ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (1,326)
  • Cells, Cultured  (513)
  • American Association for the Advancement of Science (AAAS)  (1,720)
  • Annual Reviews
  • Elsevier
  • Nature Publishing Group
  • 2005-2009  (327)
  • 1985-1989  (549)
  • 1980-1984  (844)
  • 1940-1944
Collection
Keywords
Publisher
Years
Year
  • 1
    facet.materialart.
    Unknown
    Molecular cloning of odorant-binding protein: member of a ligand carrier family (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-07-15
    Description: Odorant-binding protein (OBP) is found in nasal epithelium, and it selectively binds odorants. Three complementary DNAs encoding rat odorant-binding protein have now been cloned and sequenced. One clone contains an open reading frame predicted to encode an 18,091-dalton protein. RNA blot analysis confirms the localization of OBP messenger RNA in the nasal epithelium. This OBP has 33 percent amino acid identity to alpha 2-microglobulin, a secreted plasma protein. Other members of an alpha 2-microglobulin superfamily bind and transport hydrophobic ligands. Thus, OBP probably binds and carries odorants within the nasal epithelium to putative olfactory receptors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pevsner, J -- Reed, R R -- Feinstein, P G -- Snyder, S H -- DA-00074/DA/NIDA NIH HHS/ -- GM-07626/GM/NIGMS NIH HHS/ -- P01 CA16519-13/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 15;241(4863):336-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388043" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Carrier Proteins/*genetics ; Cloning, Molecular ; Ligands ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Nasal Mucosa/*physiology ; Rats ; *Receptors, Odorant ; Smell/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Transient expression shows ligand gating and allosteric potentiation of GABAA receptor subunits (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-02
    Description: Human gamma-aminobutyric acid A (GABAA) receptor subunits were expressed transiently in cultured mammalian cells. This expression system allows the simultaneous characterization of ligand-gated ion channels by electrophysiology and by pharmacology. Thus, coexpression of the alpha and beta subunits of the GABAA receptor generated GABA-gated chloride channels and binding sites for GABAA receptor ligands. Channels consisting of only alpha or beta subunits could also be detected. These homomeric channels formed with reduced efficiencies compared to the heteromeric receptors. Both of these homomeric GABA-responsive channels were potentiated by barbiturate, indicating that sites for both ligand-gating and allosteric potentiation are present on receptors assembled from either subunit.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pritchett, D B -- Sontheimer, H -- Gorman, C M -- Kettenmann, H -- Seeburg, P H -- Schofield, P R -- New York, N.Y. -- Science. 1988 Dec 2;242(4883):1306-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Neuroendocrinology, ZMBH, University of Heidelberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2848320" target="_blank"〉PubMed〈/a〉
    Keywords: Allosteric Regulation ; Blotting, Northern ; Cells, Cultured ; Chloride Channels ; Chlorides/*physiology ; Cloning, Molecular ; Electric Conductivity ; Humans ; Macromolecular Substances ; Membrane Proteins/*physiology ; Muscimol/metabolism ; Receptors, GABA-A/*physiology/ultrastructure ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Heat shock is lethal to fibroblasts microinjected with antibodies against hsp70 (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-10-21
    Description: Synthesis of a small group of highly conserved proteins in response to elevated temperature and other agents that induce stress is a universal feature of prokaryotic and eukaryotic cells. Although correlative evidence suggests that these proteins play a role in enhancing survival during and after stress, there is no direct evidence to support this in mammalian cells. To assess the role of the most highly conserved heat shock protein (hsp) family during heat shock, affinity-purified monoclonal antibodies to hsp70 were introduced into fibroblasts by needle microinjection. In addition to impairing the heat-induced translocation of hsp70 proteins into the nucleus after mild heat shock treatment, injected cells were unable to survive a brief incubation at 45 degrees C. Cells injected with control antibodies survived a similar heat shock. These results indicate that functional hsp70 is required for survival of these cells during and after thermal stress.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riabowol, K T -- Mizzen, L A -- Welch, W J -- GM33551/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Oct 21;242(4877):433-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cold Spring Harbor Laboratory, NY 11724.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3175665" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies/administration & dosage ; Antigen-Antibody Complex ; Cell Survival ; Fibroblasts/cytology ; Heat-Shock Proteins/immunology/*physiology ; *Hot Temperature ; Microinjections ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Grafting genetically modified cells to the damaged brain: restorative effects of NGF expression (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-16
    Description: Fibroblasts were genetically modified to secrete nerve growth factor (NGF) by infection with a retroviral vector and then implanted into the brains of rats that had surgical lesions of the fimbria-fornix. The grafted cells survived and produced sufficient NGF to prevent the degeneration of cholinergic neurons that would die without treatment. In addition, the protected cholinergic cells sprouted axons that projected in the direction of the cellular source of NGF. These results indicate that a combination of gene transfer and intracerebral grafting may provide an effective treatment for some disorders of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenberg, M B -- Friedmann, T -- Robertson, R C -- Tuszynski, M -- Wolff, J A -- Breakefield, X O -- Gage, F H -- AG06088/AG/NIA NIH HHS/ -- HD20034/HD/NICHD NIH HHS/ -- NS24279/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1575-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, University of California School of Medicine, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201248" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholinesterase/metabolism ; Animals ; Brain/cytology/enzymology/*pathology ; Cell Survival ; DNA/genetics ; Fibroblasts/metabolism/*transplantation ; Genetic Vectors ; Histocytochemistry ; Moloney murine leukemia virus/genetics ; Nerve Growth Factors/genetics/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Expression of c-fos protein in brain: metabolic mapping at the cellular level (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-06-03
    Description: The proto-oncogene c-fos is expressed in neurons in response to direct stimulation by growth factors and neurotransmitters. In order to determine whether the c-fos protein (Fos) and Fos-related proteins can be induced in response to polysynaptic activation, rat hindlimb motor/sensory cortex was stimulated electrically and Fos expression examined immunohistochemically. Three hours after the onset of stimulation, focal nuclear Fos staining was seen in motor and sensory thalamus, pontine nuclei, globus pallidus, and cerebellum. Moreover, 24-hour water deprivation resulted in Fos expression in paraventricular and supraoptic nuclei. Fos immunohistochemistry therefore provides a cellular method to label polysynaptically activated neurons and thereby map functional pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagar, S M -- Sharp, F R -- Curran, T -- EY05721/EY/NEI NIH HHS/ -- NS24666/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 3;240(4857):1328-31.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of California, San Francisco.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3131879" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/*metabolism ; Cell Nucleus/metabolism ; Cerebellum/metabolism ; Cerebral Cortex/metabolism ; Electric Stimulation ; *Gene Expression Regulation ; Globus Pallidus/metabolism ; Hippocampus/metabolism ; Hypothalamus/metabolism ; Immunohistochemistry ; Motor Cortex/physiology ; Neurons/metabolism ; Pons/metabolism ; Proto-Oncogene Proteins/*genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Thalamus/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Molecular crowding on the cell surface (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-01-01
    Description: Strong steric interactions among proteins on crowded living cell surfaces were revealed by measurements of the equilibrium spatial distributions of proteins in applied potential gradients. The fraction of accessible surface occupied by mobile surface proteins can be accurately represented by including steric exclusion in the statistical thermodynamic analysis of the data. The analyses revealed enhanced, concentration-dependent activity coefficients, implying unanticipated thermodynamic activity even at typical cell surface receptor concentrations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ryan, T A -- Myers, J -- Holowka, D -- Baird, B -- Webb, W W -- AI18306/AI/NIAID NIH HHS/ -- AI22449/AI/NIAID NIH HHS/ -- GM33028/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jan 1;239(4835):61-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physics, Cornell University, Ithaca, NY 14853.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2962287" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Membrane/*physiology ; *Membrane Fluidity ; Membrane Proteins/*physiology ; Rats ; Receptors, Fc/physiology ; Receptors, IgE ; Thermodynamics ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    cAMP evokes long-term facilitation in Aplysia sensory neurons that requires new protein synthesis (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-06-17
    Description: Behavioral sensitization leads to both short- and long-term enhancement of synaptic transmission between the sensory and motor neurons of the gill-withdrawal reflex in Aplysia. Serotonin (5-HT), a transmitter important for short-term sensitization, can evoke long-term enhancement of synaptic strength detected 1 day later. Because 5-HT mediates short-term facilitation through adenosine 3',5'-monophosphate (cAMP)-dependent protein phosphorylation, the role of cAMP in the long-term modulation of this identified synapse was examined. Like 5-HT, cAMP can also evoke long-term facilitation lasting 24 hours. Unlike the short-term change, the long-lasting change is blocked by anisomycin, a reversible inhibitor of protein synthesis, and therefore must involve the synthesis of gene products not required for the short-term change.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schacher, S -- Castellucci, V F -- Kandel, E R -- GM 32099/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1667-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Neurobiology and Behavior, Howard Hughes Medical Institute, College of Physicians and Surgeons of Columbia University, New York State Psychiatric Institute, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2454509" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-3-isobutylxanthine/pharmacology ; Animals ; Anisomycin/pharmacology ; Aplysia/*physiology ; Cells, Cultured ; Cyclic AMP/analogs & derivatives/*pharmacology ; Evoked Potentials/drug effects ; Motor Neurons/physiology ; Neurons, Afferent/drug effects/*physiology ; *Protein Biosynthesis ; Serotonin/pharmacology ; Synapses/drug effects/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    Mammalian glucocorticoid receptor derivatives enhance transcription in yeast (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-08-19
    Description: In mammalian cells, the glucocorticoid receptor binds specifically to glucocorticoid response element (GRE) DNA sequences and enhances transcription from linked promoters. It is shown here that derivatives of the glucocorticoid receptor also enhance transcription when expressed in yeast. Receptor-mediated enhancement in yeast was observed in fusions of GRE sequences to the yeast cytochrome c1 (CYC1) promoter; the CYC1 upstream activator sequences were not essential, since enhancement was observed in fusions of GREs to mutant CYC1 promoters retaining only the TATA region and transcription startpoints. It is concluded that the receptor operates by a common, highly conserved mechanism in yeast and mammalian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schena, M -- Yamamoto, K R -- CA20535-12/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Aug 19;241(4868):965-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3043665" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; DNA/metabolism ; *Enhancer Elements, Genetic ; Gene Expression Regulation ; Immunoassay ; Plasmids ; Promoter Regions, Genetic ; Rats ; Receptors, Glucocorticoid/*genetics ; Saccharomyces cerevisiae/*genetics ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    The ras oncogenes increase the intrinsic resistance of NIH 3T3 cells to ionizing radiation (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-02-05
    Description: Identification of genes that function to protect cells from radiation damage is an essential step in understanding the molecular mechanisms by which mammalian cells cope with ionizing radiation. The intrinsic radiation resistance (D0) of NIH 3T3 cells was markedly and significantly increased by transformation with ras oncogenes activated by missense mutations. This radiobiologic activity appeared to be a specific consequence of the ras mutations rather than of transformation, since revertant cells that contained functional ras genes (but were no longer phenotypically transformed) retained their increased D0's.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sklar, M D -- CA 41166/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Feb 5;239(4840):645-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor 48109.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3277276" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Survival/*radiation effects ; Cell Transformation, Neoplastic ; Cells, Cultured ; Clone Cells ; Dose-Response Relationship, Radiation ; *Genes, ras ; Mice ; Mice, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    Astrocytes synthesize angiotensinogen in brain (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-09
    Description: Cell types associated with angiotensinogen mRNA in rat brain were identified in individual brain sections by in situ hybridization with tritiated RNA probes or with a sulfur-35--labeled oligonucleotide combined with immunocytochemical detection of either glial fibrillary acidic protein (GFAP) for astrocytes or microtubule-associated protein (MAP-2) for neurons. Autoradiography revealed silver grains clustered primarily over GFAP-reactive soma and processes; most grain clusters were not associated with MAP-2--reactive cells. These results demonstrate that, in contrast to other known neuropeptide precursors, angiotensinogen is synthesized by glia.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stornetta, R L -- Hawelu-Johnson, C L -- Guyenet, P G -- Lynch, K R -- R01 HL33513/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1444-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201232" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensinogen/*biosynthesis/genetics ; Animals ; Astrocytes/*metabolism ; Brain/*metabolism ; Glial Fibrillary Acidic Protein/analysis ; Histocytochemistry ; Microtubule-Associated Proteins/analysis ; Nucleic Acid Hybridization ; RNA, Messenger/analysis/genetics ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 11
    facet.materialart.
