ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Ihre E-Mail wurde erfolgreich gesendet. Bitte prüfen Sie Ihren Maileingang.

Leider ist ein Fehler beim E-Mail-Versand aufgetreten. Bitte versuchen Sie es erneut.

Vorgang fortführen?

Exportieren
Filter
  • Artikel  (67)
  • Transfection  (67)
  • American Association for the Advancement of Science (AAAS)  (67)
  • American Association for the Advancement of Science
  • Elsevier
  • International Union of Crystallography
  • 1985-1989  (67)
  • 1970-1974
  • 1950-1954
  • 1945-1949
  • 1940-1944
  • 1935-1939
  • 1989  (44)
  • 1988  (23)
  • 1970
  • 1952
  • 1949
  • 1940
  • Chemie und Pharmazie  (67)
  • Wirtschaftswissenschaften
  • Geographie
  • Technik allgemein
  • Maschinenbau
Sammlung
  • Artikel  (67)
Datenquelle
Schlagwörter
Verlag/Herausgeber
  • American Association for the Advancement of Science (AAAS)  (67)
  • American Association for the Advancement of Science
  • Elsevier
  • International Union of Crystallography
Erscheinungszeitraum
  • 1985-1989  (67)
  • 1970-1974
  • 1950-1954
  • 1945-1949
  • 1940-1944
    • +
Jahr
Zeitschrift
Thema
  • 1
    facet.materialart.
    Unbekannt
    Isolation and expression of functional high-affinity Fc receptor complementary DNAs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: Human and murine mononuclear phagocytes express a high-affinity receptor for immunoglobulin G that plays a central role in macrophage antibody-dependent cellular cytotoxicity and clearance of immune complexes. The receptor (FcRI) may also be involved in CD4-independent infection of human macrophages by human immunodeficiency virus. This report describes the isolation of cDNA clones encoding the human FcRI by a ligand-mediated selection technique. Expression of the cDNAs in COS cells gave rise to immunoglobulin G binding of the expected affinity and subtype specificity. RNA blot analysis revealed expression of a 1.7-kilobase transcript in macrophages and in cells of the promonocytic cell line U937 induced with interferon-gamma. The extracellular region of FcRI consists of three immunoglobulin-like domains, two of which share homology with low-affinity receptor domains.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Allen, J M -- Seed, B -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):378-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911749" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Blotting, Northern ; Cercopithecus aethiops ; Cloning, Molecular ; DNA/genetics ; Gene Expression Regulation ; Humans ; Molecular Sequence Data ; Molecular Weight ; Polymorphism, Genetic ; Receptors, Fc/*genetics ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 2
    facet.materialart.
    Unbekannt
    AP1/jun function is differentially induced in promotion-sensitive and resistant JB6 cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-05
    Beschreibung: Tumor promoters may bring about events that lead to neoplastic transformation by inducing specific promotion-relevant effector genes. Functional activation of the transacting transcription factor AP-1 by the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) may play an essential role in this process. Clonal genetic variants of mouse epidermal JB6 cells that are genetically susceptible (P+) or resistant (P-) to promotion of transformation by TPA were transfected with 3XTRE-CAT, a construct that has AP-1 cis-enhancer sequences attached to a reporter gene encoding chloramphenicol acetyltransferase (CAT). Transfected JB6 P+, but not P- variants, showed TPA-inducible CAT synthesis. Epidermal growth factor, another transformation promoter in JB6 cells, also caused P+ specific induction of CAT gene expression. These results demonstrate an association between induced AP-1 function and sensitivity to promotion of neoplastic transformation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bernstein, L R -- Colburn, N H -- New York, N.Y. -- Science. 1989 May 5;244(4904):566-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Johns Hopkins University, Department of Biology, Baltimore, MD 21218.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541502" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Chloramphenicol O-Acetyltransferase/genetics ; Cloning, Molecular ; DNA-Binding Proteins/genetics/*physiology ; Epidermal Growth Factor/pharmacology ; Epidermis ; Gene Expression Regulation ; Genetic Variation ; Kinetics ; Mice ; Nucleic Acid Hybridization ; Plasmids ; Promoter Regions, Genetic ; Proto-Oncogene Proteins ; Proto-Oncogene Proteins c-jun ; Simplexvirus/genetics ; Tetradecanoylphorbol Acetate/*pharmacology ; Transcription Factors/genetics/*physiology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 3
    facet.materialart.
    Unbekannt
    Kappa B-specific DNA binding proteins: role in the regulation of human interleukin-2 gene expression (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-28
    Beschreibung: Transcriptional activation of the human interleukin-2 (IL-2) gene, like induction of the IL-2 receptor alpha (IL-2R alpha) gene and the type 1 human immunodeficiency virus (HIV-1), is shown to be modulated by a kappa B-like enhancer element. Mutation of a kappa B core sequence identified in the IL-2 promoter (-206 to -195) partially inhibits both mitogen- and HTLV-I Tax-mediated activation of this transcription unit and blocks the specific binding of two inducible cellular factors. These kappa B-specific proteins (80 to 90 and 50 to 55 kilodaltons) similarly interact with the functional kappa B enhancer present in the IL-2R alpha promoter. These data suggest that these kappa B-specific proteins have a role in the coordinate regulation of this growth factor-growth factor receptor gene system that controls T cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoyos, B -- Ballard, D W -- Bohnlein, E -- Siekevitz, M -- Greene, W C -- A127053-01/PHS HHS/ -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):457-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Medical Center, Department of Microbiology, New York, NY 10029.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497518" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/metabolism ; DNA-Binding Proteins/*metabolism ; *Enhancer Elements, Genetic ; *Gene Expression Regulation ; Genes, Viral ; HIV-1/genetics ; HTLV-I Antigens/pharmacology ; Humans ; Immunoglobulin kappa-Chains/*genetics ; Interleukin-2/*genetics ; Molecular Weight ; Mutation ; Phytohemagglutinins/pharmacology ; Plasmids ; Promoter Regions, Genetic ; RNA, Messenger/biosynthesis ; T-Lymphocytes/metabolism ; Tetradecanoylphorbol Acetate/pharmacology ; Trans-Activators ; Transcription Factors/pharmacology ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 4
    facet.materialart.
    Unbekannt
    Golf: an olfactory neuron specific-G protein involved in odorant signal transduction (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-19
    Beschreibung: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 5
    facet.materialart.
    Unbekannt
    Targeting of nonexpressed genes in embryonic stem cells via homologous recombination (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-15
    Beschreibung: Gene targeting via homologous recombination-mediated disruption in murine embryonic stem (ES) cells has been described for a number of different genes expressed in these cells; it has not been reported for any nonexpressed genes. Pluripotent stem cell lines were isolated with homologously recombined insertions at three different loci: c-fos, which is expressed at a low level in ES cells, and two genes, adipsin and adipocyte P2 (aP2), which are transcribed specifically in adipose cells and are not expressed at detectable levels in ES cells. The frequencies at which homologous recombination events occurred did not correlate with levels of expression of the targeted genes, but did occur at rates comparable to those previously reported for genes that are actively expressed in ES cells. Injection of successfully targeted cells into mouse blastocysts resulted in the formation of chimeric mice. These studies demonstrate the feasibility of altering genes in ES cells that are expressed in a tissue-specific manner in the mouse, in order to study their function at later developmental stages.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R S -- Sheng, M -- Greenberg, M E -- Kolodner, R D -- Papaioannou, V E -- Spiegelman, B M -- DK 31405/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1234-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506639" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adipose Tissue/cytology ; Animals ; Blotting, Northern ; Blotting, Southern ; Carrier Proteins/biosynthesis/*genetics ; Cell Line ; Chimera ; Complement Factor D ; DNA, Recombinant ; DNA-Binding Proteins/biosynthesis/genetics ; Fatty Acid-Binding Proteins ; Fatty Acids/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; *Neoplasm Proteins ; *Nerve Tissue Proteins ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-fos ; RNA, Messenger/biosynthesis/genetics ; *Recombination, Genetic ; Serine Endopeptidases/*genetics ; Stem Cells/*metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 6
    facet.materialart.
    Unbekannt
    Ectopic expression of the serotonin 1c receptor and the triggering of malignant transformation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-02
    Beschreibung: Neurotransmitter receptors are usually restricted to neuronal cells, but the signaling pathways activated by these receptors are widely distributed in both neural and non-neural cells. The functional consequences of activating a brain-specific neurotransmitter receptor, the serotonin 5HT1c receptor, in the unnatural environment of a fibroblast were examined. Introduction of functional 5HT1c receptors into NIH 3T3 cells results, at high frequency, in the generation of transformed foci. Moreover, the generation and maintenance of transformed foci requires continued activation of the serotonin receptor. In addition, the injection of cells derived from transformed foci into nude mice results in the generation of tumors. The serotonin 5HT1c receptor therefore functions as a protooncogene when expressed in NIH 3T3 fibroblasts.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Julius, D -- Livelli, T J -- Jessell, T M -- Axel, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1057-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, College of Physicians and Surgeons, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727693" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Calcium/pharmacology ; Cell Division ; Cell Line ; *Cell Transformation, Neoplastic ; Cloning, Molecular ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Receptors, Serotonin/*genetics/physiology ; Second Messenger Systems ; Serotonin/pharmacology/physiology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 7
    facet.materialart.
    Unbekannt
    Effect of antisense c-raf-1 on tumorigenicity and radiation sensitivity of a human squamous carcinoma (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-10
    Beschreibung: Antisense RNA-mediated inhibition of gene expression was used to investigate the biological function of the c-raf-1 gene in a radiation-resistant human squamous carcinoma cell line, SQ-20B. S1 nuclease protection assays revealed that transfection of full-length raf complementary DNA in the antisense orientation (AS) leads to a specific reduction (greater than tenfold) of steady-state levels of the endogenous c-raf-1 sense (S) transcript in SQ-20B cells. In nude mice, the malignant potential of SQ-20B cells transfected with raf (S) was significantly increased relative to that of SQ-20B cells transfected with raf (AS). SQ-20B cells containing transfected raf (S) maintained a radiation-resistant phenotype as compared to those cells harboring the AS version, which appeared to have enhanced radiation sensitivity. These data indicate that the reduced expression of endogenous c-raf-1 is sufficient to modulate the tumorigenicity and the radiation-resistant phenotype of SQ-20B cells, thus implicating c-raf-1 in a pathway important to the genesis of this type of cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kasid, U -- Pfeifer, A -- Brennan, T -- Beckett, M -- Weichselbaum, R R -- Dritschilo, A -- Mark, G E -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1354-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiation Medicine, Vincent T. Lombardi Comprehensive Cancer Research Center, Georgetown University Medical Center, Washington 20007.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466340" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Blotting, Southern ; Carcinoma, Squamous Cell/*genetics ; Cell Line ; Cell Survival/*radiation effects ; Clone Cells ; Dose-Response Relationship, Radiation ; *Gene Expression Regulation ; Humans ; Kinetics ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Nucleic Acid Hybridization ; *Proto-Oncogenes ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors ; Transcription, Genetic ; Transfection ; Transplantation, Heterologous ; Tumor Cells, Cultured/*radiation effects
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 8
    facet.materialart.
    Unbekannt
    Antisense RNA-induced reduction in murine TIMP levels confers oncogenicity on Swiss 3T3 cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-17
    Beschreibung: Mouse 3T3 cell lines capable of constitutively synthesizing an RNA complementary to the messenger RNA encoding TIMP, tissue inhibitor of metalloproteinases, were constructed by transfection with appropriate plasmid constructs. Many of the lines were down-modulated for TIMP messenger RNA levels and secreted less TIMP into the culture medium. In comparison to noninvasive, nontumorigenic controls, these cells not only were invasive in a human amnion invasion assay, but also were tumorigenic and metastatic in athymic mice. These results indicate that TIMP suppresses oncogenicity, at least in immortal murine 3T3 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Khokha, R -- Waterhouse, P -- Yagel, S -- Lala, P K -- Overall, C M -- Norton, G -- Denhardt, D T -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):947-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Western Ontario, London, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2465572" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Cells, Cultured ; Enzyme Inhibitors/*genetics/metabolism ; Female ; Metalloendopeptidases/antagonists & inhibitors ; Mice ; Mice, Nude ; Neoplasm Metastasis ; Pituitary Neoplasms/genetics/pathology ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors/genetics ; Tissue Inhibitor of Metalloproteinases ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 9
    facet.materialart.
