06927/CA/NCI NIH HHS/ -- CA38046/CA/NCI NIH HHS/ -- N01-CO-74101/CO/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):928-31.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Crystallography Laboratory, NCI-Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2537531" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Avian Sarcoma Viruses/enzymology ; Binding Sites ; HIV-1/*enzymology ; Hydrogen Bonding ; Macromolecular Substances ; Models, Molecular ; Molecular Sequence Data ; Peptide Hydrolases/*metabolism ; Protein Conformation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 80
    facet.materialart.
    Unknown
    Amyloid beta protein enhances the survival of hippocampal neurons in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: The beta-amyloid protein is progressively deposited in Alzheimer's disease as vascular amyloid and as the amyloid cores of neuritic plaques. Contrary to its metabolically inert appearance, this peptide may have biological activity. To evaluate this possibility, a peptide ligand homologous to the first 28 residues of the beta-amyloid protein (beta 1-28) was tested in cultures of hippocampal pyramidal neurons for neurotrophic or neurotoxic effects. The beta 1-28 appeared to have neurotrophic activity because it enhanced neuronal survival under the culture conditions examined. This finding may help elucidate the sequence of events leading to plaque formation and neuronal damage in Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Whitson, J S -- Selkoe, D J -- Cotman, C W -- AG00538/AG/NIA NIH HHS/ -- AG07918/AG/NIA NIH HHS/ -- MH19691/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1488-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928783" target="_blank"〉PubMed〈/a〉
    Keywords: Amyloid/*pharmacology ; *Amyloid beta-Peptides ; *Amyloid beta-Protein Precursor ; Animals ; Cell Adhesion/drug effects ; Cell Survival ; Cells, Cultured ; Hippocampus/*cytology/embryology ; Neurons/cytology ; Peptide Fragments/*pharmacology ; Rats ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 81
    facet.materialart.
    Unknown
    Signal transduction by the platelet-derived growth factor receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-24
    Description: When platelet-derived growth factor (PDGF) binds to its receptor on a quiescent fibroblast or smooth muscle cell, it stimulates a remarkably diverse group of biochemical responses, including changes in ion fluxes, activation of several kinases, alterations in cell shape, increased transcription of a number of genes, and stimulation of enzymes that regulate phospholipid metabolism. These and other reactions culminate, hours later, in DNA replication and cell division. How does the receptor for PDGF recognize and bind its specific ligand and then transduce this signal across the cell membrane via a single membrane-spanning region? Which of the immediate cellular responses are directly involved in the biochemical pathways that lead to DNA synthesis? How does the PDGF receptor trigger a diverse group of responses? Recent studies of the PDGF receptor have provided insight into these issues.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Williams, L T -- HL-32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1564-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of California, San Francisco 94143-0724.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2538922" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Binding Sites ; Gene Expression Regulation ; Humans ; Membrane Proteins/physiology/ultrastructure ; Molecular Structure ; Platelet-Derived Growth Factor/*physiology ; Protein-Tyrosine Kinases/physiology ; Receptors, Cell Surface/*physiology/ultrastructure ; Receptors, Platelet-Derived Growth Factor
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 82
    facet.materialart.
    Unknown
    Neural connections between the lateral geniculate nucleus and visual cortex in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Neural connections were established in cocultures of rat visual cortex (VC) and lateral geniculate nucleus (LGN), which were isolated in early infancy. Morphological and electrophysiological studies showed that the cortical laminar organization of afferent and efferent connections in the coculture preparations was similar to that in the adult VC. The results indicate the existence of intrinsic mechanisms in VC and LGN that guide the formation of synaptic connections with the appropriate targets.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamoto, N -- Kurotani, T -- Toyama, K -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):192-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Kyoto Prefectural School of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749258" target="_blank"〉PubMed〈/a〉
    Keywords: Afferent Pathways/physiology ; Animals ; Axons/physiology ; Culture Techniques ; Efferent Pathways/physiology ; Electrophysiology ; Geniculate Bodies/cytology/*physiology ; Organ Culture Techniques ; Rats ; Rats, Inbred Strains ; Synapses/physiology ; Visual Cortex/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 83
    facet.materialart.