    Unknown
    Cryopreservation, culture, and transplantation of human fetal mesencephalic tissue into monkeys (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-11-04
    Description: Studies in animals suggest that fetal neural grafts might restore lost neurological function in Parkinson's disease. In monkeys, such grafts survive for many months and reverse signs of parkinsonism, without attendant graft rejection. The successful and reliable application of a similar transplantation procedure to human patients, however, will require neural tissue obtained from human fetal cadavers, with demonstrated cellular identity, viability, and biological safety. In this report, human fetal neural tissue was successfully grafted into the brains of monkeys. Neural tissue was collected from human fetal cadavers after 9 to 12 weeks of gestation and cryopreserved in liquid nitrogen. Viability after up to 2 months of storage was demonstrated by cell culture and by transplantation into monkeys. Cryopreservation and storage of human fetal neural tissue would allow formation of a tissue bank. The stored cells could then be specifically tested to assure their cellular identity, viability, and bacteriological and virological safety before clinical use. The capacity to collect and maintain viable human fetal neural tissue would also facilitate research efforts to understand the development and function of the human brain and provide opportunities to study neurological diseases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Redmond, D E Jr -- Naftolin, F -- Collier, T J -- Leranth, C -- Robbins, R J -- Sladek, C D -- Roth, R H -- Sladek, J R Jr -- New York, N.Y. -- Science. 1988 Nov 4;242(4879):768-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Yale University School of Medicine, New Haven, CT 06510.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2903552" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Survival ; Cells, Cultured ; Cercopithecus ; Fetus ; Freezing ; Humans ; Male ; Mesencephalon/cytology/embryology/enzymology/*transplantation ; Preservation, Biological ; Transplantation, Heterologous ; Tyrosine 3-Monooxygenase/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 12
    facet.materialart.
    Unknown
    Synaptic reorganization in the hippocampus induced by abnormal functional activity (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-03-04
    Description: Abnormal functional activity induces long-lasting physiological alterations in neural pathways that may play a role in the development of epilepsy. The cellular mechanisms of these alterations are not well understood. One hypothesis is that abnormal activity causes structural reorganization of neural pathways and promotes epileptogenesis. This report provides morphological evidence that synchronous perforant path activation and kindling of limbic pathways induce axonal growth and synaptic reorganization in the hippocampus, in the absence of overt morphological damage. The results show a previously unrecognized anatomic plasticity associated with synchronous activity and development of epileptic seizures in neural pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sutula, T -- He, X X -- Cavazos, J -- Scott, G -- K07-NS00808/NS/NINDS NIH HHS/ -- R29-NS25020/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Mar 4;239(4844):1147-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, University of Wisconsin, Madison 53792.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2449733" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/ultrastructure ; Cytoplasmic Granules/ultrastructure ; Electric Stimulation ; Electrophysiology ; Hippocampus/physiopathology/*ultrastructure ; Histocytochemistry ; Kindling, Neurologic ; Microscopy, Electron ; Neural Pathways/ultrastructure ; Neurons/ultrastructure ; Rats ; Seizures/*pathology/physiopathology ; Staining and Labeling ; Synapses/*ultrastructure
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 13
    facet.materialart.
    Unknown
    Cloning of a membrane protein that induces a slow voltage-gated potassium current (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-11-18
    Description: A rat kidney messenger RNA that induces a slowly activating, voltage-dependent potassium current on its expression in Xenopus oocytes was identified by combining molecular cloning with an electrophysiological assay. The cloned complementary DNA encodes a novel membrane protein that consists of 130 amino acids with a single putative transmembrane domain. This protein differs from the known ion channel proteins but is involved in the induction of selective permeation of potassium ions by membrane depolarization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takumi, T -- Ohkubo, H -- Nakanishi, S -- New York, N.Y. -- Science. 1988 Nov 18;242(4881):1042-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Immunology, Kyoto University Faculty of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3194754" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cloning, Molecular ; DNA/genetics ; Electric Conductivity ; Membrane Potentials ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Molecular Weight ; Potassium Channels/*physiology ; Rats ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 14
    facet.materialart.
    Unknown
    Vasopressin mRNA in the suprachiasmatic nuclei: daily regulation of polyadenylate tail length (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-07-15
    Description: Daily variation has been found in the length of the polyadenylate tail attached to vasopressin messenger RNA in the suprachiasmatic nuclei, which is the location of an endogenous circadian pacemaker in mammals. No such variation was found in the supraoptic or paraventricular nuclei. This variation in the length of the polyadenylate tail may underlie the circadian rhythm of vasopressin peptide levels in cerebrospinal fluid and is a unique example of a daily rhythm in messenger RNA structure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Robinson, B G -- Frim, D M -- Schwartz, W J -- Majzoub, J A -- 1P50HL36568/HL/NHLBI NIH HHS/ -- R01NS24542/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 15;241(4863):342-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388044" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arginine Vasopressin/*physiology ; Biological Clocks ; Circadian Rhythm ; Gene Expression Regulation ; Poly A/*physiology ; RNA, Messenger/*physiology ; Rats ; Suprachiasmatic Nucleus/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 15
    facet.materialart.
    Unknown
    In situ transcription: specific synthesis of complementary DNA in fixed tissue sections (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-06-17
    Description: A technique, in situ transcription, is described, in which reverse transcription of mRNAs is achieved within fixed tissue sections. An oligonucleotide complementary to proopiomelanocortin (POMC) mRNA was used as a primer for the specific synthesis of radiolabeled POMC cDNA in fixed sections of rat pituitary, thus permitting the rapid anatomical localization of POMC mRNA by autoradiography. Intermediate lobe signal intensities were sensitive to dopaminergic drugs, demonstrating that the method can be used for studies of mRNA regulation. The transcripts may also be eluted from tissue sections for a variety of uses, including the identification and cloning of autoradiographically localized cDNAs from small amounts of tissue.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tecott, L H -- Barchas, J D -- Eberwine, J H -- DA-05010/DA/NIDA NIH HHS/ -- MH-23861/MH/NIMH NIH HHS/ -- MH09099/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1661-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Nancy Pritzker Laboratory of Behavioral Neurochemistry, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2454508" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/*biosynthesis ; Deoxycytidine/metabolism ; Electrophoresis, Polyacrylamide Gel ; Nucleic Acid Denaturation ; Nucleic Acid Hybridization ; Oligonucleotides/genetics ; Pituitary Gland/*metabolism ; Pro-Opiomelanocortin/*genetics ; RNA, Messenger/*metabolism ; RNA-Directed DNA Polymerase/metabolism ; Rats ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 16
    facet.materialart.
    Unknown
    Imaging of phosphorescence: a novel method for measuring oxygen distribution in perfused tissue (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-23
    Description: The imaging of phosphorescence provides a method for monitoring oxygen distribution within the vascular system of intact tissues. Isolated rat lives were perfused through the portal vein with media containing palladium coproporphyrin, which phosphoresced and was used to image the liver at various perfusion rates. Because oxygen is a powerful quenching agent for phosphors, the transition from well-perfused liver to anoxia (no flow of oxygen) resulted in large increases of phosphorescence. During stepwise restoration of oxygen flow, the phosphorescence images showed marked heterogeneous patterns of tissue reoxygenation, which indicated that there were regional inequalities in oxygen delivery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rumsey, W L -- Vanderkooi, J M -- Wilson, D F -- GM 21524/GM/NIGMS NIH HHS/ -- GM 36393/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1649-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of Pennsylvania School of Medicine, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3420417" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Coproporphyrins ; Liver Circulation ; *Luminescence ; Male ; Oxygen/*analysis ; Palladium ; Perfusion ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 17
    facet.materialart.