    Unbekannt
    Adenylyl cyclase amino acid sequence: possible channel- or transporter-like structure (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-30
    Beschreibung: Complementary DNA's that encode an adenylyl cyclase were isolated from a bovine brain library. Most of the deduced amino acid sequence of 1134 residues is divisible into two alternating sets of hydrophobic and hydrophilic domains. Each of the two large hydrophobic domains appears to contain six transmembrane spans. Each of the two large hydrophilic domains contains a sequence that is homologous to a single cytoplasmic domain of several guanylyl cyclases; these sequences may represent nucleotide binding sites. An unexpected topographical resemblance between adenylyl cyclase and various plasma membrane channels and transporters was observed. This structural complexity suggests possible, unappreciated functions for this important enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Krupinski, J -- Coussen, F -- Bakalyar, H A -- Tang, W J -- Feinstein, P G -- Orth, K -- Slaughter, C -- Reed, R R -- Gilman, A G -- CA16519/CA/NCI NIH HHS/ -- GM12230/GM/NIGMS NIH HHS/ -- GM34497/GM/NIGMS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1558-64.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas 75235.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472670" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): *Adenylyl Cyclases/genetics/isolation & purification ; Amino Acid Sequence ; Animals ; Base Sequence ; Brain/enzymology ; *Carrier Proteins ; Cattle ; Cell Line ; Cloning, Molecular ; DNA/genetics ; Electrophoresis, Polyacrylamide Gel ; *Ion Channels ; Membrane Proteins ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Protein Conformation ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 10
    facet.materialart.
    Unbekannt
    The MHC-binding and gp120-binding functions of CD4 are separable (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-18
    Beschreibung: CD4 is a cell surface glycoprotein that is thought to interact with nonpolymorphic determinants of class II major histocompatibility (MHC) molecules. CD4 is also the receptor for the human immunodeficiency virus (HIV), binding with high affinity to the HIV-1 envelope glycoprotein, gp120. Homolog-scanning mutagenesis was used to identify CD4 regions that are important in class II MHC binding and to determine whether the gp120 and class II MHC binding sites of CD4 are related. Class II MHC binding was abolished by mutations in each of the first three immunoglobulin-like domains of CD4. The gp120 binding could be abolished without affecting class II MHC binding and vice versa, although at least one mutation examined reduced both functions significantly. These findings indicate that, while there may be overlap between the gp120 and class II MHC binding sites of CD4, these sites are distinct and can be separated. Thus it should be possible to design CD4 analogs that can block HIV infectivity but intrinsically lack the ability to affect the normal immune response by binding to class II MHC molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lamarre, D -- Ashkenazi, A -- Fleury, S -- Smith, D H -- Sekaly, R P -- Capon, D J -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):743-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549633" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Antigens, Surface ; Binding Sites ; DNA, Recombinant ; HIV/*metabolism ; HIV Envelope Protein gp120 ; HLA-DP Antigens/immunology ; Histocompatibility Antigens Class II/*immunology ; Humans ; Hybridomas ; Mice ; Molecular Sequence Data ; Mutation ; Receptors, HIV ; Receptors, Virus/genetics/immunology/*metabolism ; Retroviridae Proteins/immunology/*metabolism ; Rosette Formation ; Structure-Activity Relationship ; T-Lymphocytes/immunology/metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 11
    facet.materialart.
    Unbekannt
    Membrane anchoring of a human IgG Fc receptor (CD16) determined by a single amino acid (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: CD16 is a low-affinity immunoglobulin G (IgG) Fc receptor that is expressed on natural killer (NK) cells, granulocytes, activated macrophages, and some T lymphocytes. Two similar genes, CD16-I and CD16-II, encode membrane glycoproteins that are anchored by phosphatidylinositol (PI)-glycan and transmembrane polypeptides, respectively. The primary structural requirements for PI-linkage were examined by constructing a series of hybrid cDNA molecules. Although both cDNA's have an identical COOH-terminal hydrophobic segment, CD16-I has Ser203 whereas CD16-II has Phe203. Conversion of Phe to Ser in CD16-II permits expression of a PI-glycan-anchored glycoprotein, whereas conversion of Ser to Phe in CD16-I prevents PI-glycan linkage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lanier, L L -- Cwirla, S -- Yu, G -- Testi, R -- Phillips, J H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Becton Dickinson Monoclonal Center, Inc., Mountain View, CA 94043.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531919" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, CD/*genetics ; Antigens, Differentiation/*genetics/metabolism ; Base Sequence ; Cell Line ; Cell Membrane/immunology ; Codon/genetics ; *Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; *Phenylalanine ; Receptors, Fc/*genetics/metabolism ; Receptors, IgG ; *Serine ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 12
    facet.materialart.
    Unbekannt
    Repression of the IgH enhancer in teratocarcinoma cells associated with a novel octamer factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-27
    Beschreibung: Embryonal carcinoma (EC) cell lines are models for early cells in mouse embryogenesis. A 300-base pair fragment of the heavy chain enhancer was inactive in F9 EC cells, unlike in other nonlymphoid cells where it has significant activity. Alterations of the octamer motif increased enhancer activity. Nuclear extracts from F9 cells contained an octamer binding protein (NF-A3) that was unique to EC cells; the amount of NF-A3 decreased upon differentiation. It is proposed that NF-A3 represses specific regulatory sequences that contain the octamer motif. Thus, the same DNA sequence mediates either negative or positive transcriptional effects, depending on the cell type.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lenardo, M J -- Staudt, L -- Robbins, P -- Kuang, A -- Mulligan, R C -- Baltimore, D -- CA 01074/CA/NCI NIH HHS/ -- HD0063/HD/NICHD NIH HHS/ -- HL37569/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):544-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536195" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Bucladesine/pharmacology ; Cell Differentiation ; DNA/metabolism ; Embryonal Carcinoma Stem Cells ; *Enhancer Elements, Genetic ; Immunoglobulin Heavy Chains/*genetics ; Macromolecular Substances ; Mice ; Mutation ; Neoplastic Stem Cells/*metabolism ; RNA, Messenger/biosynthesis ; Regulatory Sequences, Nucleic Acid ; Repressor Proteins/genetics ; Transcription, Genetic ; Transfection ; Tretinoin/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 13
    facet.materialart.
    Unbekannt
    Purification, cloning, and expression of ciliary neurotrophic factor (CNTF) (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-24
    Beschreibung: Ciliary neurotrophic factor (CNTF) is one of a small number of proteins with neurotrophic activities distinct from nerve growth factor (NGF). CNTF has now been purified and cloned and the primary structure of CNTF from rabbit sciatic nerve has been determined. Biologically active CNTF has been transiently expressed from a rabbit complementary DNA clone. CNTF is a neural effector without significant sequence homologies to any previously reported protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lin, L F -- Mismer, D -- Lile, J D -- Armes, L G -- Butler, E T 3rd -- Vannice, J L -- Collins, F -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1023-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Protein Chemistry Group, Synergen, Inc., Boulder, CO 80301.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587985" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Cell Line ; Ciliary Neurotrophic Factor ; Cloning, Molecular ; DNA/genetics ; Molecular Sequence Data ; Nerve Growth Factors/*genetics ; Nerve Tissue Proteins/biosynthesis/*genetics/isolation & purification ; Rabbits ; Recombinant Proteins/biosynthesis ; Sciatic Nerve/metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 14
    facet.materialart.
    Unbekannt
    5-bromo-2'-deoxyuridine blocks myogenesis by extinguishing expression of MyoD1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-04
    Beschreibung: The pyrimidine analog 5-bromodeoxyuridine (BUdR) competes with thymidine for incorporation into DNA. Substitution of BUdR for thymidine does not significantly affect cell viability but does block cell differentiation in many different lineages. BUdR substitution in a mouse myoblast line blocked myogenic differentiation and extinguished the expression of the myogenic determination gene MyoD1. Forced expression of MyoD1 from a transfected expression vector in a BUdR-substituted myoblast overcame the block to differentiation imposed by BUdR. Activation of BUdR-substituted muscle structural genes and apparently normal differentiation were observed in transfected myoblasts. This shows that BUdR blocks myogenesis at the level of a myogenic regulatory gene, possibly MyoD1, not by directly inhibiting the activation of muscle structural genes. It is consistent with the idea that BUdR selectively blocks a class of regulatory genes, each member of which is important for the development of a different cell lineage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tapscott, S J -- Lassar, A B -- Davis, R L -- Weintraub, H -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):532-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Fred Hutchinson Cancer Research Center, Seattle, WA 98104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547249" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Bromodeoxyuridine/metabolism/*pharmacology ; Cell Differentiation/drug effects ; Cell Line ; Creatine Kinase/genetics ; DNA/metabolism ; Desmin/genetics ; Gene Expression Regulation/*drug effects ; Genes ; Mice ; Muscle Proteins/*genetics ; Muscles/*cytology ; Myogenin ; Nuclear Proteins/*genetics ; Plasmids ; RNA, Messenger/genetics ; Repetitive Sequences, Nucleic Acid ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 15
    facet.materialart.
    Unbekannt
    Brefeldin A specifically inhibits presentation of protein antigens to cytotoxic T lymphocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-02
    Beschreibung: Cytotoxic T lymphocytes (CTLs) recognize foreign antigens, including viral proteins, in association with major histocompatibility complex (MHC) class I molecules. Brefeldin A, a specific inhibitor of exocytosis, completely and reversibly inhibited the presentation of viral proteins, but not exogenous peptides, to MHC class I-restricted CTLs directed against influenza virus antigens. The effect of brefeldin A on antigen presentation correlated with its inhibition of intracellular transport of newly synthesized class I molecules. Brefeldin A is thus a specific inhibitor of antigen processing for class I-restricted T cell recognition. Its effect on antigen presentation supports the idea that exogenous peptide antigens associate with cell surface class I molecules, whereas protein antigens processed via the cytosolic route associate with nascent class I molecules before they leave the trans-Golgi complex.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yewdell, J W -- Bennink, J R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1072-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory for Viral Diseases, National Institute of Allergy and Infectious Diseases, Rockville, MD 20852.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471266" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigen-Presenting Cells/*drug effects/immunology ; Antigens, Viral/*immunology ; Biological Transport/drug effects ; Brefeldin A ; Cell Membrane/immunology ; Cyclopentanes/*pharmacology ; Endoplasmic Reticulum/immunology ; Epitopes/immunology ; Exocytosis/drug effects ; Golgi Apparatus/immunology ; H-2 Antigens/immunology ; Hemagglutinins/genetics/immunology ; Histocompatibility Antigens Class I/immunology ; Mice ; Nucleoproteins/immunology ; Orthomyxoviridae/immunology ; T-Lymphocytes, Cytotoxic/drug effects/*immunology ; Transfection ; Viral Proteins/*immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 16
    facet.materialart.
    Unbekannt
    A liver-specific enhancer in the core promoter region of human hepatitis B virus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-03
    Beschreibung: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Cell Line ; Chloramphenicol O-Acetyltransferase/genetics ; Chromosome Deletion ; *Enhancer Elements, Genetic ; *Genes, Viral ; Hepatitis B virus/*genetics ; Liver/*metabolism ; Molecular Sequence Data ; Mutation ; *Promoter Regions, Genetic ; Simplexvirus/enzymology/genetics ; Thymidine Kinase/genetics ; Transcription, Genetic ; Transfection ; Viral Structural Proteins/genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 17
    facet.materialart.