    Unknown
    The periaqueductal gray matter mediates opiate-induced immunosuppression (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The periaqueductal gray matter of the mesencephalon (PAG) subserves a variety of diverse autonomic functions and also appears to be a site for opiate action in the induction of immunosuppression. Microinjections of morphine into the PAG, but not into other opiate receptor-containing neuroanatomical sites, result in a rapid suppression of natural killer (NK) cell activity. The NK cell suppression can be blocked by prior peripheral administration of the opiate antagonist naltrexone. These findings demonstrate that certain central actions of opiates that produce changes in NK cell function are mediated through opiate receptors in the PAG and identify a brain region involved in opiate regulation of immune function.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weber, R J -- Pert, A -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):188-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Medicinal Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749256" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immune Tolerance ; Killer Cells, Natural/drug effects/immunology ; Male ; Mesencephalon/drug effects/*immunology ; Microinjections ; Morphine/administration & dosage/antagonists & inhibitors/*pharmacology ; Naltrexone/pharmacology ; Rats ; Rats, Inbred F344
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 84
    facet.materialart.
    Unknown
    Conserved folding in retroviral proteases: crystal structure of a synthetic HIV-1 protease (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: The rational design of drugs that can inhibit the action of viral proteases depends on obtaining accurate structures of these enzymes. The crystal structure of chemically synthesized HIV-1 protease has been determined at 2.8 angstrom resolution (R factor of 0.184) with the use of a model based on the Rous sarcoma virus protease structure. In this enzymatically active protein, the cysteines were replaced by alpha-amino-n-butyric acid, a nongenetically coded amino acid. This structure, in which all 99 amino acids were located, differs in several important details from that reported previously by others. The interface between the identical subunits forming the active protease dimer is composed of four well-ordered beta strands from both the amino and carboxyl termini and residues 86 to 94 have a helical conformation. The observed arrangement of the dimer interface suggests possible designs for dimerization inhibitors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wlodawer, A -- Miller, M -- Jaskolski, M -- Sathyanarayana, B K -- Baldwin, E -- Weber, I T -- Selk, L M -- Clawson, L -- Schneider, J -- Kent, S B -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):616-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Crystallography Laboratory, NCI-Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2548279" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Aspartic Acid Endopeptidases ; Avian Sarcoma Viruses/enzymology ; Binding Sites ; Crystallization ; *Endopeptidases/chemical synthesis ; HIV Protease ; HIV-1/*enzymology ; Hydrogen Bonding ; Macromolecular Substances ; Models, Molecular ; Molecular Sequence Data ; Molecular Structure ; Protein Conformation ; Solutions ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 85
    facet.materialart.
    Unknown
    Functionally distinct NF-kappa B binding sites in the immunoglobulin kappa and IL-2 receptor alpha chain genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-28
    Description: The interleukin-2 receptor alpha (IL-2R alpha) chain gene contains a sequence similar to the immunoglobulin (Ig) kappa (kappa) enhancer NF-kappa B binding site. This site, which is bound by the nuclear protein, NF-kappa B, is critical for Ig kappa gene expression. The major T cell nuclear factor that binds to the IL-2R alpha site in vitro appears indistinguishable from NF-kappa B. NF-kappa B binds to IL-2R alpha and kappa sequences with similar affinities; however, only the kappa site potently activates transcription from heterologous promoters. Thus, high-affinity NF-kappa B binding in vitro cannot be equated with transcriptional activation in vivo. Mutation of the NF-kappa B binding site in the context of an IL-2 R alpha promoter construct markedly diminished promoter activity in human T cell lymphotropic virus type I (HTLV-I)-transformed MT-2 cells but not in phorbol myristate acetate-stimulated Jurkat T cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cross, S L -- Halden, N F -- Lenardo, M J -- Leonard, W J -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):466-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497520" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Cell Line, Transformed ; DNA-Binding Proteins/*metabolism ; *Enhancer Elements, Genetic ; *Gene Expression Regulation ; HIV-1/genetics ; HeLa Cells ; Human T-lymphotropic virus 1 ; Humans ; Immunoglobulin kappa-Chains/*genetics ; Mice ; Molecular Sequence Data ; Mutation ; NF-kappa B ; Promoter Regions, Genetic ; Receptors, Interleukin-2/*genetics ; T-Lymphocytes/metabolism ; Tetradecanoylphorbol Acetate/pharmacology ; Transcription Factors/*metabolism ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 86
    facet.materialart.