    Unknown
    Monocyte-derived human B-cell growth factor identified as interferon-beta 2 (BSF-2, IL-6) (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-01-29
    Description: Soluble products of either Epstein-Barr virus (EBV)-infected B cells or activated monocytes promote the proliferation of EBV-infected B cells and permit their growth at low cell densities. This suggests that growth factors are important for B-cell immortalization by EBV. In this study, a monocyte-derived factor that promotes the growth of EBV-infected b cells was purified and identified as interferon-beta 2 (IFN-beta 2), which is also known as 26-kilodalton protein, B-cell differentiation factor (BSF-2), and interleukin-6 (IL-6). The purified protein has a specific activity of approximately 4 X 10(7) units per milligram of protein in assays of B-cell growth. Thus, IFN-beta 2/BSF-2 is a B-cell growth factor that promotes the proliferation of human B cells infected with EBV.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tosato, G -- Seamon, K B -- Goldman, N D -- Sehgal, P B -- May, L T -- Washington, G C -- Jones, K D -- Pike, S E -- AI-16262/AI/NIAID NIH HHS/ -- CA-44365/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Jan 29;239(4839):502-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biochemistry and Biophysics, Food and Drug Administration, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2829354" target="_blank"〉PubMed〈/a〉
    Keywords: B-Lymphocytes/*cytology/microbiology ; Cell Count ; Cell Division ; Cells, Cultured ; Electrophoresis, Polyacrylamide Gel ; Herpesvirus 4, Human/*physiology ; Humans ; Immunoassay ; Interleukin-6 ; Interleukins/isolation & purification/*pharmacology ; Monocytes/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 18
    facet.materialart.
    Unknown
    Two mechanisms for the extinction of gene expression in hybrid cells (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-02
    Description: When two different mammalian cell types are fused to generate a stable hybrid cell line, genes that are active in only one of the parents are frequently shut off, a phenomenon called extinction. In this study two distinct, complementary mechanisms for such extinction of growth hormone gene expression were identified. In hybrids formed by fusing fibroblasts to pituitary cells, pituitary-specific proteins that bind to the growth hormone promoter were absent. In addition, a negative regulatory element located near the rat growth hormone promoter was specifically activated.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tripputi, P -- Guerin, S L -- Moore, D D -- New York, N.Y. -- Science. 1988 Sep 2;241(4870):1205-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2842865" target="_blank"〉PubMed〈/a〉
    Keywords: Acetyltransferases/genetics ; Animals ; Avian Sarcoma Viruses/genetics ; Chloramphenicol O-Acetyltransferase ; Enhancer Elements, Genetic ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Growth Hormone/*genetics ; Herpesviridae/genetics ; Hybrid Cells/*metabolism ; Hypoxanthine Phosphoribosyltransferase/genetics ; L Cells (Cell Line) ; Mice ; Pituitary Gland/metabolism ; Plasmids ; Promoter Regions, Genetic ; Rats ; Thymidine Kinase/genetics ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 19
    facet.materialart.
    Unknown
    Newly identified brain potassium channels gated by the guanine nucleotide binding protein Go (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-09
    Description: Potassium channels in neurons are linked by guanine nucleotide binding (G) proteins to numerous neurotransmitter receptors. The ability of Go, the predominant G protein in the brain, to stimulate potassium channels was tested in cell-free membrane patches of hippocampal pyramidal neurons. Four distinct types of potassium channels, which were otherwise quiescent, were activated by both isolated brain G0 and recombinant Go alpha. Hence brain Go can couple diverse brain potassium channels to neurotransmitter receptors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉VanDongen, A M -- Codina, J -- Olate, J -- Mattera, R -- Joho, R -- Birnbaumer, L -- Brown, A M -- DK-19318/DK/NIDDK NIH HHS/ -- HL-31154/HL/NHLBI NIH HHS/ -- HL-37044/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1433-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Molecular Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3144040" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Imidodiphosphate/pharmacology ; Animals ; Cattle ; Electric Conductivity ; GTP-Binding Proteins/*pharmacology ; Hippocampus/*physiology ; In Vitro Techniques ; Kinetics ; Macromolecular Substances ; Membrane Potentials/drug effects ; Potassium Channels/drug effects/*physiology ; Pyramidal Tracts/physiology ; Rats ; Recombinant Proteins/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 20
    facet.materialart.
    Unknown
    Identification of an intracellular peptide segment involved in sodium channel inactivation (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-23
    Description: Antibodies directed against a conserved intracellular segment of the sodium channel alpha subunit slow the inactivation of sodium channels in rat muscle cells. Of four site-directed antibodies tested, only antibodies against the short intracellular segment between homologous transmembrane domains III and IV slowed inactivation, and their effects were blocked by the corresponding peptide antigen. No effects on the voltage dependence of sodium channel activation or of steady-state inactivation were observed, but the rate of onset of the antibody effect and the extent of slowing of inactivation were voltage-dependent. Antibody binding was more rapid at negative potentials, at which sodium channels are not inactivated; antibody-induced slowing of inactivation was greater during depolarizations to more positive membrane potentials. The peptide segment recognized by this antibody appears to participate directly in rapid sodium channel inactivation during large depolarizations and to undergo a conformational change that reduces its accessibility to antibodies as the channel inactivates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Vassilev, P M -- Scheuer, T -- Catterall, W A -- NS 15751/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Washington, School of Medicine, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2458625" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies ; Cytoplasm/analysis ; In Vitro Techniques ; Ion Channels/*metabolism ; Membrane Potentials ; Molecular Sequence Data ; Peptides/*metabolism ; Rats ; Sodium/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 21
    facet.materialart.
    Unknown
    Modulation of acetylcholine receptor desensitization by forskolin is independent of cAMP (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-06-17
    Description: Biochemical and electrophysiological studies suggest that adenosine 3',5'-monophosphate (cAMP)-dependent phosphorylation of the nicotinic acetylcholine receptor channel is functionally significant because it modifies the receptor's rate of desensitization to acetylcholine. In studies that support this conclusion researchers have used forskolin to stimulate cAMP-dependent phosphorylation in intact muscle. It is now shown that although forskolin facilitated desensitization in voltage-clamped rat muscle, this effect was not correlated with the abilities of forskolin and forskolin analogs to activate adenylate cyclase or phosphorylate the receptor. Furthermore, elevation of intracellular cAMP or addition of the catalytic subunit of A-kinase failed to alter desensitization. Therefore, in intact skeletal muscle, cAMP-dependent phosphorylation does not modulate desensitization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wagoner, P K -- Pallotta, B S -- GM32211/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1655-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Pharmacology, Glaxo Research Laboratories, Chapel Hill, NC 27599.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2454507" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-3-isobutylxanthine/pharmacology ; Acetylcholine/pharmacology ; Adenylyl Cyclases/metabolism ; Animals ; Bucladesine/pharmacology ; Colforsin/*pharmacology ; Cyclic AMP/analogs & derivatives/*pharmacology ; Electric Conductivity ; Enzyme Activation/drug effects ; Kinetics ; Muscles/*metabolism ; Phosphorylation ; Rats ; Receptors, Cholinergic/drug effects/*physiology ; Torpedo/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 22
    facet.materialart.
    Unknown
    Functional expression of a new pharmacological subtype of brain nicotinic acetylcholine receptor (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-04-15
    Description: A new type of agonist-binding subunit of rat neuronal nicotinic acetylcholine receptors (nAChRs) was identified. Rat genomic DNA and complementary DNA encoding this subunit (alpha 2) were cloned and analyzed. Complementary DNA expression studies in Xenopus oocytes revealed that the injection of messenger RNAs (mRNAs) for alpha 2 and beta 2 (a neuronal nAChR subunit) led to the generation of a functional nAChR. In contrast to the other known neuronal nAChRs, the receptor produced by the injection of alpha 2 and beta 2 mRNAs was resistant to the alpha-neurotoxin Bgt3.1. In situ hybridization histochemistry showed that alpha 2 mRNA was expressed in a small number of regions, in contrast to the wide distribution of the other known agonist-binding subunits (alpha 3 and alpha 4) mRNAs. These results demonstrate that the alpha 2 subunit differs from other known agonist-binding alpha-subunits of nAChRs in its distribution in the brain and in its pharmacology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wada, K -- Ballivet, M -- Boulter, J -- Connolly, J -- Wada, E -- Deneris, E S -- Swanson, L W -- Heinemann, S -- Patrick, J -- New York, N.Y. -- Science. 1988 Apr 15;240(4850):330-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Salk Institute for Biological Studies, San Diego, CA 92138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2832952" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Brain/*metabolism ; DNA Restriction Enzymes ; Female ; *Genes ; Molecular Sequence Data ; Neurons/metabolism ; Nucleotide Mapping ; Oocytes/metabolism ; Rats ; Receptors, Nicotinic/*genetics/metabolism ; Transcription, Genetic ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 23
    facet.materialart.
    Unknown
    Clonally related cortical cells show several migration patterns (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-09
    Description: The mammalian cerebral cortex is organized into columns of cells with common functional properties. During embryogenesis, cortical neurons are formed deep, near the lateral ventricles, and migrate radially to their final position. This observation led to the suggestion that the cortex consists of radial, ontogenetic units of clonally related neurons. In the experiments reported here, this hypothesis was tested by studying cell lineage in the rat cortex with a retroviral vector carrying the Escherichia coli beta-galactosidase gene, which can be easily visualized. Labeled, clonally related cortical neurons did not occur in simple columnar arrays. Instead, clonally related neurons entered several different radial columns, apparently by migrating along different radial glial fibers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Walsh, C -- Cepko, C L -- EY07331-01/EY/NEI NIH HHS/ -- R01 NS 23021-01/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1342-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3137660" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Movement ; Cerebral Cortex/cytology/*embryology ; Clone Cells ; Neuroglia/physiology ; Rats ; Transfection ; beta-Galactosidase/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 24
    facet.materialart.