    Unbekannt
    The neuronal growth-associated protein GAP-43 induces filopodia in non-neuronal cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-09
    Beschreibung: The neuron-specific protein GAP-43 is associated with the membrane of the nerve growth cone and thus may be important to the activity of this distinctive neuronal structure. Transient transfection of COS and NIH 3T3 cells with appropriate vectors resulted in expression of GAP-43 in these non-neuronal cells; as in neurons, transfected GAP-43 associated with the membrane. In addition, many long fine filopodial processes extended from the periphery of such transfected cells. Stable CHO cell lines expressing GAP-43 also exhibited processes that were more numerous, far longer, and more complex than those of CHO cell lines not transfected or transfected with control plasmids. Thus GAP-43 may directly contribute to growth cone activity by regulating cell membrane structure and enhancing extension of filopodial processes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zuber, M X -- Goodman, D W -- Karns, L R -- Fishman, M C -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1193-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Developmental Biology Laboratory, Massachusetts General Hospital Cancer Center, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658062" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Cell Membrane/*ultrastructure ; Cells, Cultured ; Fluorescent Antibody Technique ; GAP-43 Protein ; Growth Substances/*physiology ; Membrane Proteins/genetics/*physiology ; Mice ; Nerve Tissue Proteins/genetics/*physiology ; Recombinant Proteins/pharmacology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 18
    facet.materialart.
    Unbekannt
    Type I and type II GABAA-benzodiazepine receptors produced in transfected cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-22
    Beschreibung: GABAA (gamma-aminobutyric acid A)-benzodiazepine receptors expressed in mammalian cells and assembled from one of three different alpha subunit variants (alpha 1, alpha 2, or alpha 3) in combination with a beta 1 and a gamma 2 subunit display the pharmacological properties of either type I or type II receptor subtypes. These receptors contain high-affinity binding sites for benzodiazepines. However, CL 218 872, 2-oxoquazepam, and methyl beta-carboline-3-carboxylate (beta-CCM) show a temperature-modulated selectivity for alpha 1 subunit-containing receptors. There were no significant differences in the binding of clonazepam, diazepam, Ro 15-1788, or dimethoxy-4-ethyl-beta-carboline-3-carboxylate (DMCM) to all three recombinant receptors. Receptors containing the alpha 3 subunit show greater GABA potentiation of benzodiazepine binding than receptors containing the alpha 1 or alpha 2 subunit, indicating that there are subtypes within the type II class. Thus, diversity in benzodiazepine pharmacology is generated by heterogeneity of the alpha subunit of the GABAA receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pritchett, D B -- Luddens, H -- Seeburg, P H -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1389-92.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Neuroendocrinology, Zentrum fur Molekulare Biologie, Universitat Heidelberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2551039" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Cell Line ; Diazepam/metabolism ; Flumazenil/metabolism ; Flunitrazepam/metabolism ; Humans ; Molecular Weight ; Pyridazines/metabolism ; Receptors, GABA-A/classification/*genetics/metabolism ; Recombinant Proteins/metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 19
    facet.materialart.
    Unbekannt
    Ethical questions haunt new genetic technologies (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-03
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1134-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922602" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Abortion, Induced ; *Advisory Committees ; DNA, Recombinant ; *Ethics, Medical ; Federal Government ; Genetic Engineering ; Genetic Markers ; *Genetic Therapy ; Humans ; Legislation, Medical ; National Institutes of Health (U.S.) ; Transfection ; United States
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 20
    facet.materialart.
    Unbekannt
    Adipsin and complement factor D activity: an immune-related defect in obesity (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-23
    Beschreibung: Adipsin is a serine protease that is secreted by adipocytes into the bloodstream; it is deficient in several animal models of obesity, representing a striking example of defective gene expression in this disorder. Recombinant mouse adipsin was purified and its biochemical and enzymatic properties were studied in order to elucidate the function of this protein. Activated adipsin has little or no proteolytic activity toward most substrates but has the same activity as human complement factor D, cleaving complement factor B when it is complexed with activated complement component C3. Like authentic factor D, adipsin can activate the alternative pathway of complement, resulting in red blood cell lysis. Decreased (58 to 80 percent) complement factor D activity, relative to lean controls, was observed as a common feature of several experimental models of obesity, including the ob/ob, db/db, and monosodium glutamate (MSG)-injected mouse and the fa/fa rat. These results suggest that adipsin and the alternative pathway of complement may play an unexpected but important role in the regulation of systemic energy balance in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosen, B S -- Cook, K S -- Yaglom, J -- Groves, D L -- Volanakis, J E -- Damm, D -- White, T -- Spiegelman, B M -- DK31403/DK/NIDDK NIH HHS/ -- DK34605/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1483-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734615" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adipose Tissue/metabolism ; Amino Acid Sequence ; Animals ; Cell Line ; Complement Activating Enzymes/*metabolism ; Complement Factor D/*metabolism ; Complement Pathway, Alternative ; Cricetinae ; DNA/genetics ; Gene Expression Regulation ; Humans ; Immunoblotting ; Mice ; Molecular Sequence Data ; Obesity/genetics/*immunology/metabolism ; RNA, Messenger/metabolism ; Recombinant Proteins ; Serine Endopeptidases/genetics/isolation & purification/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 21
    facet.materialart.
    Unbekannt
    The product of the mos proto-oncogene as a candidate "initiator" for oocyte maturation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-11
    Beschreibung: The endogenous c-mos product, pp39mos, is required for progesterone-induced meiotic maturation in Xenopus oocytes. Treatment of oocytes with progesterone induced a rapid increase in pp39mos that preceded both the activation of maturation promoting factor (MPF) and germinal vesicle breakdown (GVBD). Microinjection of synthetic mos RNA into oocytes activated MPF and induced GVBD in the absence of progesterone. Thus, the mos proto-oncogene product may qualify as a candidate "initiator" protein of MPF and is at least one of the "triggers" for G2 to M transition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagata, N -- Daar, I -- Oskarsson, M -- Showalter, S D -- Vande Woude, G F -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):643-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉BRI-Basic Research Program, National Cancer Institute, Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474853" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Cycloheximide/pharmacology ; Female ; Growth Substances/physiology ; Kinetics ; Maturation-Promoting Factor ; Meiosis/drug effects ; Microinjections ; Oocytes/*physiology ; Progesterone/pharmacology ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*physiology ; Proto-Oncogene Proteins c-mos ; RNA/genetics ; Transcription, Genetic ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 22
    facet.materialart.
    Unbekannt
    Progress toward human gene therapy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-16
    Beschreibung: Current therapies for most human genetic diseases are inadequate. In response to the need for effective treatments, modern molecular genetics is providing tools for an unprecedented new approach to disease treatment through an attack directly on mutant genes. Recent results with several target organs and gene transfer techniques have led to broad medical and scientific acceptance of the feasibility of this "gene therapy" concept for disorders of the bone marrow, liver, and central nervous system; some kinds of cancer; and deficiencies of circulating enzymes, hormones, and coagulation factors. The most well-developed models involve alteration of mutant target genes by gene transfer with recombinant pathogenic viruses in order to express new genetic information and to correct disease phenotypes--the conversion of the swords of pathology into the plowshares of therapy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Friedmann, T -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660259" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Bone Marrow/physiology ; Brain/physiology ; Ethics, Medical ; Gene Expression Regulation ; Genetic Diseases, Inborn ; Genetic Therapy/*methods/trends ; Genetic Vectors ; Humans ; Liver/physiology ; Neoplasms/genetics ; Risk Assessment ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 23
    facet.materialart.
    Unbekannt
    Prevention of rapid intracellular degradation of ODC by a carboxyl-terminal truncation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-17
    Beschreibung: Ornithine decarboxylase (ODC) was converted from a protein with a short intracellular half-life in mammalian cells to a stable protein by truncating 37 residues at its carboxyl terminus. Cells expressing wild-type protein lost ODC activity with a half-life of approximately 1 hour. Cells expressing the truncated protein, however, retained full activity for at least 4 hours. Pulse-chase experiments in which immunoprecipitation and gel electrophoresis were used confirmed the stabilizing effect of the truncation. Thus, a carboxyl-terminal domain is responsible for the rapid intracellular degradation of murine ODC.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ghoda, L -- van Daalen Wetters, T -- Macrae, M -- Ascherman, D -- Coffino, P -- CA 09043/CA/NCI NIH HHS/ -- CA 29048/CA/NCI NIH HHS/ -- CA 47721/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1493-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928784" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Cloning, Molecular ; Mice ; Ornithine Decarboxylase/genetics/*metabolism ; Recombinant Proteins/metabolism ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 24
    facet.materialart.
    Unbekannt
    Myristoylated and nonmyristoylated forms of a protein are phosphorylated by protein kinase C (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-10-27
    Beschreibung: Activation of protein kinase C is thought to require association of the kinase with the cell membrane. It has been assumed that cellular substrates for the kinase must likewise be associated with membranes, and previous studies with membrane-associated myristoylated proteins have supported this view. It is now shown that a mutation that prevents the normal amino-terminal myristoylation of a prominent cellular substrate of protein kinase C, and appears to prevent its membrane association, does not prevent the normal phosphorylation of this protein in intact cells in response to phorbol esters. Thus, membrane association may not be required in order for protein kinase C substrates to undergo phosphorylation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Graff, J M -- Gordon, J I -- Blackshear, P J -- 2T32-GM 07171/GM/NIGMS NIH HHS/ -- AI27179/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):503-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratories, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814478" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Cells, Cultured ; Chickens ; Enzyme Activation ; *Intracellular Signaling Peptides and Proteins ; Membrane Proteins/metabolism ; Mutation ; Myristic Acid ; Myristic Acids ; Phosphorylation ; Protein Kinase C/*metabolism ; Proteins/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 25
    facet.materialart.
    Unbekannt
    Interleukin-2 receptor beta chain gene: generation of three receptor forms by cloned human alpha and beta chain cDNA's (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-05
    Beschreibung: Interleukin-2 (IL-2) binds to two distinct receptor molecules, the IL-2 receptor alpha (IL-2R alpha, p55) chain and the newly identified IL-2 receptor beta (IL-2R beta, p70-75) chain. The cDNA encoding the human IL-2R beta chain has now been isolated. The overall primary structure of the IL-2R beta chain shows no apparent homology to other known receptors. Unlike the IL-2R alpha chain, the IL-2R beta chain has a large cytoplasmic region in which a functional domain (or domains) mediating an intracellular signal transduction pathway (or pathways) may be embodied. The cDNA-encoded beta chain binds and internalizes IL-2 when expressed on T lymphoid cells but not fibroblast cells. Furthermore, the cDNA gives rise to the generation of high-affinity IL-2 receptor when co-expressed with the IL-2R alpha chain cDNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hatakeyama, M -- Tsudo, M -- Minamoto, S -- Kono, T -- Doi, T -- Miyata, T -- Miyasaka, M -- Taniguchi, T -- New York, N.Y. -- Science. 1989 May 5;244(4904):551-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785715" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; Cross-Linking Reagents ; DNA/*genetics/isolation & purification ; Fibroblasts/metabolism ; Gene Expression Regulation ; Humans ; Interleukin-2/metabolism ; Leukemia ; Molecular Sequence Data ; Nucleic Acid Hybridization ; RNA, Messenger/genetics ; Receptors, Interleukin-2/*genetics/metabolism ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Signal Transduction ; Succinimides ; T-Lymphocytes/metabolism ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 26
    facet.materialart.
    Unbekannt
    Identification of a thyroid hormone receptor that is pituitary-specific (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-07
    Beschreibung: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 27
    facet.materialart.
    Unbekannt
    Neural cadherin: role in selective cell-cell adhesion (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-11
    Beschreibung: Cadherins are a family of Ca2+-dependent intercellular adhesion molecules. Complementary DNAs encoding mouse neural cadherin (N-cadherin) were cloned, and the cell binding specificity of this molecule was examined. Mouse N-cadherin shows 92 percent similarity in amino acid sequence to the chicken homolog, while it shows 49 percent and 43 percent similarity to epithelial cadherin and to placental cadherin of the same species, respectively. In cell binding assays, mouse N-cadherin did not cross-react with other mouse cadherins, but it did cross-react with chicken N-cadherin. The results indicate that each cadherin type confers distinct adhesive specificities on different cells, and also that the specificity of N-cadherin is conserved between mammalian and avian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miyatani, S -- Shimamura, K -- Hatta, M -- Nagafuchi, A -- Nose, A -- Matsunaga, M -- Hatta, K -- Takeichi, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):631-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2762814" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Antigens, Surface/genetics/*physiology ; Base Sequence ; Brain Chemistry ; *Cell Adhesion ; Cell Adhesion Molecules ; Chickens ; Cloning, Molecular ; DNA/genetics ; Embryo, Mammalian ; Embryo, Nonmammalian ; L Cells (Cell Line) ; Mice ; Molecular Sequence Data ; Nerve Tissue/*analysis ; Nucleic Acid Hybridization ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 28
    facet.materialart.