    Unknown
    Fenfluramine studies (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Derome-Tremblay, M -- Nathan, C -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):991.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922597" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Fenfluramine/administration & dosage/therapeutic use/*toxicity ; Humans ; Obesity/drug therapy ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 87
    facet.materialart.
    Unknown
    Perineurium originates from fibroblasts: demonstration in vitro with a retroviral marker (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: A cellular sheath, the perineurium, forms a protective barrier around fascicles of nerve fibers throughout the peripheral nervous system. In a study to determine the cellular origin of perineurium, a culture system was used in which perineurium forms after purified populations of sensory neurons, Schwann cells, and fibroblasts are recombined. Before recombination, the Schwann cells or the fibroblasts were labeled by infection with a defective recombinant retrovirus whose gene product, beta-galactosidase, is histochemically detectable in the progeny of infected cells. Perineurial cells were labeled when fibroblasts had been infected but not when Schwann cells had been infected. Thus, perineurium arises from fibroblasts in vitro and, by implication, in vivo as well.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bunge, M B -- Wood, P M -- Tynan, L B -- Bates, M L -- Sanes, J R -- NS09923/NS/NINDS NIH HHS/ -- NS22828/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):229-31.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492115" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/ultrastructure ; Cell Transformation, Viral ; Cells, Cultured ; *Connective Tissue Cells ; Fetus ; Fibroblasts/*cytology ; Ganglia, Spinal/*cytology ; Genes ; Neurons/*cytology ; Rats ; Retroviridae/enzymology/*genetics ; Schwann Cells/cytology ; beta-Galactosidase/analysis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 88
    facet.materialart.
    Unknown
    A role for a 70-kilodalton heat shock protein in lysosomal degradation of intracellular proteins (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-20
    Description: A 73-kilodalton (kD) intracellular protein was found to bind to peptide regions that target intracellular proteins for lysosomal degradation in response to serum withdrawal. This protein cross-reacted with a monoclonal antibody raised to a member of the 70-kD heat shock protein (hsp70) family, and sequences of two internal peptides of the 73-kD protein confirm that it is a member of this family. In response to serum withdrawal, the intracellular concentration of the 73-kD protein increased severalfold. In the presence of adenosine 5'-triphosphate (ATP) and MgCl2, the 73-kD protein enhanced protein degradation in two different cell-free assays for lysosomal proteolysis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chiang, H L -- Terlecky, S R -- Plant, C P -- Dice, J F -- AG06116/AG/NIA NIH HHS/ -- DK07542/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):382-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Tufts University School of Medicine, Boston, MA 02111.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799391" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Heat-Shock Proteins/genetics/*physiology ; Immunoblotting ; Lysosomes/*metabolism ; Molecular Sequence Data ; Rats ; Ribonuclease, Pancreatic/genetics/*metabolism ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 89
    facet.materialart.
    Unknown
    The protein kinase domain of the ANP receptor is required for signaling (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-22
    Description: A plasma membrane form of guanylate cyclase is a cell surface receptor for atrial natriuretic peptide (ANP). In response to ANP binding, the receptor-enzyme produces increased amounts of the second messenger, guanosine 3',5'-monophosphate. Maximal activation of the cyclase requires the presence of adenosine 5'-triphosphate (ATP) or nonhydrolyzable ATP analogs. The intracellular region of the receptor contains at least two domains with homology to other proteins, one possessing sequence similarity to protein kinase catalytic domains, the other to regions of unknown function in a cytoplasmic form of guanylate cyclase and in adenylate cyclase. It is now shown that the protein kinase-like domain functions as a regulatory element and that the second domain possesses catalytic activity. When the kinase-like domain was removed by deletion mutagenesis, the resulting ANP receptor retained guanylate cyclase activity, but this activity was independent of ANP and its stimulation by ATP was markedly reduced. A model for signal transduction is suggested in which binding of ANP to the extracellular domain of its receptor initiates a conformational change in the protein kinase-like domain, resulting in derepression of guanylate cyclase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chinkers, M -- Garbers, D L -- GM31362/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1392-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2571188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Atrial Natriuretic Factor/*physiology ; Cyclic GMP/physiology ; DNA Mutational Analysis ; Guanylate Cyclase/metabolism ; Magnesium/physiology ; Protein Kinases/*physiology ; Rats ; Receptors, Atrial Natriuretic Factor ; Receptors, Cell Surface/*physiology/ultrastructure ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 90
    facet.materialart.