    Unknown
    Muscarinic depression of long-term potentiation in CA3 hippocampal neurons (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-10-07
    Description: Behavioral studies have suggested that muscarinic cholinergic systems have an important role in learning and memory. A muscarinic cholinergic agonist is now shown to affect synaptic plasticity in the CA3 region of the hippocampal slice. Long-term potentiation (LTP) of the mossy fiber-CA3 synapse was blocked by muscarine. Low concentrations of muscarine (1 micromolar) had little effect on low-frequency (0.2 hertz) synaptic stimulation but did significantly reduce the magnitude and probability of induction of LTP. Experiments under voltage clamp showed that muscarine blocked the increase in excitatory synaptic conductance normally associated with LTP at this synapse. These results suggest a possible role for cholinergic systems in synaptic plasticity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Williams, S -- Johnston, D -- HL31164/HL/NHLBI NIH HHS/ -- NS11535/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Oct 7;242(4875):84-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2845578" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Electric Stimulation ; Evoked Potentials/drug effects ; Hippocampus/drug effects/*physiology ; In Vitro Techniques ; Muscarine/*pharmacology ; Neurons/drug effects/*physiology ; Pyramidal Tracts/drug effects/*physiology ; Rats ; Reference Values ; Synapses/physiology ; Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 25
    facet.materialart.
    Unknown
    Specific recognition of cruciform DNA by nuclear protein HMG1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 26
    facet.materialart.
    Unknown
    Endothelial interleukin-8: a novel inhibitor of leukocyte-endothelial interactions (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: Certain inflammatory stimuli render cultured human vascular endothelial cells hyperadhesive for neutrophils. This state is transient and reversible, in part because activated endothelial cells secrete a leukocyte adhesion inhibitor (LAI). LAI was identified as endothelial interleukin-8 (IL-8), the predominant species of which is an extended amino-terminal IL-8 variant. At nanomolar concentrations, purified endothelial IL-8 and recombinant human IL-8 inhibit neutrophil adhesion to cytokine-activated endothelial monolayers and protect these monolayers from neutrophil-mediated damage. These findings suggest that endothelial-derived IL-8 may function to attenuate inflammatory events at the interface between vessel wall and blood.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gimbrone, M A Jr -- Obin, M S -- Brock, A F -- Luis, E A -- Hass, P E -- Hebert, C A -- Yip, Y K -- Leung, D W -- Lowe, D G -- Kohr, W J -- P01-HL-36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1601-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688092" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Biological Factors/pharmacology ; Cell Adhesion/drug effects ; Cells, Cultured ; Chemotactic Factors/*isolation & purification/pharmacology ; Culture Media/analysis ; Cytokines ; Endothelium, Vascular/cytology/drug effects/*physiology ; Humans ; Interleukin-1/*pharmacology ; Interleukin-8 ; Interleukins/*isolation & purification/pharmacology ; Molecular Sequence Data ; Neutrophils/cytology/drug effects/*physiology ; Recombinant Proteins/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 27
    facet.materialart.
    Unknown
    Expression of functional nerve growth factor receptors after gene transfer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 28
    facet.materialart.
    Unknown
    Indole-2-carboxylic acid: a competitive antagonist of potentiation by glycine at the NMDA receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 29
    facet.materialart.
    Unknown
    Immunodeficiency and clonal growth of target cells induced by helper-free defective retrovirus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: The murine acquired immunodeficiency syndrome is induced by a defective retrovirus. To study the role of virus replication in this disease, helper-free stocks of defective Duplan virus were produced. These stocks were highly pathogenic in absence of detectable replicating murine leukemia viruses (MuLVs) other than xenotropic MuLV. They induced expansion of the infected cell population (over 1000-fold), and this cell expansion was oligoclonal in origin and, most likely, arose through cell division. These results suggest that this defective virus is oncogenic, inducing a primary neoplasia associated with an acquired immunodeficiency syndrome as a paraneoplastic syndrome. These data emphasize the need to determine whether virus replication is necessary for the progression of other immunodeficiency diseases, including acquired immunodeficiency syndrome, and whether these diseases also represent paraneoplastic syndromes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huang, M -- Simard, C -- Jolicoeur, P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1614-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Biology, Clinical Research Institute of Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Southern ; Cells, Cultured ; DNA, Viral/isolation & purification ; Defective Viruses/isolation & purification/*pathogenicity ; Helper Viruses/isolation & purification ; Immunologic Deficiency Syndromes/*microbiology ; Leukemia Virus, Murine/pathogenicity ; Lymph Nodes/microbiology ; Lymphocytes/microbiology ; Mice ; Mice, Inbred C57BL ; RNA-Directed DNA Polymerase/analysis ; Retroviridae/isolation & purification/*pathogenicity ; Retroviridae Infections/*microbiology ; Spleen/microbiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 30
    facet.materialart.
    Unknown
    Effects of glucocorticoids and norepinephrine on the excitability in the hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 31
    facet.materialart.
    Unknown
    Fibroblasts transformed with v-src show enhanced formation of an inositol tetrakisphosphate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 32
    facet.materialart.
    Unknown
    Golf: an olfactory neuron specific-G protein involved in odorant signal transduction (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 33
    facet.materialart.
    Unknown
    Localization and mobility of omega-conotoxin-sensitive Ca2+ channels in hippocampal CA1 neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: Voltage-dependent Ca2+ channels (VDCCs) are modulators of synaptic plasticity, oscillatory behavior, and rhythmic firing in brain regions such as the hippocampus. The distribution and lateral mobility of VDCCs on CA1 hippocampal neurons have been determined with biologically active fluorescent and biotinylated derivatives of the selective probe omega-conotoxin in conjunction with circular dityndallism, digital fluorescence imaging, and photobleach recovery microscopy. On noninnervated cell bodies, VDCCs were found to be organized in multiple clusters, whereas after innervation the VDCCs were concentrated and immobilized at synaptic contact sites. On dendrites, VDCC distribution was punctate and was interrupted by extensive bare regions or abruptly terminated. More than 85% of the dendritic VDCCs were found to be immobile by fluorescence photobleach recovery. Thus, before synaptic contact, specific mechanisms target, segregate, and immobilize VDCCs to neuronal cell bodies and to specialized dendritic sites. Regulation of this distribution may be critical in determining the firing activity and integrative properties of hippocampal CA1 neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, O T -- Kunze, D L -- Angelides, K J -- NS01218/NS/NINDS NIH HHS/ -- NS23575/NS/NINDS NIH HHS/ -- NS24606/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1189-93.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Molecular Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543080" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcium Channel Blockers/*pharmacology ; Calcium Channels/drug effects/*physiology ; Cells, Cultured ; Electric Conductivity ; Hippocampus/*physiology ; Membrane Potentials/drug effects ; Mollusk Venoms/*pharmacology ; Neurons/drug effects/*physiology ; Pyramidal Tracts/*physiology ; *omega-Conotoxins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 34
    facet.materialart.
    Unknown
    Increased expression of DNA cointroduced with nuclear protein in adult rat liver (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 35
    facet.materialart.
    Unknown
    Corticosteroid modulation of hippocampal potentials: increased effect with aging (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 36
    facet.materialart.
    Unknown
    Antisense RNA-induced reduction in murine TIMP levels confers oncogenicity on Swiss 3T3 cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-17
    Description: Mouse 3T3 cell lines capable of constitutively synthesizing an RNA complementary to the messenger RNA encoding TIMP, tissue inhibitor of metalloproteinases, were constructed by transfection with appropriate plasmid constructs. Many of the lines were down-modulated for TIMP messenger RNA levels and secreted less TIMP into the culture medium. In comparison to noninvasive, nontumorigenic controls, these cells not only were invasive in a human amnion invasion assay, but also were tumorigenic and metastatic in athymic mice. These results indicate that TIMP suppresses oncogenicity, at least in immortal murine 3T3 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Khokha, R -- Waterhouse, P -- Yagel, S -- Lala, P K -- Overall, C M -- Norton, G -- Denhardt, D T -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):947-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Western Ontario, London, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2465572" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Cells, Cultured ; Enzyme Inhibitors/*genetics/metabolism ; Female ; Metalloendopeptidases/antagonists & inhibitors ; Mice ; Mice, Nude ; Neoplasm Metastasis ; Pituitary Neoplasms/genetics/pathology ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors/genetics ; Tissue Inhibitor of Metalloproteinases ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 37
    facet.materialart.
    Unknown
    Potassium channels in cardiac cells activated by arachidonic acid and phospholipids (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 38
    facet.materialart.
    Unknown
    The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 39
    facet.materialart.
    Unknown
    The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 40
    facet.materialart.
    Unknown
    Purification and complementary DNA cloning of a receptor for basic fibroblast growth factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: Basic fibroblast growth factor (bFGF) participates in many processes including early developmental events, angiogenesis, wound healing, and maintenance of neuronal cell viability. A 130-kilodalton protein was isolated on the basis of its ability to specifically bind to bFGF. A complementary DNA clone was isolated with an oligonucleotide probe corresponding to determined amino acid sequences of tryptic peptide fragments of the purified protein. The putative bFGF receptor encoded by this complementary DNA is a transmembrane protein that contains three extracellular immunoglobulin-like domains, an unusual acidic region, and an intracellular tyrosine kinase domain. These domains are arranged in a pattern that is different from that of any growth factor receptor described.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, P L -- Johnson, D E -- Cousens, L S -- Fried, V A -- Williams, L T -- CA 21765/CA/NCI NIH HHS/ -- R01 HL32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):57-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544996" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cells, Cultured ; Chick Embryo ; *Cloning, Molecular ; DNA/*genetics ; Fibroblast Growth Factors/*genetics ; Kinetics ; Mice ; Molecular Sequence Data ; Peptide Fragments/analysis ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Fibroblast Growth Factor ; Recombinant Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 41
    facet.materialart.
    Unknown
    Secretion of activin by interstitial cells in the testis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 42
    facet.materialart.
    Unknown
    Atrial natriuretic peptide inhibits a cation channel in renal inner medullary collecting duct cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 43
    facet.materialart.
    Unknown
    Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 44
    facet.materialart.
    Unknown
    Specific block of calcium channel expression by a fragment of dihydropyridine receptor cDNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 45
    facet.materialart.