    Unbekannt
    Class II MHC molecules are specific receptors for staphylococcus enterotoxin A (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-19
    Beschreibung: T cell proliferation in response to stimulation with Staphylococcus enterotoxin A (SEA) requires accessory cells that express class II major histocompatibility complex (MHC) molecules. Murine fibroblasts transfected with genes encoding the alpha and beta subunits of HLA-DR, DQ, or DP were used to show that the proliferative response of purified human T cells to SEA is dependent on class II molecules but is not restricted by the haplotype of the responder. Binding of fluoresceinated SEA to class II transfectants and precipitation of class II heterodimers with SEA-Sepharose show that the proliferative response is a result of SEA binding to class II molecules. The binding is specific for class II molecules and is independent of class II allotype or isotype. The ability of SEA to bind class II molecules may be a general characteristic of this class of antigens, now called "superantigens".〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mollick, J A -- Cook, R G -- Rich, R R -- AI-15394/AI/NIAID NIH HHS/ -- AI-21289/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):817-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratory, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658055" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, Bacterial/immunology ; Enterotoxins/*immunology ; Fibroblasts/immunology ; Fluoresceins ; Fluorescent Dyes ; HLA-DP Antigens/genetics/immunology ; HLA-DQ Antigens/genetics/immunology ; HLA-DR Antigens/genetics/immunology ; Histocompatibility Antigens Class II/*immunology ; Immunosorbent Techniques ; Lymphocyte Activation ; Mice ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 29
    facet.materialart.
    Unbekannt
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-01
    Beschreibung: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 30
    facet.materialart.
    Unbekannt
    Interleukin-1 costimulatory activity on the interleukin-2 promoter via AP-1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-10-13
    Beschreibung: Interleukin-1 (IL-1) is a major regulator of inflammation and immunity. IL-1 induces T lymphocyte growth by acting as a second signal (together with antigen) in enhancing the production of interleukin-2 (IL-2). An IL-1-responsive element in the promoter region of the human IL-2 gene was similar to the binding site for the transcription factor AP-1. IL-1 enhanced expression of c-jun messenger RNA, whereas the antigenic signal enhanced messenger RNA expression of c-fos. Thus, the two components of the AP-1 factor are independently regulated and the AP-1 factor may serve as a nuclear mediator for the many actions of IL-1 on cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Muegge, K -- Williams, T M -- Kant, J -- Karin, M -- Chiu, R -- Schmidt, A -- Siebenlist, U -- Young, H A -- Durum, S K -- 5-T32-CA-09140/CA/NCI NIH HHS/ -- AI-R01-23879/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):249-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, Program Resources Inc., Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799385" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Chloramphenicol O-Acetyltransferase/genetics ; Gene Expression Regulation ; Humans ; Interleukin-1/*physiology ; Interleukin-2/*genetics ; Mice ; Promoter Regions, Genetic/genetics ; Proto-Oncogene Proteins c-jun/*genetics ; Tetradecanoylphorbol Acetate/pharmacology ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 31
    facet.materialart.
    Unbekannt
    Mouse embryonic stem cells and reporter constructs to detect developmentally regulated genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-28
    Beschreibung: A strategy was devised for identifying regions of the mouse genome that are transcriptionally active in a temporally and spatially restricted manner during development. The approach is based on the introduction into embryonic stem cells of two types of lacZ reporter constructs that can be activated by flanking mouse genomic sequences. Embryonic stem cells containing the lacZ constructs were used to produce chimaeric mice. Developmental regulation of lacZ expression occurred at a high frequency. Molecular cloning of the flanking endogenous genes and introduction of these potential insertional mutations into the mouse germ line should provide an efficient means of identifying and mutating novel genes important for the control of mammalian development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gossler, A -- Joyner, A L -- Rossant, J -- Skarnes, W C -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):463-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Hospital Research Institute, Division of Molecular and Developmental Biology, Toronto, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497519" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Chimera ; Cloning, Molecular ; Embryo, Mammalian/*metabolism ; Galactosidases/*genetics ; *Gene Expression Regulation ; Genetic Vectors ; Germ Cells ; Heat-Shock Proteins/genetics ; Male ; Mice ; Promoter Regions, Genetic ; Stem Cells/*metabolism ; Transfection ; Transformation, Genetic ; beta-Galactosidase/*genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 32
    facet.materialart.
    Unbekannt
    Mutant potassium channels with altered binding of charybdotoxin, a pore-blocking peptide inhibitor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-22
    Beschreibung: The inhibition by charybdotoxin of A-type potassium channels expressed in Xenopus oocytes was studied for several splicing variants of the Drosophila Shaker gene and for several site-directed mutants of this channel. Charybdotoxin blocking affinity is lowered by a factor of 3.5 upon replacing glutamate-422 with glutamine, and by a factor of about 12 upon substituting lysine in this position. Replacement of glutamate-422 by aspartate had no effect on toxin affinity. Thus, the glutamate residue at position 422 of this potassium channel is near or in the externally facing mouth of the potassium conduction pathway, and the positively charged toxin is electrostatically focused toward its blocking site by the negative potential set up by glutamate-422.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacKinnon, R -- Miller, C -- AR 19826/AR/NIAMS NIH HHS/ -- GM 31768/GM/NIGMS NIH HHS/ -- NS 07292/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1382-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Brandeis University, Waltham, MA 02254.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476850" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Binding Sites ; Charybdotoxin ; DNA Mutational Analysis ; Drosophila melanogaster ; Ions ; Membrane Proteins/genetics/metabolism/ultrastructure ; Potassium Channels/*metabolism/ultrastructure ; Scorpion Venoms/*metabolism ; Structure-Activity Relationship ; Transfection ; Xenopus laevis
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 33
    facet.materialart.
    Unbekannt
    Mechanisms for regulating expression of membrane isoforms of Fc gamma RIII (CD16) (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: Granulocyte and natural killer (NK) cell Fc receptors for immunoglobulin G (CD16) differ in only a few amino acids, yet have phosphatidylinositol glycan (PIG) or polypeptide membrane anchors, respectively. Mutagenesis shows that anchoring is regulated by a serine residue near the PIG anchor attachment site in the extracellular domain. The NK cell isoform was not expressed on the surface of COS cells unless cotransfected with a subunit that was expressed in NK cells and that was identical to the gamma subunit of the high affinity IgE Fc receptor (Fc epsilon RI). However, the CD16 sequence and not expression of the gamma subunit is dominant in regulating PIG reanchoring.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hibbs, M L -- Selvaraj, P -- Carpen, O -- Springer, T A -- Kuster, H -- Jouvin, M H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531918" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, CD/genetics ; Antigens, Differentiation/*genetics ; Cell Line ; Cell Membrane/immunology ; Flow Cytometry ; *Gene Expression Regulation ; Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Immunoglobulin G ; Killer Cells, Natural/immunology ; L Cells (Cell Line)/immunology ; Mice ; Mutation ; RNA, Messenger/genetics/isolation & purification ; Receptors, Fc/*genetics ; Receptors, IgG ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 34
    facet.materialart.
    Unbekannt
    Induction of mesoderm by a viral oncogene in early Xenopus embryos (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-19
    Beschreibung: During frog embryogenesis, mesoderm is specified in the equatorial region of the early embryo by a signal from the vegetal hemisphere. Prospective ectodermal cells dissected from the animal hemisphere can be respecified to form mesodermal tissues by recombination with vegetal tissue or by treatment with any of several polypeptide growth factors or growth factor-like molecules. Together with the discovery that several developmental mutations in Drosophila are in genes with significant homology to mammalian mitogens and oncogenes, these observations suggest that early developmental signals may use similar transduction pathways to mitogenic signals characterized in cultured mammalian cells. Whether mesoderm can be induced by activation of intracellular signal transduction pathways implicated in mitogenesis and oncogenesis has been investigated with the viral oncogene polyoma middle T. Microinjection of middle T messenger RNA into early embryos results in the respecification of isolated prospective ectodermal tissue to form characteristic mesodermal structures. Middle T in frog blastomeres appears to associate with cellular activities similar to those observed in polyoma-transformed mouse cells, and transformation-defective middle T mutants fail to induce mesoderm. These results suggest that early inductive signals and mitogenic and oncogenic stimuli may share common signal transduction pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Whitman, M -- Melton, D A -- New York, N.Y. -- Science. 1989 May 19;244(4906):803-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biology, Harvard University, Cambridge, MA 02138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658054" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, Polyomavirus Transforming/genetics ; Blastocyst/physiology ; Blastomeres/physiology ; Ectoderm/physiology ; Immunosorbent Techniques ; Mesoderm/*physiology ; Mitosis ; Morphogenesis ; Muscles/embryology ; Mutation ; *Oncogenes ; Protein-Tyrosine Kinases/metabolism ; RNA, Messenger/genetics ; *Signal Transduction ; Transfection ; Transformation, Genetic ; Xenopus/*embryology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 35
    facet.materialart.
    Unbekannt
    Sindbis virus: an efficient, broad host range vector for gene expression in animal cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-03
    Beschreibung: Sindbis virus, an enveloped virus with a single-stranded RNA genome, was engineered to express a bacterial protein, chloramphenicol acetyltransferase (CAT), in cultured insect, avian, and mammalian cells. The vectors were self-replicating and gene expression was efficient and rapid; up to 10(8) CAT polypeptides were produced per infected cell in 16 to 20 hours. CAT expression could be made temperature-sensitive by means of a derivative that incorporated a temperature-sensitive mutation in viral RNA synthesis. Vector genomic RNAs were packaged into infectious particles when Sindbis helper virus was used to supply virion structural proteins. The vector RNAs were stable to at least seven cycles of infection. The expression of CAT increased about 10(3)-fold, despite a 10(15)-fold dilution during the passaging. Sindbis virus vectors should prove useful for expressing large quantities of gene products in a variety of animal cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Xiong, C -- Levis, R -- Shen, P -- Schlesinger, S -- Rice, C M -- Huang, H V -- AG05681/AG/NIA NIH HHS/ -- AI11377/AI/NIAID NIH HHS/ -- AI24134/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1188-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922607" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Aedes ; Animals ; Bacteria/enzymology ; Cells, Cultured ; Chick Embryo ; Chloramphenicol O-Acetyltransferase/*genetics ; Codon ; Cricetinae ; DNA/genetics ; Drosophila ; Gene Amplification ; Gene Expression Regulation ; *Genetic Engineering ; *Genetic Vectors ; Humans ; Quail ; RNA, Viral/*genetics ; Sindbis Virus/*genetics ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 36
    facet.materialart.
    Unbekannt
    Neurotoxicity of a fragment of the amyloid precursor associated with Alzheimer's disease (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-28
    Beschreibung: Amyloid deposition in senile plaques and the cerebral vasculature is a marker of Alzheimer's disease. Whether amyloid itself contributes to the neurodegenerative process or is simply a by-product of that process is unknown. Pheochromocytoma (PC12) and fibroblast (NIH 3T3) cell lines were transfected with portions of the gene for the human amyloid precursor protein. Stable PC12 cell transfectants expressing a specific amyloid-containing fragment of the precursor protein gradually degenerated when induced to differentiate into neuronal cells with nerve growth factor. Conditioned medium from these cells was toxic to neurons in primary hippocampal cultures, and the toxic agent could be removed by immunoabsorption with an antibody directed against the amyloid polypeptide. Thus, a peptide derived from the amyloid precursor may be neurotoxic.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yankner, B A -- Dawes, L R -- Fisher, S -- Villa-Komaroff, L -- Oster-Granite, M L -- Neve, R L -- HD 18655/HD/NICHD NIH HHS/ -- HD 18658/HD/NICHD NIH HHS/ -- NS 01240/NS/NINDS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):417-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, Harvard Medical School, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474201" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Alzheimer Disease/*etiology/pathology ; Amyloid/genetics/*physiology ; Blotting, Northern ; Cell Line ; Fibroblasts ; Gene Expression Regulation ; Humans ; Immunoblotting ; Neurons/pathology ; Nucleic Acid Hybridization ; Pheochromocytoma ; Protein Precursors/genetics/*physiology ; RNA/analysis/genetics ; Restriction Mapping ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 37
    facet.materialart.