    Unknown
    Cloning and expression of a Xenopus embryonic gap junction protein (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-03
    Description: Gap junctions in the early amphibian embryo may play a fundamental role in the regulation of differentiation by mediating the cell-to-cell transfer of chemical signals. A complementary DNA encoding a gap junction present in Xenopus oocytes and early embryos has now been cloned and sequenced. This protein sequence is homologous to the well-characterized gap junction structural proteins rat connexin32 and connexin43. RNA blot analysis of total Xenopus oocyte RNA showed hybridization to a single 1.6-kilobase band. This messenger RNA is abundant in oocytes, decreases to levels below the sensitivity of our assay by stage 15 (18 hours), and is not detectable in RNA from a number of adult organs. To confirm that the oocyte cDNA encodes a gap junction channel, the protein was over expressed in Xenopus oocytes by injection of RNA synthesized in vitro. Pairs of RNA-injected oocytes formed many more time- and voltage-sensitive cell-cell channels than water-injected pairs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ebihara, L -- Beyer, E C -- Swenson, K I -- Paul, D L -- Goodenough, D A -- GM18974/GM/NIGMS NIH HHS/ -- GM37751/GM/NIGMS NIH HHS/ -- HL28958-06/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1194-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466337" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cell Communication ; *Cloning, Molecular ; Connexins ; DNA Probes ; Electric Conductivity ; Female ; Gene Expression Regulation ; Intercellular Junctions/physiology ; Membrane Proteins/*genetics/physiology ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oocytes/analysis/physiology ; RNA/analysis ; RNA, Messenger/analysis ; Rats ; Tissue Distribution ; Xenopus/*embryology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 91
    facet.materialart.
    Unknown
    Modulation of calcium channels in cardiac and neuronal cells by an endogenous peptide (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: Calcium channels mediate the generation of action potentials, pacemaking, excitation-contraction coupling, and secretion and signal integration in muscle, secretory, and neuronal cells. The physiological regulation of the L-type calcium channel is thought to be mediated primarily by guanine nucleotide-binding proteins (G proteins). A low molecular weight endogenous peptide has been isolated and purified from rat brain. This peptide regulates up and down the cardiac and neuronal calcium channels, respectively. In cardiac myocytes, the peptide-induced enhancement of the L-type calcium current had a slow onset (half-time approximately 75 seconds), occurred via a G protein-independent mechanism, and could not be inhibited by alpha 1-adrenergic, beta-adrenergic, or angiotensin II blockers. In neuronal cells, on the other hand, the negative effect had a rapid onset (half-time less than 500 milliseconds) and was observed on both T-type and L-type calcium channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Callewaert, G -- Hanbauer, I -- Morad, M -- HL16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):663-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, School of Medicine, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536955" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/antagonists & inhibitors ; Animals ; Brain Chemistry ; Calcium Channels/drug effects/*physiology ; Cell Line ; Cell Membrane/metabolism ; Chromatography, High Pressure Liquid ; Electric Conductivity ; GTP-Binding Proteins/physiology ; Guinea Pigs ; Heart/*physiology ; Hippocampus/metabolism ; Mice ; Neuroblastoma ; Neurons/*physiology ; Nitrendipine/metabolism ; Peptide Fragments ; Peptides/isolation & purification/*pharmacology ; Rats ; Serine Endopeptidases/metabolism ; Sympatholytics/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 92
    facet.materialart.