    Unknown
    Pavlovian conditioning of rat mucosal mast cells to secrete rat mast cell protease II (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 46
    facet.materialart.
    Unknown
    Relation of the amyloid beta protein precursor to heparan sulfate proteoglycans (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 47
    facet.materialart.
    Unknown
    Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 48
    facet.materialart.
    Unknown
    A pertussis toxin-sensitive G protein in hippocampal long-term potentiation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 49
    facet.materialart.
    Unknown
    Quisqualate activates a rapidly inactivating high conductance ionic channel in hippocampal neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 50
    facet.materialart.
    Unknown
    Beta-adrenergic inhibition of cardiac sodium channels by dual G-protein pathways (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 51
    facet.materialart.
    Unknown
    Brain region and gene specificity of neuropeptide gene expression in cultured astrocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 52
    facet.materialart.
    Unknown
    Inescapable versus escapable shock modulates long-term potentiation in the rat hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 53
    facet.materialart.
    Unknown
    Commitment of neural crest cells to the sensory neuron lineage (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-24
    Description: Clonal cultures and monoclonal antibodies against a lineage-specific epitope, stage-specific embryonic antigen-1 (SSEA-1) were used to analyze the commitment of quail neural crest cells to the sensory neuron pathway. There were two distinct populations of sensory cells at the time of gangliogenesis. Postmitotic neuroblasts that remained in close association with the neural tube coexisted with a large number of pluripotent cells that formed the leading edge of the emigrating cells and gave rise to sensory and autonomic neuroblasts and to melanocytes. The data suggest a dual origin of spinal sensory neuroblasts and a predominantly late divergence of the autonomic and sensory lineages.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sieber-Blum, M -- HD21423/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Cellular Biology, Medical College of Wisconsin, Milwaukee 53226.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2564699" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal/immunology ; Antigens, CD15 ; Cell Differentiation ; Cell Division ; Cells, Cultured ; Coturnix ; Glycolipids/*physiology ; Neural Crest/*cytology ; Neurons, Afferent/*embryology ; Pigmentation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 54
    facet.materialart.
    Unknown
    The neuronal growth-associated protein GAP-43 induces filopodia in non-neuronal cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: The neuron-specific protein GAP-43 is associated with the membrane of the nerve growth cone and thus may be important to the activity of this distinctive neuronal structure. Transient transfection of COS and NIH 3T3 cells with appropriate vectors resulted in expression of GAP-43 in these non-neuronal cells; as in neurons, transfected GAP-43 associated with the membrane. In addition, many long fine filopodial processes extended from the periphery of such transfected cells. Stable CHO cell lines expressing GAP-43 also exhibited processes that were more numerous, far longer, and more complex than those of CHO cell lines not transfected or transfected with control plasmids. Thus GAP-43 may directly contribute to growth cone activity by regulating cell membrane structure and enhancing extension of filopodial processes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zuber, M X -- Goodman, D W -- Karns, L R -- Fishman, M C -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1193-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Developmental Biology Laboratory, Massachusetts General Hospital Cancer Center, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658062" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; Cell Membrane/*ultrastructure ; Cells, Cultured ; Fluorescent Antibody Technique ; GAP-43 Protein ; Growth Substances/*physiology ; Membrane Proteins/genetics/*physiology ; Mice ; Nerve Tissue Proteins/genetics/*physiology ; Recombinant Proteins/pharmacology ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 55
    facet.materialart.
    Unknown
    Transneuronal transfer of herpes virus from peripheral nerves to cortex and brainstem (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 56
    facet.materialart.
    Unknown
    In vitro transcription enhancement by purified derivatives of the glucocorticoid receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 57
    facet.materialart.
    Unknown
    Pathological changes induced in cerebrocortical neurons by phencyclidine and related drugs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 58
    facet.materialart.
    Unknown
    Detecting mutations in human genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):737-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2783787" target="_blank"〉PubMed〈/a〉
    Keywords: Cells, Cultured ; Electrophoresis/methods ; Humans ; Hypoxanthine Phosphoribosyltransferase/genetics ; *Mutagenicity Tests ; T-Lymphocytes/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 59
    facet.materialart.
    Unknown
    Factors that predict individual vulnerability to amphetamine self-administration (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 60
    facet.materialart.
    Unknown
    Inhibitors of angiotensin-converting enzyme prevent myointimal proliferation after vascular injury (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 61
    facet.materialart.
    Unknown
    Role of Na+/H+ exchange by interferon-gamma in enhanced expression of JE and I-A beta genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-28
    Description: The rapid transductional sequences initiated by interferon-gamma (IFN-gamma) on binding to its receptor regulate functional and genomic responses in many cells but are not well defined. Induction of macrophage activation is an example of such functional and genomic changes in response to IFN-gamma. Addition of IFN-gamma to murine macrophages, at activating concentrations, produced rapid (within 60 seconds) alkalinization of the cytosol and a concomitant, rapid influx of 22Na+. Amiloride inhibited the ion fluxes and the accumulation of specific messenger RNA for two genes induced by IFN-gamma (the early gene JE and the beta chain of the class II major histocompatibility complex gene I-A). The data indicate that IFN-gamma initiates rapid exchange of Na+ and H+ by means of the Na+/H+ antiporter and that these amiloride-sensitive ion fluxes are important to some of the genomic effects of IFN-gamma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Prpic, V -- Yu, S F -- Figueiredo, F -- Hollenbach, P W -- Gawdi, G -- Herman, B -- Uhing, R J -- Adams, D O -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):469-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541500" target="_blank"〉PubMed〈/a〉
    Keywords: Amiloride/pharmacology ; Animals ; Carrier Proteins/antagonists & inhibitors/metabolism ; Cells, Cultured ; Cytosol/metabolism ; *Gene Expression Regulation ; Histocompatibility Antigens Class II/*genetics ; Hydrogen-Ion Concentration ; Interferon-gamma/*physiology ; Kinetics ; Macrophage Activation ; Macrophages/drug effects/metabolism ; Mice ; *Protons ; RNA, Messenger/biosynthesis ; Sodium/*metabolism ; Sodium-Hydrogen Antiporter
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 62
    facet.materialart.
    Unknown
    Interleukin-1 mitogenic activity for fibroblasts and smooth muscle cells is due to PDGF-AA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Both interleukin-1 (IL-1) and platelet-derived growth factor (PDGF) induce proliferation of cultured fibroblasts and smooth muscle cells. These polypeptide mediators are released by activated macrophages and other cell types in response to injury and are thought to have a role in tissue remodeling and a number of pathologic processes. Analysis of the kinetics of [3H]thymidine incorporation by cultured fibroblasts demonstrated that the response to IL-1 is delayed approximately 8 hours relative to their response to PDGF. IL-1 transiently stimulated expression of the PDGF A-chain gene, with maximum induction after approximately 2 hours. Subsequent synthesis and release of PDGF activity into the medium was detected as early as 4 hours after IL-1 stimulation, and downregulation of the binding site for the PDGF-AA isoform of PDGF followed PDGF-AA secretion. Antibodies to PDGF completely block the mitogenic response to IL-1. Therefore, the mitogenic activity of IL-1 for fibroblasts and smooth muscle cells appears to be indirect and mediated by induction of the PDGF A-chain gene.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raines, E W -- Dower, S K -- Ross, R -- HL-18645/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):393-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2783498" target="_blank"〉PubMed〈/a〉
    Keywords: Cells, Cultured ; Fibroblasts/cytology/*drug effects ; Gene Expression Regulation/drug effects ; Humans ; Interleukin-1/*pharmacology ; Muscle, Smooth/cytology/*drug effects ; Platelet-Derived Growth Factor/*physiology ; RNA, Messenger/genetics ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 63
    facet.materialart.
    Unknown
    Glial cell diversification in the rat optic nerve (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 64
    facet.materialart.
    Unknown
    A genetic polymorphism in the renin gene of Dahl rats cosegregates with blood pressure (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 65
    facet.materialart.
    Unknown
    elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 66
    facet.materialart.
    Unknown
    Autoimmune target in Heymann nephritis is a glycoprotein with homology to the LDL receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 67
    facet.materialart.
    Unknown
    Treatment with tin prevents the development of hypertension in spontaneously hypertensive rats (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 68
    facet.materialart.
    Unknown
    Tonic activation of NMDA receptors by ambient glutamate enhances excitability of neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 69
    facet.materialart.
    Unknown
    High-level recombinant gene expression in rabbit endothelial cells transduced by retroviral vectors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 70
    facet.materialart.
    Unknown
    The neostriatal mosaic: striatal patch-matrix organization is related to cortical lamination (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 71
    facet.materialart.
    Unknown
    Myristoylated and nonmyristoylated forms of a protein are phosphorylated by protein kinase C (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-27
    Description: Activation of protein kinase C is thought to require association of the kinase with the cell membrane. It has been assumed that cellular substrates for the kinase must likewise be associated with membranes, and previous studies with membrane-associated myristoylated proteins have supported this view. It is now shown that a mutation that prevents the normal amino-terminal myristoylation of a prominent cellular substrate of protein kinase C, and appears to prevent its membrane association, does not prevent the normal phosphorylation of this protein in intact cells in response to phorbol esters. Thus, membrane association may not be required in order for protein kinase C substrates to undergo phosphorylation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Graff, J M -- Gordon, J I -- Blackshear, P J -- 2T32-GM 07171/GM/NIGMS NIH HHS/ -- AI27179/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):503-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratories, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814478" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Chickens ; Enzyme Activation ; *Intracellular Signaling Peptides and Proteins ; Membrane Proteins/metabolism ; Mutation ; Myristic Acid ; Myristic Acids ; Phosphorylation ; Protein Kinase C/*metabolism ; Proteins/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 72
    facet.materialart.
    Unknown
    Identification of a thyroid hormone receptor that is pituitary-specific (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 73
    facet.materialart.
    Unknown
    Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 74
    facet.materialart.