    Unbekannt
    Histone H5 in the control of DNA synthesis and cell proliferation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-07
    Beschreibung: The linker histones (H1, H5, H1 degrees) are involved in the condensation of chromatin into the 30-nanometer fiber. This supranucleosome organization correlates with the resting state of chromatin, and it is therefore possible that the linker histones play an active role in the control of chromatin activity. The effect of H5 has been directly determined by expression of an inducible transfected H5 gene in rat sarcoma cells, which do not produce H5. Transfection resulted in the reversible inhibition of DNA replication and arrest of cells in G1, at which time H5 concentrations approached that of terminally differentiated avian erythrocytes. The arrest of proliferation was accompanied by specific changes in gene expression probably related to the cell cycle block. The selectivity of these effects suggest that H5 plays an active role in the control of DNA replication and cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, J M -- Wiaderkiewicz, R -- Ruiz-Carrillo, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):68-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cancer Research Center, Laval University School of Medicine, L'Hotel-Dieu du Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740916" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Cell Cycle ; Cell Division ; Cell Line ; Chickens ; DNA/*biosynthesis ; *DNA Replication ; Histones/genetics/*physiology ; Rats ; Receptors, Glucocorticoid/biosynthesis ; Recombinant Proteins/pharmacology ; Sarcoma, Experimental ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 38
    facet.materialart.
    Unbekannt
    Identification of the fusion peptide of primate immunodeficiency viruses (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-12
    Beschreibung: Membrane fusion induced by the envelope glycoproteins of human and simian immunodeficiency viruses (HIV and SIVmac) is a necessary step for the infection of CD4 cells and for the formation of syncytia after infection. Identification of the region in these molecules that mediates the fusion events is important for understanding and possibly interfering with HIV/SIVmac infection and pathogenesis. Amino acid substitutions were made in the 15 NH2-terminal residues of the SIVmac gp32 transmembrane glycoprotein, and the mutants were expressed in recombinant vaccinia viruses, which were then used to infect CD4-expressing T cell lines. Mutations that increased the overall hydrophobicity of the gp32 NH2-terminus increased the ability of the viral envelope to induce syncytia formation, whereas introduction of polar or charged amino acids in the same region abolished the fusogenic function of the viral envelope. Hydrophobicity in the NH2-terminal region of gp32 may therefore be an important correlate of viral virulence in vivo and could perhaps be exploited to generate a more effective animal model for the study of acquired immunodeficiency syndrome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bosch, M L -- Earl, P L -- Fargnoli, K -- Picciafuoco, S -- Giombini, F -- Wong-Staal, F -- Franchini, G -- New York, N.Y. -- Science. 1989 May 12;244(4905):694-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Tumor Cell Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541505" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA, Viral/genetics ; *Gene Products, env ; HIV/*analysis ; HIV Antigens/metabolism ; HIV Envelope Protein gp120 ; HIV Envelope Protein gp41 ; Humans ; Membrane Glycoproteins ; Molecular Sequence Data ; Mutation ; *Retroviridae Proteins/genetics/metabolism/pharmacology ; *Retroviridae Proteins, Oncogenic ; Retroviruses, Simian/*analysis ; Structure-Activity Relationship ; T-Lymphocytes, Helper-Inducer/microbiology ; Transfection ; Vaccinia virus/genetics ; *Viral Envelope Proteins/genetics/metabolism/pharmacology ; *Viral Fusion Proteins
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 39
    facet.materialart.
    Unbekannt
    The protein kinase domain of the ANP receptor is required for signaling (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-22
    Beschreibung: A plasma membrane form of guanylate cyclase is a cell surface receptor for atrial natriuretic peptide (ANP). In response to ANP binding, the receptor-enzyme produces increased amounts of the second messenger, guanosine 3',5'-monophosphate. Maximal activation of the cyclase requires the presence of adenosine 5'-triphosphate (ATP) or nonhydrolyzable ATP analogs. The intracellular region of the receptor contains at least two domains with homology to other proteins, one possessing sequence similarity to protein kinase catalytic domains, the other to regions of unknown function in a cytoplasmic form of guanylate cyclase and in adenylate cyclase. It is now shown that the protein kinase-like domain functions as a regulatory element and that the second domain possesses catalytic activity. When the kinase-like domain was removed by deletion mutagenesis, the resulting ANP receptor retained guanylate cyclase activity, but this activity was independent of ANP and its stimulation by ATP was markedly reduced. A model for signal transduction is suggested in which binding of ANP to the extracellular domain of its receptor initiates a conformational change in the protein kinase-like domain, resulting in derepression of guanylate cyclase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chinkers, M -- Garbers, D L -- GM31362/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1392-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2571188" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Atrial Natriuretic Factor/*physiology ; Cyclic GMP/physiology ; DNA Mutational Analysis ; Guanylate Cyclase/metabolism ; Magnesium/physiology ; Protein Kinases/*physiology ; Rats ; Receptors, Atrial Natriuretic Factor ; Receptors, Cell Surface/*physiology/ultrastructure ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 40
    facet.materialart.
    Unbekannt
    Functional analysis of CAR, the target sequence for the Rev protein of HIV-1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: Expression of high levels of the structural proteins of the human immunodeficiency virus type 1 (HIV-1) requires the presence of the protein encoded by the rev open reading frame (Rev) and its associated target sequence CAR (cis anti-repression sequence) which is present in the env region of viral RNA. Extensive mutagenesis demonstrated that CAR has a complex secondary structure consisting of a central stem and five stem/loops. Disruption of any of these structures severely impaired the Rev response, but many of the stem/loops contain material that was unnecessary for Rev regulation and must be retained in these structures to avoid disturbing adjacent structures critical for CAR function. Probably no more than two of the described structural components are involved in sequence-specific recognition by regulatory proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dayton, E T -- Powell, D M -- Dayton, A I -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1625-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Immunoregulation, National Institute of Allergy and Infectious Disease, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688093" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Cell Line ; Chromosome Deletion ; Gene Amplification ; Gene Products, rev/genetics/*metabolism ; *Genes, Viral ; HIV-1/*genetics ; Models, Structural ; Molecular Sequence Data ; Mutation ; Nucleic Acid Conformation ; Plasmids ; RNA, Viral/*genetics ; Software ; Trans-Activators/*metabolism ; Transfection ; Viral Envelope Proteins/genetics ; rev Gene Products, Human Immunodeficiency Virus
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 41
    facet.materialart.
    Unbekannt
    Molecular characterization of the human beta 3-adrenergic receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-08
    Beschreibung: Since the classification of beta-adrenergic receptors (beta-ARs) into beta 1 and beta 2 subtypes, additional beta-ARs have been implicated in the control of various metabolic processes by catecholamines. A human gene has been isolated that encodes a third beta-AR, here referred to as the "beta 3-adrenergic receptor." Exposure of eukaryotic cells transfected with this gene to adrenaline or noradrenaline promotes the accumulation of adenosine 3',5'-monophosphate; only 2 of 11 classical beta-AR blockers efficiently inhibited this effect, whereas two others behaved as beta 3-AR agonists. The potency order of beta-AR agonists for the beta 3-AR correlates with their rank order for stimulating various metabolic processes in tissues where atypical adrenergic sites are thought to exist. In particular, novel beta-AR agonists having high thermogenic, antiobesity, and antidiabetic activities in animal models are among the most potent stimulators of the beta 3-AR.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Emorine, L J -- Marullo, S -- Briend-Sutren, M M -- Patey, G -- Tate, K -- Delavier-Klutchko, C -- Strosberg, A D -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1118-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉CNRS, Universite Paris VII, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2570461" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adrenergic beta-Agonists/pharmacology ; Adrenergic beta-Antagonists/pharmacology ; Amino Acid Sequence ; Animals ; Cell Line ; Cloning, Molecular ; Cricetinae ; Cyclic AMP/metabolism ; Humans ; Molecular Sequence Data ; Receptors, Adrenergic, beta/drug effects/genetics/*isolation & purification ; Sequence Homology, Nucleic Acid ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 42
    facet.materialart.
    Unbekannt
    Making transgenic mice: is it really that easy? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-11
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barinaga, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):590-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2669126" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; DNA/genetics ; Fertilization in Vitro ; Genetic Engineering/*methods ; History, 20th Century ; Male ; Mice ; Mice, Transgenic/*genetics ; Spermatozoa ; Transfection ; Zygote
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 43
    facet.materialart.
    Unbekannt
    Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-03
    Beschreibung: Focal adhesion of leukocytes to the blood vessel lining is a key step in inflammation and certain vascular disease processes. Endothelial leukocyte adhesion molecule-1 (ELAM-1), a cell surface glycoprotein expressed by cytokine-activated endothelium, mediates the adhesion of blood neutrophils. A full-length complementary DNA (cDNA) for ELAM-1 has now been isolated by transient expression in COS cells. Cells transfected with the ELAM-1 clone express a surface structure recognized by two ELAM-1 specific monoclonal antibodies (H4/18 and H18/7) and support the adhesion of isolated human neutrophils and the promyelocytic cell line HL-60. Expression of ELAM-1 transcripts in cultured human endothelial cells is induced by cytokines, reaching a maximum at 2 to 4 hours and decaying by 24 hours; cell surface expression of ELAM-1 protein parallels that of the mRNA. The primary sequence of ELAM-1 predicts an amino-terminal lectin-like domain, an EGF domain, and six tandem repetitive motifs (about 60 amino acids each) related to those found in complement regulatory proteins. A similar domain structure is also found in the MEL-14 lymphocyte cell surface homing receptor, and in granule-membrane protein 140, a membrane glycoprotein of platelet and endothelial secretory granules that can be rapidly mobilized (less than 5 minutes) to the cell surface by thrombin and other stimuli. Thus, ELAM-1 may be a member of a nascent gene family of cell surface molecules involved in the regulation of inflammatory and immunological events at the interface of vessel wall and blood.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bevilacqua, M P -- Stengelin, S -- Gimbrone, M A Jr -- Seed, B -- P01 HL-36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1160-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466335" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Cell Adhesion ; DNA/genetics ; E-Selectin ; Endothelium, Vascular/metabolism ; Gene Expression Regulation ; Humans ; Immunoassay ; Interleukin-1/pharmacology ; *Membrane Glycoproteins ; Molecular Sequence Data ; Neutrophils/*physiology ; Nucleic Acid Hybridization ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Transcription, Genetic ; Transfection ; Tumor Cells, Cultured ; Tumor Necrosis Factor-alpha/pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 44
    facet.materialart.
    Unbekannt
    Signal peptide for protein secretion directing glycophospholipid membrane anchor attachment (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-03
    Beschreibung: Decay accelerating factor (DAF) is anchored to the plasma membrane by a glycophospholipid (GPI) membrane anchor covalently attached to the COOH-terminus of the protein. A hydrophobic domain located at the COOH-terminus is required for anchor attachment; DAF molecules lacking this domain are secreted. Replacement of the COOH-terminal hydrophobic domain with a signal peptide that normally functions in membrane translocation, or with a random hydrophobic sequence, results in efficient and correct processing, producing GPI-anchored DAF on the cell surface. The structural requirements for GPI anchor attachment and for membrane translocation are therefore similar, presumably depending on overall hydrophobicity rather than specific sequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Caras, I W -- Weddell, G N -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1196-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466338" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Antigens, CD55 ; Blood Proteins ; *Carbohydrate Metabolism ; Cell Line ; Cell Membrane/*metabolism ; Complement Inactivator Proteins ; Ethanolamine ; Ethanolamines/metabolism ; Growth Hormone ; Humans ; Immunosorbent Techniques ; Membrane Proteins/genetics/*metabolism/secretion ; Mutation ; Phosphatidylinositol Diacylglycerol-Lyase ; Phosphatidylinositols/metabolism ; Phospholipids/*metabolism ; Phosphoric Diester Hydrolases/metabolism ; Protein Sorting Signals/*physiology ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 45
    facet.materialart.