    Unknown
    Postponement of satiety by blockade of brain cholecystokinin (CCK-B) receptors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Exogenous cholecystokinin (CCK) decreases food intake and causes satiety in animals and man. However, it has not been established that endogenous CCK causes satiety or whether the response is mediated by peripheral-type (CCK-A) or brain-type (CCK-B) receptors. The development of potent and selective antagonists for CCK-A (MK-329) and CCK-B (L-365,260) receptors now allows these issues to be addressed. The CCK-A antagonist MK-329 and the CCK-B antagonist L-365,260 increased food intake in partially satiated rats and postponed the onset of satiety; however, L-365,260 was 100 times more potent than MK-329 in increasing feeding and preventing satiety. These results suggest that endogenous CCK causes satiety by an agonist action on CCK-B receptors in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dourish, C T -- Rycroft, W -- Iversen, S D -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1509-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Merck Sharp & Dohme Research Laboratories, Neuroscience Research Center, Terlings Park, Harlow, Essex, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781294" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Benzodiazepines/pharmacology ; Benzodiazepinones/pharmacology ; Brain/drug effects/*physiology ; Cholecystokinin/antagonists & inhibitors/*physiology ; Devazepide ; Male ; *Phenylurea Compounds ; Rats ; Rats, Inbred Strains ; Receptors, Cholecystokinin/drug effects/*physiology ; Satiation/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 93
    facet.materialart.
    Unknown
    Spatial selectivity of rat hippocampal neurons: dependence on preparedness for movement (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-30
    Description: The mammalian hippocampal formation appears to play a major role in the generation of internal representations of spatial relationships. In rats, this role is reflected in the spatially selective discharge of hippocampal pyramidal cells. The principal metric for coding spatial relationships might be the organism's own movements in space, that is, the spatial relationship between two locations is coded in terms of the movements executed in getting from one to the other. Thus, information from the motor programming systems (or "motor set") may contribute to coding of spatial location by hippocampal neurons. Spatially selective discharge of hippocampal neurons was abolished under conditions of restraint in which the animal had learned that locomotion was impossible. Therefore, hippocampal neuronal activity may reflect the association of movements with their spatial consequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foster, T C -- Castro, C A -- McNaughton, B L -- NS20331/NS/NINDS NIH HHS/ -- T32-HD07288/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1580-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Colorado, Boulder 80303.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740902" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electroencephalography ; Electrophysiology ; Hippocampus/*physiology ; Motor Activity/*physiology ; Neurons/*physiology ; Rats ; Restraint, Physical ; Space Perception/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 94
    facet.materialart.
    Unknown
    Limbic seizures increase neuronal production of messenger RNA for nerve growth factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-18
    Description: Nerve growth factor (NGF) produced by telencephalic neurons provides critical trophic support for cholinergic neurons of the basal forebrain. In situ hybridization and nuclease protection analyses demonstrate that limbic seizures dramatically increase the amount of messenger RNA for NGF in the neurons of the hippocampal dentate gyrus within 1 hour of seizure onset and in broadly distributed neocortical and olfactory forebrain neurons some hours later. The increased messenger RNA species is indistinguishable from messenger RNA for transcript B of the beta subunit of NGF from mouse submandibular gland. Thus, the expression of a known growth factor is affected by unusual physiological activity, suggesting one route through which trophic interactions between neurons in adult brain can be modified.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gall, C M -- Isackson, P J -- NS00915/NS/NINDS NIH HHS/ -- NS24747/NS/NINDS NIH HHS/ -- NS26748/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):758-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Neurobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549634" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoradiography ; Endonucleases ; Gene Expression Regulation ; Guinea Pigs ; Hippocampus/physiopathology ; Limbic System/*physiopathology ; Mice ; Nerve Growth Factors/*genetics ; Neurons/*metabolism ; Nucleic Acid Hybridization ; RNA Probes ; RNA, Messenger/*biosynthesis ; Rats ; Seizures/*metabolism ; Single-Strand Specific DNA and RNA Endonucleases ; Telencephalon/metabolism ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 95
    facet.materialart.