    Unknown
    Isolation of a novel receptor cDNA establishes the existence of two PDGF receptor genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-10
    Description: A genomic sequence and cloned complementary DNA has been identified for a novel receptor-like gene of the PDGF receptor/CSF1 receptor subfamily (platelet-derived growth factor receptor/colony-stimulating factor type 1 receptor). The gene recognized a 6.4-kilobase transcript that was coexpressed in normal human tissues with the 5.3-kilobase PDGF receptor messenger RNA. Introduction of complementary DNA of the novel gene into COS-1 cells led to expression of proteins that were specifically detected with antiserum directed against a predicted peptide. When the new gene was transfected into COS-1 cells, a characteristic pattern of binding of the PDGF isoforms was observed, which was different from the pattern observed with the known PDGF receptor. Tyrosine phosphorylation of the receptor in response to the PDGF isoforms was also different from the known receptor. The new PDGF receptor gene was localized to chromosome 4q11-4q12. The existence of genes encoding two PDGF receptors that interact in a distinct manner with three different PDGF isoforms likely confers considerable regulatory flexibility in the functional responses to PDGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matsui, T -- Heidaran, M -- Miki, T -- Popescu, N -- La Rochelle, W -- Kraus, M -- Pierce, J -- Aaronson, S -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):800-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536956" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Cells, Cultured ; *Chromosomes, Human, Pair 4 ; Cloning, Molecular ; DNA/genetics ; Gene Expression Regulation ; *Genes ; Humans ; Molecular Sequence Data ; Multigene Family ; Platelet-Derived Growth Factor/*physiology ; Protein-Tyrosine Kinases/genetics ; RNA, Messenger/genetics ; Receptors, Cell Surface/*genetics ; Receptors, Platelet-Derived Growth Factor ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 75
    facet.materialart.
    Unknown
    The EGF receptor kinase substrate p35 in the floor plate of the embryonic rat CNS (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 76
    facet.materialart.
    Unknown
    Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 77
    facet.materialart.
    Unknown
    Novel sites of expression of functional angiotensin II receptors in the late gestation fetus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 78
    facet.materialart.
    Unknown
    Expression of high-affinity binding of human immunoglobulin E by transfected cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 79
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 80
    facet.materialart.
    Unknown
    Receptor-mediated drug delivery to macrophages in chemotherapy of leishmaniasis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-12
    Description: Methotrexate coupled to maleylated bovine serum albumin was taken up efficiently through the "scavenger" receptors present on macrophages and led to selective killing of intracellular Leishmania mexicana amazonensis amastigotes in cultured hamster peritoneal macrophages. The drug conjugate was nearly 100 times as effective as free methotrexate in eliminating the intracellular parasites. Furthermore, in a model of experimental cutaneous leishmaniasis in hamsters, the drug conjugate brought about more than 90% reduction in the size of footpad lesions within 11 days. In contrast, the free drug at a similar concentration did not significantly affect lesion size. These studies demonstrate the potential of receptor-mediated drug delivery in the therapy of macrophage-associated diseases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mukhopadhyay, A -- Chaudhuri, G -- Arora, S K -- Sehgal, S -- Basu, S K -- New York, N.Y. -- Science. 1989 May 12;244(4905):705-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Microbial Technology, Chandigarh, India.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2717947" target="_blank"〉PubMed〈/a〉
    Keywords: Albumins/*administration & dosage/metabolism ; Animals ; Cells, Cultured ; Cricetinae ; Female ; Kinetics ; Leishmania mexicana/*drug effects ; Leishmaniasis/*drug therapy ; Macrophages/metabolism/*parasitology ; Male ; *Membrane Proteins ; Mesocricetus ; Methotrexate/*administration & dosage/pharmacology/therapeutic use ; *Receptors, Immunologic/metabolism ; *Receptors, Lipoprotein ; Receptors, Scavenger ; Scavenger Receptors, Class B ; Serum Albumin, Bovine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 81
    facet.materialart.
    Unknown
    Regulation of calcium release is gated by calcium current, not gating charge, in cardiac myocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: In skeletal muscle, intramembrane charge movement initiates the processes that lead to the release of calcium from the sarcoplasmic reticulum. In cardiac muscle, in contrast, the similarity of the voltage dependence of developed tension and intracellular calcium transients to that of calcium current suggests that the calcium current may gate the release of calcium. Nevertheless, a mechanism similar to that of skeletal muscle continues to be postulated for cardiac muscle. By using rapid exchange (20 to 50 milliseconds) of the extracellular solutions in rat ventricular myocytes in which the intracellular calcium transients or cell shortening were measured, it has now been shown that the influx of calcium through the calcium channel is a mandatory link in the processes that couple membrane depolarization to the release of calcium. Thus, intramembrane charge movement does not contribute to the release of calcium in heart muscle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nabauer, M -- Callewaert, G -- Cleemann, L -- Morad, M -- R01-HL16152/HL/NHLBI NIH HHS/ -- R01-HL33720/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):800-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Pennsylvania, Department of Physiology, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543067" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Barium/metabolism/pharmacology ; Benzofurans ; Buffers ; Calcium/*metabolism ; Calcium Channels/*physiology ; Dialysis ; Egtazic Acid/pharmacology ; Extracellular Space/metabolism ; Fluorescent Dyes ; Fura-2 ; Heart/drug effects/*physiology ; Heart Ventricles ; Membrane Potentials ; Myocardial Contraction ; Rats ; Sarcoplasmic Reticulum/metabolism ; Sodium/metabolism ; Spectrometry, Fluorescence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 82
    facet.materialart.
    Unknown
    Angiotensin II: does it have a direct obligate role in ovulation? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Naftolin, F -- Andrade-Gordon, P -- Pellicer, A -- Palumbo, A -- Apa, R -- Zreik, T -- Yoon, T K -- DeCherney, A -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):870-1.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Obstetrics and Gynecology, Yale University, New Haven, CT 06510-8063.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772639" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Sarcosine-8-Isoleucine Angiotensin II/pharmacology ; Angiotensin II/*physiology ; Animals ; Chorionic Gonadotropin/pharmacology ; Female ; Gonadotropins, Equine/pharmacology ; *Ovulation ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/analysis ; Receptors, LH/analysis ; Saralasin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 83
    facet.materialart.
    Unknown
    Conserved repetitive epitope recognized by CD4+ clones from a malaria-immunized volunteer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: T cell clones obtained from a human volunteer immunized with Plasmodium falciparum sporozoites specifically recognized the native circumsporozoite (CS) antigen expressed on P. falciparum sporozoites, as well as bacteria- and yeast-derived recombinant falciparum CS proteins. The response of these CD4+ CD8- cells was species-specific, since the clones did not proliferate or secrete gamma interferon when challenged with sporozoites or recombinant CS proteins of other human, simian, or rodent malarias. The epitope recognized by the sporozoite-specific human T cell clones mapped to the 5' repeat region of the CS protein and was contained in the NANPNVDPNANP sequence.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nardin, E H -- Herrington, D A -- Davis, J -- Levine, M -- Stuber, D -- Takacs, B -- Caspers, P -- Barr, P -- Altszuler, R -- Clavijo, P -- AI25085/AI/NIAID NIH HHS/ -- AI62533/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1603-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical and Molecular Parasitology, New York University, NY 10010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, CD4/*immunology ; Antigens, Protozoan/*immunology ; Cells, Cultured ; Clone Cells ; Epitopes/*analysis ; Humans ; Interferon-gamma/biosynthesis ; Lymphocyte Activation ; Malaria/*immunology ; Molecular Sequence Data ; Plasmodium falciparum/*immunology ; *Protozoan Proteins ; Recombinant Proteins/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 84
    facet.materialart.
    Unknown
    Genetic and pharmacological suppression of oncogenic mutations in ras genes of yeast and humans (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: The activity of an oncoprotein and the secretion of a pheromone can be affected by an unusual protein modification. Specifically, posttranslational modification of yeast a-factor and Ras protein requires an intermediate of the cholesterol biosynthetic pathway. This modification is apparently essential for biological activity. Studies of yeast mutants blocked in sterol biosynthesis demonstrated that the membrane association and biological activation of the yeast Ras2 protein require mevalonate, a precursor of sterols and other isoprenes such as farnesyl pyrophosphate. Furthermore, drugs that inhibit mevalonate biosynthesis blocked the in vivo action of oncogenic derivatives of human Ras protein in the Xenopus oocyte assay. The same drugs and mutations also prevented the posttranslational processing and secretion of yeast a-factor, a peptide that is farnesylated. Thus, the mevalonate requirement for Ras activation may indicate that attachment of a mevalonate-derived (isoprenoid) moiety to Ras proteins is necessary for membrane association and biological function. These observations establish a connection between the cholesterol biosynthetic pathway and transformation by the ras oncogene and offer a novel pharmacological approach to investigating, and possibly controlling, ras-mediated malignant transformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schafer, W R -- Kim, R -- Sterne, R -- Thorner, J -- Kim, S H -- Rine, J -- CA-45593/CA/NCI NIH HHS/ -- GM21841/GM/NIGMS NIH HHS/ -- GM31105/GM/NIGMS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):379-85.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569235" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Drosophila ; Electrophoresis, Polyacrylamide Gel ; Fungal Proteins/genetics/*metabolism ; *Genes, ras ; Humans ; Hydroxymethylglutaryl CoA Reductases/genetics ; Hydroxymethylglutaryl-CoA Synthase/genetics ; Immunoblotting ; Mevalonic Acid/biosynthesis ; Molecular Sequence Data ; Peptides/genetics/metabolism ; Precipitin Tests ; Protein Processing, Post-Translational ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins p21(ras) ; Saccharomyces cerevisiae/genetics/physiology ; *Saccharomyces cerevisiae Proteins ; *Suppression, Genetic ; Xenopus ; *ras Proteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 85
    facet.materialart.