    Unbekannt
    Transient expression shows ligand gating and allosteric potentiation of GABAA receptor subunits (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-12-02
    Beschreibung: Human gamma-aminobutyric acid A (GABAA) receptor subunits were expressed transiently in cultured mammalian cells. This expression system allows the simultaneous characterization of ligand-gated ion channels by electrophysiology and by pharmacology. Thus, coexpression of the alpha and beta subunits of the GABAA receptor generated GABA-gated chloride channels and binding sites for GABAA receptor ligands. Channels consisting of only alpha or beta subunits could also be detected. These homomeric channels formed with reduced efficiencies compared to the heteromeric receptors. Both of these homomeric GABA-responsive channels were potentiated by barbiturate, indicating that sites for both ligand-gating and allosteric potentiation are present on receptors assembled from either subunit.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pritchett, D B -- Sontheimer, H -- Gorman, C M -- Kettenmann, H -- Seeburg, P H -- Schofield, P R -- New York, N.Y. -- Science. 1988 Dec 2;242(4883):1306-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Neuroendocrinology, ZMBH, University of Heidelberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2848320" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Allosteric Regulation ; Blotting, Northern ; Cells, Cultured ; Chloride Channels ; Chlorides/*physiology ; Cloning, Molecular ; Electric Conductivity ; Humans ; Macromolecular Substances ; Membrane Proteins/*physiology ; Muscimol/metabolism ; Receptors, GABA-A/*physiology/ultrastructure ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 46
    facet.materialart.
    Unbekannt
    Site-directed mutagenesis of two trans-regulatory genes (tat-III,trs) of HIV-1 (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-02-19
    Beschreibung: Point mutations were introduced into the overlapping trans-regulatory genes (tat-III and trs) of human immunodeficiency virus type 1 (HIV-1), and the mutants were evaluated for virus expression. The results showed that tat-III has a positive transacting role and is required for transcriptional activation. A chain terminating mutation early in the trs gene resulted in an increase in transcription of viral messenger RNA as measured by nuclear transcription experiments, but only one major species of viral messenger RNA (1.8 kilobases) was detected, and little or no viral structural proteins were made. Thus, the trs gene product is essential for expression of virus structural proteins but, at the same time, may have a negative trans-regulatory role in transcription. Cotransfection of the point mutant proviruses defective in tat or trs with each other or with a complementary DNA clone containing tat and trs sequences restored the normal transcription pattern and subsequent virus production.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sadaie, M R -- Benter, T -- Wong-Staal, F -- New York, N.Y. -- Science. 1988 Feb 19;239(4842):910-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Tumor Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3277284" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acetyltransferases/genetics ; Acquired Immunodeficiency Syndrome/immunology ; Animals ; Cell Line ; Chloramphenicol O-Acetyltransferase ; Codon ; DNA/genetics ; *Genes, Regulator ; *Genes, Viral ; HIV/*genetics ; Humans ; Immunosorbent Techniques ; *Mutation ; Plasmids ; RNA, Messenger/genetics ; RNA, Viral/genetics ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 47
    facet.materialart.
    Unbekannt
    Ordered interstrand and intrastrand DNA transfer during reverse transcription (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-08-26
    Beschreibung: Retroviruses contain two copies of the plus stranded viral RNA genome. As a means of determining whether both of these RNA's are used in the reverse transcription reaction, cells were infected with heterozygous virus particles that varied in nucleotide sequence at two separate locations at the RNA termini. The DNA proviruses formed from a single cycle of reverse transcription were then examined. Of the 12 proviruses that were characterized, all exhibited long terminal repeats (LTR's) that would be expected to arise only if both RNA templates were used for the generation of minus strand DNA. In contrast, only a single minus strand DNA appeared to be used as template for the plus strand DNA in the generation of fully double-stranded viral DNA. These results indicate that the first strand transfer step in reverse transcription is an intermolecular event while that of the second transfer is intramolecular. Thus, retroviruses contain two functionally active RNA's, and both may be required for the generation of a single linear DNA molecule. Formation of heterozygotes during retrovirus infection would be expected to result in the efficient generation of LTR recombinants.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Panganiban, A T -- Fiore, D -- New York, N.Y. -- Science. 1988 Aug 26;241(4869):1064-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉McArdle Laboratory for Cancer Research, University of Wisconsin, Madison 53706.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2457948" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Cell Line ; DNA Restriction Enzymes ; DNA, Viral/*genetics/metabolism ; Deoxyribonuclease HindIII ; Genes, Viral ; Nucleic Acid Hybridization ; Polymorphism, Restriction Fragment Length ; RNA, Viral/*genetics/metabolism ; RNA-Directed DNA Polymerase/*metabolism ; Repetitive Sequences, Nucleic Acid ; Retroviridae/*genetics ; Templates, Genetic ; *Transcription, Genetic ; Transfection ; Virion/genetics ; Virus Replication
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 48
    facet.materialart.
    Unbekannt
    Two mechanisms for the extinction of gene expression in hybrid cells (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-09-02
    Beschreibung: When two different mammalian cell types are fused to generate a stable hybrid cell line, genes that are active in only one of the parents are frequently shut off, a phenomenon called extinction. In this study two distinct, complementary mechanisms for such extinction of growth hormone gene expression were identified. In hybrids formed by fusing fibroblasts to pituitary cells, pituitary-specific proteins that bind to the growth hormone promoter were absent. In addition, a negative regulatory element located near the rat growth hormone promoter was specifically activated.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tripputi, P -- Guerin, S L -- Moore, D D -- New York, N.Y. -- Science. 1988 Sep 2;241(4870):1205-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2842865" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acetyltransferases/genetics ; Animals ; Avian Sarcoma Viruses/genetics ; Chloramphenicol O-Acetyltransferase ; Enhancer Elements, Genetic ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Growth Hormone/*genetics ; Herpesviridae/genetics ; Hybrid Cells/*metabolism ; Hypoxanthine Phosphoribosyltransferase/genetics ; L Cells (Cell Line) ; Mice ; Pituitary Gland/metabolism ; Plasmids ; Promoter Regions, Genetic ; Rats ; Thymidine Kinase/genetics ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 49
    facet.materialart.
    Unbekannt
    Reshaping human antibodies: grafting an antilysozyme activity (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-03-25
    Beschreibung: The production of therapeutic human monoclonal antibodies by hybridoma technology has proved difficult, and this has prompted the "humanizing" of mouse monoclonal antibodies by recombinant DNA techniques. It was shown previously that the binding site for a small hapten could be grafted from the heavy-chain variable domain of a mouse antibody to that of a human myeloma protein by transplanting the hypervariable loops. It is now shown that a large binding site for a protein antigen (lysozyme) can also be transplanted from mouse to human heavy chain. The success of such constructions may be facilitated by an induced-fit mechanism.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Verhoeyen, M -- Milstein, C -- Winter, G -- New York, N.Y. -- Science. 1988 Mar 25;239(4847):1534-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Medical Research Council Laboratory of Molecular Biology, Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2451287" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Antibodies, Monoclonal/genetics/immunology ; Base Sequence ; Binding Sites, Antibody ; Binding, Competitive ; Cloning, Molecular ; DNA, Recombinant ; Epitopes/immunology ; Humans ; Immunoglobulin G/genetics/immunology ; Immunoglobulin Variable Region/genetics ; Mice ; Molecular Sequence Data ; Muramidase/*immunology ; Plasmids ; Recombinant Proteins ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 50
    facet.materialart.
    Unbekannt
    Clonally related cortical cells show several migration patterns (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-09-09
    Beschreibung: The mammalian cerebral cortex is organized into columns of cells with common functional properties. During embryogenesis, cortical neurons are formed deep, near the lateral ventricles, and migrate radially to their final position. This observation led to the suggestion that the cortex consists of radial, ontogenetic units of clonally related neurons. In the experiments reported here, this hypothesis was tested by studying cell lineage in the rat cortex with a retroviral vector carrying the Escherichia coli beta-galactosidase gene, which can be easily visualized. Labeled, clonally related cortical neurons did not occur in simple columnar arrays. Instead, clonally related neurons entered several different radial columns, apparently by migrating along different radial glial fibers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Walsh, C -- Cepko, C L -- EY07331-01/EY/NEI NIH HHS/ -- R01 NS 23021-01/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1342-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3137660" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Movement ; Cerebral Cortex/cytology/*embryology ; Clone Cells ; Neuroglia/physiology ; Rats ; Transfection ; beta-Galactosidase/metabolism
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 51
    facet.materialart.
    Unbekannt
    AIDS mice die in NIH accident (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-12-16
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1502.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201235" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Accidents ; *Acquired Immunodeficiency Syndrome ; Animals ; Disease Models, Animal ; HIV/genetics ; Mice ; National Institutes of Health (U.S.) ; Transfection ; United States
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 52
    facet.materialart.
    Unbekannt
    HTLV-II transactivation is regulated by the overlapping tax/rex nonstructural genes (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-05-13
    Beschreibung: The human T-cell leukemia virus (HTLV) types I and II have two nonstructural genes that are encoded in overlapping reading frames. One of these genes, known as tax, has been shown to encode a protein responsible for enhanced transcription (transactivation) from the viral long terminal repeats (LTRs). Genetic evidence indicates that the second nonstructural gene of HTLV-II, here designated rex, acts in trans to modulate tax gene-mediated transactivation in a concentration-dependent fashion. The rex gene may regulate the process of transactivation during the viral life cycle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenblatt, J D -- Cann, A J -- Slamon, D J -- Smalberg, I S -- Shah, N P -- Fujii, J -- Wachsman, W -- Chen, I S -- 1 R01 CA 43370/CA/NCI NIH HHS/ -- 1K11 CA 01314/CA/NCI NIH HHS/ -- CA 32737/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 May 13;240(4854):916-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, UCLA School of Medicine.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2834826" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Base Sequence ; DNA, Recombinant ; DNA, Viral/genetics ; Deltaretrovirus/*genetics ; *Genes, Regulator ; *Genes, Viral ; Mutation ; Promoter Regions, Genetic ; RNA, Messenger/genetics/metabolism ; RNA, Viral/genetics/metabolism ; Simian virus 40/genetics ; *Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 53
    facet.materialart.
    Unbekannt
    Conversion of a PI-anchored protein to an integral membrane protein by a single amino acid mutation (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-08-05
    Beschreibung: Qa-2, a cell-surface glycoprotein anchored by phosphatidylinositol (PI), is structurally related to the class I transplantation antigens H-2 K, D, and L, which are integral membrane glycoproteins. The predicted transmembrane segment of Qa-2 differs from those of H-2 K, D, and L by the presence of an aspartate in place of a valine at position 295. A single base change that replaced this aspartate with valine resulted in cell-surface Qa-2 molecules that were insensitive to hydrolysis by a PI-specific phospholipase C and more resistant to papain cleavage, properties shared by H-2D. Cells expressing Asp----Val mutant Qa-2 proteins were still able to attach a PI anchor to endogenous proteins such as Thy-1 and J11D. It therefore appears that this single amino acid change converts Qa-2 from a PI-linked form into an integral membrane protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Waneck, G L -- Stein, M E -- Flavell, R A -- AI24562/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1988 Aug 5;241(4866):697-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biogen Research Corporation, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3399901" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; *Antigens, Surface/genetics ; *Aspartic Acid ; Cell Line ; DNA/genetics ; H-2 Antigens ; *Histocompatibility Antigens/genetics ; *Histocompatibility Antigens Class I ; Membrane Proteins/genetics/*metabolism ; Mutation ; Papain/metabolism ; Phosphatidylinositols/*metabolism ; Thymoma ; Thymus Neoplasms ; Transfection ; Tumor Cells, Cultured ; Type C Phospholipases/metabolism ; *Valine
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 54
    facet.materialart.