    Unknown
    Correction: RuGli cell line not of human origin (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gehlsen, K -- Engvall, E -- Dillner, L -- Ruoslahti, E -- Goodman, S -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):342-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526967" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Glioma ; Humans ; Isoenzymes/analysis ; Laminin/metabolism ; Rats ; Receptors, Immunologic/*analysis ; Receptors, Laminin ; *Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 96
    facet.materialart.
    Unknown
    Pretranslational suppression of an insulin-responsive glucose transporter in rats with diabetes mellitus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: A prominent feature of diabetes mellitus is the inability of insulin to appropriately increase the transport of glucose into target tissues. The contributions of different glucose transport proteins to insulin resistance in rats with streptozotocin-induced diabetes was evaluated. A glucose transporter messenger RNA and its cognate protein that are exclusively expressed in muscle and adipose tissue were specifically depleted in diabetic animals, and these effects were reversed after insulin therapy; a different glucose transporter and its messenger RNA that exhibit a less restricted tissue distribution were not specifically modulated in this way. Depletion of the muscle- and adipose-specific glucose transporter species correlates with and may account for the major portion of cellular insulin resistance in diabetes in these animals.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Garvey, W T -- Huecksteadt, T P -- Birnbaum, M J -- DK 38765/DK/NIDDK NIH HHS/ -- DK 39519/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):60-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section of Endocrinology and Metabolism, VA Medical Center, Indianapolis, IN.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2662408" target="_blank"〉PubMed〈/a〉
    Keywords: 3-O-Methylglucose ; Adipose Tissue/metabolism ; Animals ; Blood Glucose/metabolism ; Brain/metabolism ; Diabetes Mellitus, Experimental/drug therapy/*metabolism ; Insulin/*therapeutic use ; Male ; Methylglucosides/metabolism ; Monosaccharide Transport Proteins/*biosynthesis/genetics ; Muscles/metabolism ; Organ Specificity ; RNA, Messenger/genetics ; Rats ; Rats, Inbred Strains ; Reference Values ; *Suppression, Genetic ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 97
    facet.materialart.
    Unknown
    The role of excitatory amino acids and NMDA receptors in traumatic brain injury (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: Brain injury induced by fluid percussion in rats caused a marked elevation in extracellular glutamate and aspartate adjacent to the trauma site. This increase in excitatory amino acids was related to the severity of the injury and was associated with a reduction in cellular bioenergetic state and intracellular free magnesium. Treatment with the noncompetitive N-methyl-D-aspartate (NMDA) antagonist dextrophan or the competitive antagonist 3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid limited the resultant neurological dysfunction; dextrorphan treatment also improved the bioenergetic state after trauma and increased the intracellular free magnesium. Thus, excitatory amino acids contribute to delayed tissue damage after brain trauma; NMDA antagonists may be of benefit in treating acute head injury.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Faden, A I -- Demediuk, P -- Panter, S S -- Vink, R -- New York, N.Y. -- Science. 1989 May 19;244(4906):798-800.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of California, San Francisco.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2567056" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/analogs & derivatives/antagonists & inhibitors/*metabolism ; Binding, Competitive ; Brain/drug effects/metabolism ; Brain Injuries/drug therapy/*metabolism ; Dextrorphan/pharmacology/therapeutic use ; Glutamates/*metabolism ; Glutamic Acid ; Magnesium/metabolism ; Magnetic Resonance Spectroscopy ; Male ; N-Methylaspartate ; Phosphates/metabolism ; Phosphocreatine/metabolism ; Piperazines/pharmacology/therapeutic use ; Rats ; Rats, Inbred Strains ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/drug effects/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 98
    facet.materialart.