    Unknown
    Protection of dentate hilar cells from prolonged stimulation by intracellular calcium chelation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-13
    Description: Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein-negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Scharfman, H E -- Schwartzkroin, P A -- NS-01744/NS/NINDS NIH HHS/ -- NS-15317/NS/NINDS NIH HHS/ -- NS-18895/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):257-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2508225" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Calcium/*metabolism ; Calcium-Binding Proteins/metabolism ; Egtazic Acid/pharmacology ; Electric Stimulation ; Female ; Hippocampus/cytology/drug effects/*physiology ; In Vitro Techniques ; Neurons/drug effects/physiology ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 86
    facet.materialart.
    Unknown
    Inhibition of antigen-induced lymphocyte proliferation by Tat protein from HIV-1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: The purified human immunodeficiency virus type-l (HIV-l) Tat protein inhibited lymphocyte proliferation induced by tetanus toxoid or Candida antigens by 66 to 97% at nanomolar concentrations of Tat. In contrast, Tat did not cause a significant reduction of lymphocyte proliferation in response to mitogens such as phytohemagglutinin or pokeweed mitogen. Inhibition was blocked by oxidation of the cysteine-rich region of Tat or by incubation with an antibody to Tat before the assay. A synthetic Tat peptide (residues 1 to 58) also inhibited antigen-stimulated proliferation. Experiments with H9 and U937 cell lines showed that Tat can easily enter both lymphocytes and monocytes. The specific inhibition of antigen-induced lymphocyte proliferation by Tat mimics the effect seen with lymphocytes from HIV-infected individuals and suggests that Tat might directly contribute to the immunosuppression associated with HIV infection.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Viscidi, R P -- Mayur, K -- Lederman, H M -- Frankel, A D -- AI29135/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1606-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556795" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/immunology ; Cells, Cultured ; Concanavalin A ; DNA Replication/drug effects ; Gene Products, tat/immunology/*pharmacology ; HIV-1/genetics/*immunology ; HeLa Cells/metabolism ; Humans ; Immunosuppression ; Lymphocyte Activation/*drug effects ; Lymphocytes/drug effects/immunology ; Pokeweed Mitogens ; Promoter Regions, Genetic ; Recombinant Proteins/immunology/pharmacology ; Staphylococcal Protein A ; Trans-Activators/*pharmacology ; Transcriptional Activation ; tat Gene Products, Human Immunodeficiency Virus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 87
    facet.materialart.
    Unknown
    Sindbis virus: an efficient, broad host range vector for gene expression in animal cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-03
    Description: Sindbis virus, an enveloped virus with a single-stranded RNA genome, was engineered to express a bacterial protein, chloramphenicol acetyltransferase (CAT), in cultured insect, avian, and mammalian cells. The vectors were self-replicating and gene expression was efficient and rapid; up to 10(8) CAT polypeptides were produced per infected cell in 16 to 20 hours. CAT expression could be made temperature-sensitive by means of a derivative that incorporated a temperature-sensitive mutation in viral RNA synthesis. Vector genomic RNAs were packaged into infectious particles when Sindbis helper virus was used to supply virion structural proteins. The vector RNAs were stable to at least seven cycles of infection. The expression of CAT increased about 10(3)-fold, despite a 10(15)-fold dilution during the passaging. Sindbis virus vectors should prove useful for expressing large quantities of gene products in a variety of animal cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Xiong, C -- Levis, R -- Shen, P -- Schlesinger, S -- Rice, C M -- Huang, H V -- AG05681/AG/NIA NIH HHS/ -- AI11377/AI/NIAID NIH HHS/ -- AI24134/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1188-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922607" target="_blank"〉PubMed〈/a〉
    Keywords: Aedes ; Animals ; Bacteria/enzymology ; Cells, Cultured ; Chick Embryo ; Chloramphenicol O-Acetyltransferase/*genetics ; Codon ; Cricetinae ; DNA/genetics ; Drosophila ; Gene Amplification ; Gene Expression Regulation ; *Genetic Engineering ; *Genetic Vectors ; Humans ; Quail ; RNA, Viral/*genetics ; Sindbis Virus/*genetics ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 88
    facet.materialart.
    Unknown
    Selective loss of hippocampal granule cells in the mature rat brain after adrenalectomy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Adrenalectomy of adult male rats resulted in a nearly complete loss of hippocampal granule cells 3 to 4 months after surgery. Nissl and immunocytochemical staining of hippocampal neurons revealed that the granule cell loss was selective; there was no apparent loss of hippocampal pyramidal cells or of gamma-amino butyric acid (GABA)-, somatostatin-, neuropeptide Y-, calcium binding protein-, or parvalbumin-containing hippocampal interneurons. The hippocampal CA1 pyramidal cells of adrenalectomized animals exhibited normal electrophysiological responses to afferent stimulation, whereas responses evoked in the dentate gyrus were severely attenuated. Corticosterone replacement prevented both the adrenalectomy-induced granule cell loss and the attenuated physiological response. Thus, the adrenal glands play a role in maintaining the structural integrity of the normal adult brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sloviter, R S -- Valiquette, G -- Abrams, G M -- Ronk, E C -- Sollas, A L -- Paul, L A -- Neubort, S -- NS18201/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):535-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurology Research Center, Helen Hayes Hospital, New York State Department of Health, West Haverstraw 10993.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911756" target="_blank"〉PubMed〈/a〉
    Keywords: *Adrenalectomy ; Animals ; Annexin A6 ; Calcium-Binding Proteins/analysis ; Corticosterone/pharmacology ; Cytoplasmic Granules ; Electrophysiology ; Evoked Potentials ; Hippocampus/*cytology/drug effects/physiology ; Immunohistochemistry ; Male ; Neurons/cytology/physiology ; Potassium/blood ; Rats ; Sodium/blood ; Weight Gain
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 89
    facet.materialart.
    Unknown
    Hyperpolarizing vasodilators activate ATP-sensitive K+ channels in arterial smooth muscle (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Vasodilators are used clinically for the treatment of hypertension and heart failure. The effects of some vasodilators seem to be mediated by membrane hyperpolarization. The molecular basis of this hyperpolarization has been investigated by examining the properties of single K+ channels in arterial smooth muscle cells. The presence of adenosine triphosphate (ATP)-sensitive K+ channels in these cells was demonstrated at the single channel level. These channels were opened by the hyperpolarizing vasodilator cromakalim and inhibited by the ATP-sensitive K+ channel blocker glibenclamide. Furthermore, in arterial rings the vasorelaxing actions of the drugs diazoxide, cromakalim, and pinacidil and the hyperpolarizing actions of vasoactive intestinal polypeptide and acetylcholine were blocked by inhibitors of the ATP-sensitive K+ channels, suggesting that all these agents may act through a common pathway in smooth muscle by opening ATP-sensitive K+ channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Standen, N B -- Quayle, J M -- Davies, N W -- Brayden, J E -- Huang, Y -- Nelson, M T -- HL 35911/HL/NHLBI NIH HHS/ -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):177-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Leicester, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501869" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholine/pharmacology ; Adenosine Triphosphate/*metabolism ; Animals ; Benzopyrans/antagonists & inhibitors/pharmacology ; Cerebral Arteries ; Cromakalim ; Diazoxide/pharmacology ; Glyburide/pharmacology ; Guanidines/pharmacology ; Mesenteric Arteries ; Muscle, Smooth, Vascular/*metabolism ; Pinacidil ; Potassium Channels/*drug effects/metabolism ; Pyrroles/antagonists & inhibitors/pharmacology ; Rabbits ; Rats ; Tolbutamide/pharmacology ; Vasoactive Intestinal Peptide/pharmacology ; Vasodilator Agents/antagonists & inhibitors/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 90
    facet.materialart.
    Unknown
    NMDA antagonists differentiate epileptogenesis from seizure expression in an in vitro model (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: In an electrographic model of seizures in the hippocampal slice, both of the N-methyl-D-aspartate (NMDA) antagonists 2-amino-5-phosphonovaleric acid and 5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohepten-5,10-imine maleate (MK-801) prevented the progressive development of seizures but did not block previously induced seizures. Thus, a process dependent on the NMDA receptor-ionophore complex establishes a long-lasting, seizure-prone state; thereafter the seizures depend on non-NMDA receptor-ionophore mechanisms. This suggests that there is an important distinction between epileptogenesis and seizure expression and between antiepileptogenic and anticonvulsant pharmacological agents.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stasheff, S F -- Anderson, W W -- Clark, S -- Wilson, W A -- NS 17771/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):648-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Epilepsy Center, Veterans Administration Medical Center, Durham, NC 27705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569762" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate ; Animals ; Anticonvulsants/pharmacology ; Aspartic Acid/*analogs & derivatives/antagonists & inhibitors ; Dibenzocycloheptenes/pharmacology ; *Disease Models, Animal ; Dizocilpine Maleate ; Electric Stimulation ; Electrophysiology ; Epilepsy/*physiopathology ; Evoked Potentials ; Hippocampus/*physiopathology ; In Vitro Techniques ; N-Methylaspartate ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Seizures/*physiopathology ; Valine/analogs & derivatives/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 91
    facet.materialart.
    Unknown
    Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The discovery that the AP-1 family of enhancer binding factors includes a complex of the cellular Fos (cFos) and cellular Jun (cJun) proteins established a direct and important link between oncogenesis and transcriptional regulation. Homodimeric cJun protein synthesized in vitro is capable of binding selectively to AP-1 recognition sites, whereas the cFos polypeptide is not. When cotranslated, the cFos and cJun proteins can form a stable, heterodimeric complex with the DNA binding properties of AP-1/cJun. The related proteins Jun B and vJun are also able to form DNA binding complexes with cFos. Directed mutagenesis of the cFos protein reveals that a leucine repeat structure is required for binding to cJun, in a manner consistent with the proposed function of the "leucine zipper." A novel domain adjacent to, but distinct from, the leucine repeat of cFos is required for DNA binding by cFos-cJun heterodimers. Thus experimental evidence is presented that leucine repeats can mediate complex formation between heterologous proteins and that promotes further understanding of the molecular mechanisms underlying the function of two proto-oncogene products.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turner, R -- Tjian, R -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1689-94.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494701" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Chromatography, Affinity ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation ; Humans ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Oncogenes ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 92
    facet.materialart.