    Unbekannt
    Many transcription factors interact synergistically with steroid receptors (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-12-09
    Beschreibung: Progesterone (PRE) or glucocorticoid receptor (GRE) DNA binding sites are often found clustered with binding sites for other transcription factors. Individual protein binding sites were tested without the influence of adjacent factors by analyzing isolated combinations of several transcription factor binding sites with PREs or GREs. All show strong synergistic effects on steroid induction. The degree of synergism is inversely related to the strength of the GRE. Thus, a steroid responsive unit can be composed of several modules that, if positioned correctly, act synergistically.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schule, R -- Muller, M -- Kaltschmidt, C -- Renkawitz, R -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1418-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Max-Planck Institut fur Biochemie, Martinsried, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201230" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Base Sequence ; Binding Sites ; Cloning, Molecular ; Genes ; HeLa Cells/metabolism ; Humans ; Molecular Sequence Data ; Plasmids ; Receptors, Glucocorticoid/*genetics/metabolism ; Receptors, Progesterone/*genetics/metabolism ; Transcription Factors/*genetics/metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 55
    facet.materialart.
    Unbekannt
    Molecular cloning of a feline leukemia virus that induces fatal immunodeficiency disease in cats (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-02-19
    Beschreibung: A replication-defective variant of feline leukemia virus was molecularly cloned directly from infected tissue and found to induce a rapid and fatal immunodeficiency syndrome in cats. Studies with cloned viruses also showed that subtle mutational changes would convert a minimally pathogenic virus into one that would induce an acute form of immunodeficiency. The data suggest that acutely pathogenic viruses may be selected against by current methods for isolation of the human and simian immunodeficiency viruses.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Overbaugh, J -- Donahue, P R -- Quackenbush, S L -- Hoover, E A -- Mullins, J I -- CA01058/CA/NCI NIH HHS/ -- CA07966/CA/NCI NIH HHS/ -- CA43216/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Feb 19;239(4842):906-10.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cancer Biology, Harvard School of Public Health, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2893454" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acquired Immunodeficiency Syndrome ; Amino Acid Sequence ; Animals ; Base Sequence ; Bone Marrow/microbiology ; Cats ; *Cloning, Molecular ; DNA, Viral/genetics ; Humans ; Immunologic Deficiency Syndromes/*etiology/microbiology ; Leukemia Virus, Feline/*genetics/pathogenicity ; Molecular Sequence Data ; Mutation ; Polymorphism, Restriction Fragment Length ; Transfection ; Virus Replication
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 56
    facet.materialart.
    Unbekannt
    The cellular src gene product regulates junctional cell-to-cell communication (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-01-22
    Beschreibung: Overexpression of the cellular src gene in NIH 3T3 cells causes reduction of cell-to-cell transmission of molecules in the 400- to 700-dalton range. This down-regulation of gap junctional communication correlates with the activity of the gene product, the protein tyrosine kinase pp60c-src. The down-regulation was enhanced by point mutation of Tyr527 (a site that is phosphorylated in pp60c-src and that inhibits kinase activity) or by substitution of the viral-src for the cellular-src carboxyl-terminal coding region. Mutation of Tyr416 (a site phosphorylated upon Tyr527 mutation) suppresses both the down-regulation of communication by Tyr527 mutation and that by gene overexpression. The regulation of communication by src may be important in the control of embryonic development and cellular growth.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Azarnia, R -- Reddy, S -- Kmiecik, T E -- Shalloway, D -- Loewenstein, W R -- CA-14464/CA/NCI NIH HHS/ -- CA-32317/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Jan 22;239(4838):398-401.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Biophysics, University of Miami School of Medicine, FL 33136.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2447651" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Cell Communication ; Cell Line ; Cell Membrane Permeability ; Gene Expression Regulation ; *Intercellular Junctions ; Mice ; Mutation ; Phosphorylation ; Plasmids ; Protein-Tyrosine Kinases/*genetics ; Proto-Oncogene Proteins/genetics/*physiology ; Proto-Oncogene Proteins pp60(c-src) ; Structure-Activity Relationship ; Transcription, Genetic ; Transfection ; Tyrosine/metabolism
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 57
    facet.materialart.
    Unbekannt
    Repair of the secretion defect in the Z form of alpha 1-antitrypsin by addition of a second mutation (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-12-23
    Beschreibung: Homozygous inheritance of the Z-type mutant form of the alpha 1-antitrypsin (alpha 1AT) gene results in the most common form of alpha 1AT deficiency, a human hereditary disease associated with a high risk for the development of emphysema and an increased incidence of neonatal hepatitis. The alpha 1AT-synthesizing cells of individuals with the Z gene have normal alpha 1AT messenger RNA levels, but alpha 1AT secretion is markedly reduced secondary to accumulation of newly synthesized alpha 1AT in the rough endoplasmic reticulum. Crystallographic analysis of alpha 1AT predicts that in normal alpha 1AT, a negatively charged Glu342 is adjacent to positively charged Lys290. Thus the Glu342----Lys342 Z mutation caused the loss of a normal salt bridge, resulting in the intracellular aggregation of the Z molecule. The prediction was made that a second mutation in the alpha 1AT genet that changed the positively charged Lys290 to a negatively charged Glu290 would correct the secretion defect. When the second mutation was added to the Z-type complementary DNA, the resulting gene directed the synthesis and secretion of amounts of alpha 1AT similar to that directed by the normal alpha 1AT complementary DNA in an in vitro eukaryotic expression system. This suggests the possibility that a human hereditary disease can be corrected by inserting an additional mutation in the same gene.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Brantly, M -- Courtney, M -- Crystal, R G -- New York, N.Y. -- Science. 1988 Dec 23;242(4886):1700-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pulmonary Branch, National Heart, Lung, and Blood Institute, Bethesda, MD.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2904702" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Codon ; DNA/genetics ; Electrochemistry ; Endoplasmic Reticulum/metabolism ; Glutamates ; Glutamic Acid ; Humans ; Lysine ; *Mutation ; Protein Conformation ; RNA, Messenger/metabolism ; Structure-Activity Relationship ; Transfection ; alpha 1-Antitrypsin/*genetics/secretion ; alpha 1-Antitrypsin Deficiency
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 58
    facet.materialart.
    Unbekannt
    Signal transduction and transcriptional regulation by glucocorticoid receptor-LexA fusion proteins (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-08-12
    Beschreibung: The glucocorticoid receptor regulates transcriptional initiation upon binding to its cognate hormone. A series of fusion genes was constructed to examine the mechanism of hormone-regulated transcriptional enhancement. The DNA binding domain of the bacterial LexA repressor was fused to receptor derivatives lacking the region that is necessary and sufficient for specific DNA binding and transcriptional enhancement at glucocorticoid response elements (GRE's). The resultant hybrid proteins activated transcription from promoters linked to the lex operator. Enhancement still required hormone binding by the hybrid receptor regardless of the exact positioning of the LexA binding domain within the protein. Thus, the unliganded hormone binding domain of the receptor acts as a strong but reversible inhibitor of receptor activity in a manner that is independent of the means by which the receptor recognizes DNA. The results also show directly that the receptor contains at least one "enhancement domain" other than that overlapping the GRE binding region; the second domain, enh2, occupies a region near the receptor amino terminus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Godowski, P J -- Picard, D -- Yamamoto, K R -- New York, N.Y. -- Science. 1988 Aug 12;241(4867):812-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3043662" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Bacterial Proteins/*physiology ; Biological Evolution ; Escherichia coli/genetics ; *Gene Expression Regulation ; Promoter Regions, Genetic ; Receptors, Glucocorticoid/*genetics ; Recombinant Fusion Proteins/*physiology ; Recombinant Proteins/*physiology ; Repressor Proteins/*physiology ; *Serine Endopeptidases ; Transcription Factors/*physiology ; *Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 59
    facet.materialart.
    Unbekannt
    Limited immunological recognition of critical malaria vaccine candidate antigens (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-10-28
    Beschreibung: Current vaccine development strategies for malaria depend on widespread immunological responsiveness to candidate antigens such as the zygote surface antigens and the sporozoite coat protein, the circumsporozoite (CS) protein. Since immunological responsiveness is controlled mainly by genes mapping within the major histocompatibility complex (MHC), the humoral immune response to the zygote surface antigens and the cytotoxic T lymphocyte (CTL) response to the CS protein were examined in MHC-disparate congenic mouse strains. Only two of six strains responded to the 230-kilodalton zygote surface antigen and another two strains responded to the 48/45-kilodalton surface antigen. From two mouse strains, expressing between them five different class I MHC molecules, there was recognition of only a single CTL epitope from the CS protein, which was from a polymorphic segment of the molecule. The restricted CTL response to this protein parallels the restricted antibody response to this protein observed in humans and mice. These findings suggest that subunit malaria vaccines now being developed may be ineffective.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Good, M F -- Miller, L H -- Kumar, S -- Quakyi, I A -- Keister, D -- Adams, J H -- Moss, B -- Berzofsky, J A -- Carter, R -- New York, N.Y. -- Science. 1988 Oct 28;242(4878):574-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2902690" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antibodies, Protozoan/biosynthesis ; Antigens, Protozoan/*immunology ; Antigens, Surface/genetics/immunology ; CD4-Positive T-Lymphocytes/immunology ; Genes, MHC Class II ; Immunity, Cellular ; Lymphocyte Cooperation ; Malaria/*prevention & control ; Mice ; Plasmodium falciparum/*immunology ; *Protozoan Proteins ; T-Lymphocytes, Cytotoxic/immunology ; Transfection ; Vaccines/*immunology ; Zygote/immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 60
    facet.materialart.
    Unbekannt
    Growth factors regulate transin gene expression by c-fos-dependent and c-fos-independent pathways (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-12-09
    Beschreibung: The rapid induction of the proto-oncogene c-fos by growth factors and other bioactive agents, and the recent evidence that the c-fos protein (Fos) is associated with transcriptional complexes, suggests that Fos may represent an integral part of an intracellular messenger pathway that triggers changes in gene expression and ultimately phenotypic alterations. This report examines the role of c-fos in growth factor stimulation of transin, a matrix-degrading secreted metalloproteinase. Platelet-derived growth factor (PDGF) stimulation of transin RNA was blocked by a selective reduction in Fos synthesis with antisense c-fos mRNA, whereas epidermal growth factor (EGF) stimulation of transin occurred despite an equivalent inhibition of Fos levels. The stimulatory effect of both PDGF and EGF on transin transcription involved factors recognizing the sequence TGAGTCA, which is found in the transin promoter and is reported to be a binding site for the transcriptional factor Jun/AP-1 and for associated Fos and Fos-related complexes. Thus both Fos-dependent and Fos-independent pathways exist for growth factor regulation of gene expression, and both effects may be mediated through the same cis-acting transcription element.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, L D -- Holt, J T -- Matrisian, L M -- New York, N.Y. -- Science. 1988 Dec 9;242(4884):1424-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2462278" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cells, Cultured ; *Gene Expression Regulation ; Genes/*drug effects ; Growth Substances/*pharmacology ; Humans ; Matrix Metalloproteinase 3 ; Metalloendopeptidases/*genetics ; Mice ; Neoplasm Proteins/*genetics ; Proto-Oncogenes/*drug effects ; RNA/genetics ; RNA, Antisense ; RNA, Messenger/antagonists & inhibitors ; Tetradecanoylphorbol Acetate/pharmacology ; Transcription, Genetic/*drug effects ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 61
    facet.materialart.