    Unknown
    The involvement of platelet activating factor in ovulation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Follicle rupture during ovulation is associated with inflammation-like changes. Because platelet activating factor (PAF) participates in the inflammatory process, the effect of a PAF-specific antagonist, BN52021, on the ovulatory response was tested in rats. BN52021, administered locally, inhibited follicle rupture in rats stimulated to ovulate with human chorionic gonadotropin (hCG). In addition to suppressing rupture of the follicles, this antagonist suppressed the hCG-stimulated increase in ovarian collagenolysis and vascular permeability. The inhibition of ovulation of BN52021 could be reversed by simultaneous administration of PAF. Furthermore, PAF partially reversed the blockage of ovulation by inhibitors of eicosanoid synthesis. Collectively, these results suggest the involvement of PAF in ovulation. Its role seems to be closely related to the metabolism of arachidonic acid. Thus, modulation of PAF action may serve as an additional target for regulation of reproduction via its action on ovulation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Abisogun, A O -- Braquet, P -- Tsafriri, A -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):381-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Hormone Research, Weizmann Institute of Science, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911750" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Capillary Permeability/drug effects ; Collagen/metabolism ; *Diterpenes ; Female ; Ginkgolides ; Lactones/pharmacology ; Ovary/blood supply ; *Ovulation ; Platelet Activating Factor/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 99
    facet.materialart.
    Unknown
    Expression of a cloned rat brain potassium channel in Xenopus oocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-14
    Description: Potassium channels are ubiquitous membrane proteins with essential roles in nervous tissue, but little is known about the relation between their function and their molecular structure. A complementary DNA library was made from rat hippocampus, and a complementary DNA clone (RBK-1) was isolated. The predicted sequence of the 495-amino acid protein is homologous to potassium channel proteins encoded by the Shaker locus of Drosophila and differs by only three amino acids from the expected product of a mouse clone MBK-1. Messenger RNA transcribed from RBK-1 in vitro directed the expression of potassium channels when it was injected into Xenopus oocytes. The potassium current through the expressed channels resembles both the transient (or A) and the delayed rectifier currents reported in mammalian neurons and is sensitive to both 4-aminopyridine and tetraethylammonium.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Christie, M J -- Adelman, J P -- Douglass, J -- North, R A -- DA03160/DA/NIDA NIH HHS/ -- DA03161/DA/NIDA NIH HHS/ -- DA04154/DA/NIDA NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):221-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Vollum Institute, Oregon Health Sciences University, Portland 97201.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539643" target="_blank"〉PubMed〈/a〉
    Keywords: 4-Aminopyridine ; Amino Acid Sequence ; Aminopyridines/pharmacology ; Animals ; Base Sequence ; Brain/*metabolism ; Cloning, Molecular ; Membrane Potentials ; Membrane Proteins/genetics ; Molecular Sequence Data ; Oocytes/*metabolism ; Potassium/physiology ; Potassium Channels/drug effects/*metabolism ; Rats ; Tetraethylammonium ; Tetraethylammonium Compounds/pharmacology ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 100
    facet.materialart.
    Unknown
    Thymotaxin, a chemotactic protein, is identical to beta 2-microglobulin (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-10
    Description: Thymotaxin, an 11-kilodalton protein chemotactic for rat bone marrow hematopoietic precursors, was purified from media conditioned by a rat thymic epithelial cell line. The NH2-terminal sequence of thymotaxin was identical to that of rat beta 2-microglobulin (beta 2m). Antibodies to beta 2m removed thymotaxin activity from the fraction containing the 11-kilodalton protein. Chemotactic activity was observed with rat plasma beta 2m, human beta 2m, and mouse recombinant beta 2m, further supporting the identity of thymotaxin with beta 2m. The directional migration, as opposed to random movement, of the cells was also confirmed. The only rat bone marrow cells that migrated toward beta 2m were Thy1+ immature lymphoid cells devoid of T cell, B cell, and myeloid cell differentiation markers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dargemont, C -- Dunon, D -- Deugnier, M A -- Denoyelle, M -- Girault, J M -- Lederer, F -- Le, K H -- Godeau, F -- Thiery, J P -- Imhof, B A -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):803-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire de Physiopathologie du Developpement CNRS, Paris, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683083" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bone Marrow Cells ; Cell Line ; Cell Movement/drug effects ; Chemotactic Factors/*pharmacology ; *Chemotaxis ; Chromatography, Gel ; Chromatography, High Pressure Liquid ; Electrophoresis, Polyacrylamide Gel ; Granulocytes/drug effects ; Hematopoietic Stem Cells/drug effects ; Rats ; beta 2-Microglobulin/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...