    Unknown
    The cholinergic neuronal differentiation factor from heart cells is identical to leukemia inhibitory factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 93
    facet.materialart.
    Unknown
    Two NF1 translocations map within a 600-kilobase segment of 17q11.2 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-02
    Description: Balanced translocations, each involving chromosome 17q11.2, have been described in two patients with von Recklinghausen neurofibromatosis (NF1). To better localize the end points of these translocation events, and the NF1 gene (NF1) itself, human cosmids were isolated and mapped in the immediate vicinity of NF1. One cosmid probe, c11-1F10, demonstrated that both translocation breakpoints, and presumably NF1, are contained within a 600-kilobase Nru I fragment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Connell, P -- Leach, R -- Cawthon, R M -- Culver, M -- Stevens, J -- Viskochil, D -- Fournier, R E -- Rich, D C -- Ledbetter, D H -- White, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1087-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of Utah, Salt Lake City 84132.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543077" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Mapping ; *Chromosomes, Human, Pair 17 ; Cosmids ; DNA Restriction Enzymes ; Deoxyribonucleases, Type II Site-Specific ; Electrophoresis ; Genetic Linkage ; Humans ; Hybrid Cells ; Neurofibromatosis 1/*genetics ; Rats ; *Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 94
    facet.materialart.
    Unknown
    Parallel association of Fos and Jun leucine zippers juxtaposes DNA binding domains (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The protein products of the fos and jun proto-oncogenes form a heterodimeric complex that participates in a stable high affinity interaction with DNA elements containing AP-1 binding sites. The effects of deletions and point mutations in Fos and Jun on protein complex formation and DNA binding have been examined. The data suggest that Fos and Jun dimerize via a parallel interaction of helical domains containing a heptad repeat of leucine residues (the leucine zipper). Dimerization is required for DNA binding and results in the appropriate juxtaposition of basic amino acid regions from Fos and Jun, both of which are required for association with DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gentz, R -- Rauscher, F J 3rd -- Abate, C -- Curran, T -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1695-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Oncology, Roche Institute of Molecular Biology, Nutley, NJ 07110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494702" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Cross-Linking Reagents ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Glutaral ; Immunosorbent Techniques ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Protein Conformation ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 95
    facet.materialart.
    Unknown
    Histone H5 in the control of DNA synthesis and cell proliferation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: The linker histones (H1, H5, H1 degrees) are involved in the condensation of chromatin into the 30-nanometer fiber. This supranucleosome organization correlates with the resting state of chromatin, and it is therefore possible that the linker histones play an active role in the control of chromatin activity. The effect of H5 has been directly determined by expression of an inducible transfected H5 gene in rat sarcoma cells, which do not produce H5. Transfection resulted in the reversible inhibition of DNA replication and arrest of cells in G1, at which time H5 concentrations approached that of terminally differentiated avian erythrocytes. The arrest of proliferation was accompanied by specific changes in gene expression probably related to the cell cycle block. The selectivity of these effects suggest that H5 plays an active role in the control of DNA replication and cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, J M -- Wiaderkiewicz, R -- Ruiz-Carrillo, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):68-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cancer Research Center, Laval University School of Medicine, L'Hotel-Dieu du Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740916" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Cycle ; Cell Division ; Cell Line ; Chickens ; DNA/*biosynthesis ; *DNA Replication ; Histones/genetics/*physiology ; Rats ; Receptors, Glucocorticoid/biosynthesis ; Recombinant Proteins/pharmacology ; Sarcoma, Experimental ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 96
    facet.materialart.
    Unknown
    Monoclonal antibody-mediated tumor regression by induction of apoptosis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-21
    Description: To characterize cell surface molecules involved in control of growth of malignant lymphocytes, monoclonal antibodies were raised against the human B lymphoblast cell line SKW6.4. One monoclonal antibody, anti-APO-1, reacted with a 52-kilodalton antigen (APO-1) on a set of activated human lymphocytes, on malignant human lymphocyte lines, and on some patient-derived leukemic cells. Nanogram quantities of anti-APO-1 completely blocked proliferation of cells bearing APO-1 in vitro in a manner characteristic of a process called programmed cell death or apoptosis. Cell death was preceded by changes in cell morphology and fragmentation of DNA. This process was distinct from antibody- and complement-dependent cell lysis and was mediated by the antibody alone. A single intravenous injection of anti-APO-1 into nu/nu mice carrying a xenotransplant of a human B cell tumor induced regression of this tumor within a few days. Histological thin sections of the regressing tumor showed that anti-APO-1 was able to induce apoptosis in vivo. Thus, induction of apoptosis as a consequence of a signal mediated through cell surface molecules like APO-1 may be a useful therapeutic approach in treatment of malignancy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Trauth, B C -- Klas, C -- Peters, A M -- Matzku, S -- Moller, P -- Falk, W -- Debatin, K M -- Krammer, P H -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):301-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Immunology and Genetics, German Cancer Research Center, Heidelberg.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2787530" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal/*immunology/therapeutic use ; Antigens, Neoplasm/immunology ; Autoradiography ; B-Lymphocytes/immunology ; Burkitt Lymphoma/immunology/therapy ; Cell Survival ; Cells, Cultured ; Electrophoresis, Polyacrylamide Gel ; Humans ; Leukemia, B-Cell/*immunology/pathology/therapy ; Mice ; Mice, Nude ; Precipitin Tests ; Remission Induction ; T-Lymphocytes/immunology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 97
    facet.materialart.
    Unknown
    Amyloid beta protein enhances the survival of hippocampal neurons in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: The beta-amyloid protein is progressively deposited in Alzheimer's disease as vascular amyloid and as the amyloid cores of neuritic plaques. Contrary to its metabolically inert appearance, this peptide may have biological activity. To evaluate this possibility, a peptide ligand homologous to the first 28 residues of the beta-amyloid protein (beta 1-28) was tested in cultures of hippocampal pyramidal neurons for neurotrophic or neurotoxic effects. The beta 1-28 appeared to have neurotrophic activity because it enhanced neuronal survival under the culture conditions examined. This finding may help elucidate the sequence of events leading to plaque formation and neuronal damage in Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Whitson, J S -- Selkoe, D J -- Cotman, C W -- AG00538/AG/NIA NIH HHS/ -- AG07918/AG/NIA NIH HHS/ -- MH19691/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1488-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928783" target="_blank"〉PubMed〈/a〉
    Keywords: Amyloid/*pharmacology ; *Amyloid beta-Peptides ; *Amyloid beta-Protein Precursor ; Animals ; Cell Adhesion/drug effects ; Cell Survival ; Cells, Cultured ; Hippocampus/*cytology/embryology ; Neurons/cytology ; Peptide Fragments/*pharmacology ; Rats ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 98
    facet.materialart.
    Unknown
    Rapid beta-adrenergic modulation of cardiac calcium channel currents by a fast G protein pathway (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: beta-Adrenergic agonists activate the G protein, Gs, which stimulates cardiac calcium currents by both cytoplasmic, indirect and membrane-delimited, direct pathways. To test whether beta-adrenergic agonists might use both pathways in the heart, isoproterenol was rapidly applied to cardiac myocytes, resulting in a biphasic increase in cardiac calcium channel currents that had time constants of 150 milliseconds and 36 seconds. beta-Adrenergic antagonists of a G protein inhibitor blocked both the fast and slow responses, whereas the adenylyl cyclase activator forskolin produced only the slow response. The presence of a fast pathway in the heart can explain what the slow pathway cannot account for: the ability of cardiac sympathetic nerves to change heart rate within a single beat.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yatani, A -- Brown, A M -- HL36930/HL/NHLBI NIH HHS/ -- HL37044/HL/NHLBI NIH HHS/ -- NS23877/NS/NINDS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):71-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544999" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Atrial Function ; Calcium Channels/drug effects/*physiology ; Carbachol/pharmacology ; Cells, Cultured ; Colforsin/pharmacology ; GTP-Binding Proteins/*physiology ; Guinea Pigs ; Heart/*physiology ; Isoproterenol/*pharmacology ; Kinetics ; Membrane Potentials/drug effects ; *Signal Transduction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 99
    facet.materialart.
    Unknown
    Neural connections between the lateral geniculate nucleus and visual cortex in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Neural connections were established in cocultures of rat visual cortex (VC) and lateral geniculate nucleus (LGN), which were isolated in early infancy. Morphological and electrophysiological studies showed that the cortical laminar organization of afferent and efferent connections in the coculture preparations was similar to that in the adult VC. The results indicate the existence of intrinsic mechanisms in VC and LGN that guide the formation of synaptic connections with the appropriate targets.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamoto, N -- Kurotani, T -- Toyama, K -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):192-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Kyoto Prefectural School of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749258" target="_blank"〉PubMed〈/a〉
    Keywords: Afferent Pathways/physiology ; Animals ; Axons/physiology ; Culture Techniques ; Efferent Pathways/physiology ; Electrophysiology ; Geniculate Bodies/cytology/*physiology ; Organ Culture Techniques ; Rats ; Rats, Inbred Strains ; Synapses/physiology ; Visual Cortex/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 100
    facet.materialart.
    Unknown
    The periaqueductal gray matter mediates opiate-induced immunosuppression (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The periaqueductal gray matter of the mesencephalon (PAG) subserves a variety of diverse autonomic functions and also appears to be a site for opiate action in the induction of immunosuppression. Microinjections of morphine into the PAG, but not into other opiate receptor-containing neuroanatomical sites, result in a rapid suppression of natural killer (NK) cell activity. The NK cell suppression can be blocked by prior peripheral administration of the opiate antagonist naltrexone. These findings demonstrate that certain central actions of opiates that produce changes in NK cell function are mediated through opiate receptors in the PAG and identify a brain region involved in opiate regulation of immune function.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weber, R J -- Pert, A -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):188-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Medicinal Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749256" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immune Tolerance ; Killer Cells, Natural/drug effects/immunology ; Male ; Mesencephalon/drug effects/*immunology ; Microinjections ; Morphine/administration & dosage/antagonists & inhibitors/*pharmacology ; Naltrexone/pharmacology ; Rats ; Rats, Inbred F344
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...