    Unbekannt
    Distinct cloned class II MHC DNA binding proteins recognize the X box transcription element (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-10-07
    Beschreibung: The class II (Ia) major histocompatibility complex (MHC) antigens are a family of integral membrane proteins whose expression is limited to certain cell types. A pair of consensus sequences, X and Y, is found upstream of all class II genes, and deletion of each of these sequences eliminates expression of transfected genes. Furthermore, the absence of a specific X box binding protein in patients with severe combined immunodeficiency disease whose cells lack class II suggests an important role for these proteins in class II regulation. Here, the cloning of two lambda gt11 complementary DNAs encoding DNA binding proteins (murine X box binding proteins lambda mXBP and lambda mXBP-2) is reported. Both phage-encoded fusion proteins bind specifically to the X box of the A alpha, but not to E alpha or E beta class II genes. These two independent isolates do not cross-hybridize. The lambda mXBP complementary DNA hybridizes to two RNA species, 6.2 and 3.0 kilobases in mouse, that are expressed in both Ia positive and Ia negative cells. By means of DNA blot analysis with the lambda mXBP complementary DNA insert and probes generated from each end of this complementary DNA insert, lambda mXBP was found to arise from a multigene family. These data illustrate the high degree of complexity in the transcriptional control of this coordinately regulated gene family.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Liou, H C -- Boothby, M R -- Glimcher, L H -- New York, N.Y. -- Science. 1988 Oct 7;242(4875):69-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cancer Biology, Harvard School of Public Health, Boston, Massachusetts 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3140376" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; *Cloning, Molecular ; DNA-Binding Proteins/*genetics ; Gene Expression Regulation ; *Genes ; *Genes, MHC Class II ; Humans ; Mice ; Molecular Sequence Data ; *Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 62
    facet.materialart.
    Unbekannt
    HTLV-I tax induces cellular proteins that activate the kappa B element in the IL-2 receptor alpha gene (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-09-23
    Beschreibung: Jurkat T cell lines constitutively expressing Tax, the 40-kilodalton transactivator protein of human T lymphotropic virus type I (HTLV-I), were used to investigate the mechanism by which this viral product deregulates the expression of the interleukin-2 receptor alpha gene (IL-2R alpha, Tac). Transfection of deleted forms of the IL-2R alpha promoter and in vitro DNA-binding studies revealed that a 12-base pair promoter segment, which has homology with the binding site for NF-kappa B, was required for Tax-induced activation of the IL-2R alpha promoter in vivo. An 18-base pair oligonucleotide containing this kappa B-like regulatory element proved sufficient to confer Tax inducibility upon a heterologous promoter. DNA affinity precipitation assays showed that Tax, like mitogenic stimuli, induced the expression of the 86-kilodalton cellular protein HIVEN86A, which specifically binds to the IL-2R alpha kappa B element in vitro. Furthermore, DNA/protein cross-linking studies revealed that several polypeptides interact with this sequence motif. Thus, the deregulation of IL-2R alpha gene expression encountered in HTLV-I leukemias appears to involve Tax activation of one or more cellular proteins that are normally induced by mitogens and that directly contribute to transcriptional activation of this receptor gene.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ballard, D W -- Bohnlein, E -- Lowenthal, J W -- Wano, Y -- Franza, B R -- Greene, W C -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1652-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2843985" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acetyltransferases/genetics ; Cell Line ; Chloramphenicol O-Acetyltransferase ; DNA-Binding Proteins/*biosynthesis/physiology ; Deltaretrovirus/genetics/*physiology ; *Gene Expression Regulation ; Nuclear Proteins/*biosynthesis/physiology ; Plasmids ; Promoter Regions, Genetic ; Receptors, Antigen, T-Cell/*genetics ; Receptors, Immunologic/*genetics ; Receptors, Interleukin-2 ; Retroviridae Proteins/*physiology ; Tetradecanoylphorbol Acetate/pharmacology ; Trans-Activators ; Transcription Factors/*physiology ; Transfection ; Viral Proteins/*physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 63
    facet.materialart.
    Unbekannt
    Iron-responsive elements: regulatory RNA sequences that control mRNA levels and translation (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-05-13
    Beschreibung: The biosynthetic rates for both the transferrin receptor (TfR) and ferritin are regulated by iron. An iron-responsive element (IRE) in the 5' untranslated portion of the ferritin messenger RNA (mRNA) mediates iron-dependent control of its translation. In this report the 3' untranslated region of the mRNA for the human TfR was shown to be necessary and sufficient for iron-dependent control of mRNA levels. Deletion studies identified a 678-nucleotide fragment of the TfR complementary DNA that is critical for this iron regulation. Five potential stem-loops that resemble the ferritin IRE are contained within the region critical for TfR regulation. Each of two of the five TfR elements was independently inserted into the 5' untranslated region of an indicator gene transcript. In this location they conferred iron regulation of translation. Thus, an mRNA element has been implicated in the mediation of distinct regulatory phenomena dependent on the context of the element within the transcript.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Casey, J L -- Hentze, M W -- Koeller, D M -- Caughman, S W -- Rouault, T A -- Klausner, R D -- Harford, J B -- New York, N.Y. -- Science. 1988 May 13;240(4854):924-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2452485" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; DNA/genetics ; DNA, Recombinant ; Ferritins/biosynthesis/*genetics ; Growth Hormone/genetics ; Humans ; Iron/*pharmacology ; Mice ; Plasmids ; Protein Biosynthesis/*drug effects ; RNA/*genetics ; RNA, Messenger/*genetics ; Receptors, Transferrin/biosynthesis/*genetics ; *Regulatory Sequences, Nucleic Acid ; Transcription, Genetic ; Transfection ; Transformation, Genetic
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 64
    facet.materialart.
    Unbekannt
    A defective HSV-1 vector expresses Escherichia coli beta-galactosidase in cultured peripheral neurons (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-09-23
    Beschreibung: A defective herpes simplex virus 1 (HSV-1) vector, pHSVlac, has been developed that contains a transcription unit that places the Escherichia coli lacZ gene under the control of the HSV-1 immediate early 4/5 promoter. The vector pHSVlac was propagated with the HSV-1 temperature-sensitive mutant ts K as helper virus. Infection of neurons from rat superior cervical ganglia and dorsal root ganglia in primary culture resulted in stable expression of high levels of beta-galactosidase without cell death. These HSV-1 vectors should be useful for introducing genes into postmitotic cells, such as neurons, in vitro and in vivo.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2581874/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2581874/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Geller, A I -- Breakefield, X O -- DK39836/DK/NIDDK NIH HHS/ -- NS24279/NS/NINDS NIH HHS/ -- R01 NS034025/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1667-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2843986" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cells, Cultured ; DNA, Viral/metabolism ; Defective Viruses/*genetics ; Escherichia coli/enzymology/*genetics ; Fluorescent Antibody Technique ; Galactosidases/*genetics ; *Genetic Vectors ; Helper Viruses ; Neurons/*microbiology ; Rats ; Recombinant Fusion Proteins/biosynthesis ; Simplexvirus/genetics ; Transfection ; beta-Galactosidase/biosynthesis/*genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 65
    facet.materialart.
    Unbekannt
    Point mutations in the human vitamin D receptor gene associated with hypocalcemic rickets (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-12-23
    Beschreibung: Hypocalcemic vitamin D-resistant rickets is a human genetic disease resulting from target organ resistance to the action of 1,25-dihydroxyvitamin D3. Two families with affected children homozygous for this autosomal recessive disorder were studied for abnormalities in the intracellular vitamin D receptor (VDR) and its gene. Although the receptor displays normal binding of 1,25-dihydroxyvitamin D3 hormone, VDR from affected family members has a decreased affinity for DNA. Genomic DNA isolated from these families was subjected to oligonucleotide-primed DNA amplification, and each of the nine exons encoding the receptor protein was sequenced for a genetic mutation. In each family, a different single nucleotide mutation was found in the DNA binding domain of the protein; one family near the tip of the first zinc finger (Gly----Asp) and one at the tip of the second zinc finger (Arg----Gly). The mutant residues were created in vitro by oligonucleotide directed point mutagenesis of wild-type VDR complementary DNA and this cDNA was transfected into COS-1 cells. The produced protein is biochemically indistinguishable from the receptor isolated from patients.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hughes, M R -- Malloy, P J -- Kieback, D G -- Kesterson, R A -- Pike, J W -- Feldman, D -- O'Malley, B W -- New York, N.Y. -- Science. 1988 Dec 23;242(4886):1702-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2849209" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Binding Sites ; Calcitriol/metabolism ; Cell Line ; Cell Line, Transformed ; Codon ; DNA/genetics/metabolism ; Exons ; Female ; Gene Amplification ; Homozygote ; Humans ; Hypocalcemia/*genetics ; Immunoblotting ; Male ; Molecular Sequence Data ; *Mutation ; Receptors, Calcitriol ; Receptors, Steroid/*genetics/metabolism ; Rickets/*genetics ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 66
    facet.materialart.
    Unbekannt
    A common PDGF receptor is activated by homodimeric A and B forms of PDGF (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-06-10
    Beschreibung: The human platelet-derived growth factor (PDGF) receptor complementary DNA was cloned and expressed by transfection of Chinese hamster ovary (CHO) fibroblasts. The ability of CHO cells expressing the human receptor complementary DNA (CHO-HR5) to interact with different recombinant forms of PDGF (AA and BB homodimers) was tested. Both forms of PDGF bind to the transfected receptor, stimulate the receptor tyrosine kinase activity, and elicit a mitogenic response in a manner that was indistinguishable from the responses of Balb/c 3T3 cells to AA and BB forms of PDGF can be attributed to a single type of receptor and show that the AA form, like the BB form, is a true mitogen.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Escobedo, J A -- Navankasatussas, S -- Cousens, L S -- Coughlin, S R -- Bell, G I -- Williams, L T -- HL-32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 10;240(4858):1532-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, University of California, San Francisco.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2836953" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Division/drug effects ; Cell Line ; Cells, Cultured ; DNA Replication/drug effects ; Enzyme Activation ; Humans ; Kinetics ; Macromolecular Substances ; Mice ; Phosphorylation ; Platelet-Derived Growth Factor/genetics/*metabolism/pharmacology ; Protein-Tyrosine Kinases/*metabolism ; Receptors, Cell Surface/genetics/*metabolism ; Receptors, Platelet-Derived Growth Factor ; Recombinant Proteins/pharmacology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 67
    facet.materialart.
    Unbekannt
    Two mutant alleles of the insulin receptor gene in a patient with extreme insulin resistance (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1988-05-06
    Beschreibung: Insulin receptor complementary DNA has been cloned from an insulin-resistant patient with leprechaunism whose receptors exhibited multiple abnormalities in insulin binding. The patient is a compound heterozygote, having inherited two different mutant alleles of the insulin receptor gene. One allele contains a missense mutation encoding the substitution of glutamic acid for lysine at position 460 in the alpha subunit of the receptor. The second allele has a nonsense mutation causing premature chain termination after amino acid 671 in the alpha subunit, thereby deleting both the transmembrane and tyrosine kinase domains of the receptor. Interestingly, the father is heterozygous for this nonsense mutation and exhibits a moderate degree of insulin resistance. This raises the possibility that mutations in the insulin receptor gene may account for the insulin resistance in some patients with non-insulin-dependent diabetes mellitus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kadowaki, T -- Bevins, C L -- Cama, A -- Ojamaa, K -- Marcus-Samuels, B -- Kadowaki, H -- Beitz, L -- McKeon, C -- Taylor, S I -- New York, N.Y. -- Science. 1988 May 6;240(4853):787-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biochemistry and Molecular Pathophysiology Section, National Institute of Diabetes, Digestive, and Kidney Disease, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2834824" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Alleles ; Base Sequence ; Cell Line ; Cell Membrane/metabolism ; Cell Transformation, Viral ; DNA/genetics ; Diabetes Mellitus, Type 2/*genetics ; Endocrine System Diseases/genetics ; Female ; Gene Amplification ; Growth Disorders/genetics ; Herpesvirus 4, Human ; Heterozygote ; Humans ; Hydrogen-Ion Concentration ; Insulin/blood ; Insulin Resistance/*genetics ; Lymphocytes/metabolism ; Monocytes/metabolism ; Mutation ; Receptor, Insulin/*genetics ; Syndrome ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
Schließen ⊗
Diese Webseite nutzt Cookies und das Analyse-Tool Matomo. Weitere Informationen finden Sie hier...