ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (426)
  • Transcription, Genetic  (151)
  • American Association for the Advancement of Science (AAAS)  (560)
  • American Chemical Society (ACS)
  • National Academy of Sciences
  • PANGAEA
  • 1985-1989  (560)
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (560)
  • American Chemical Society (ACS)
  • National Academy of Sciences
  • PANGAEA
  • Springer  (3)
Years
Year
  • 1
    facet.materialart.
    Unknown
    Specific recognition of cruciform DNA by nuclear protein HMG1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Expression of functional nerve growth factor receptors after gene transfer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Kappa B-specific DNA binding proteins: role in the regulation of human interleukin-2 gene expression (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-28
    Description: Transcriptional activation of the human interleukin-2 (IL-2) gene, like induction of the IL-2 receptor alpha (IL-2R alpha) gene and the type 1 human immunodeficiency virus (HIV-1), is shown to be modulated by a kappa B-like enhancer element. Mutation of a kappa B core sequence identified in the IL-2 promoter (-206 to -195) partially inhibits both mitogen- and HTLV-I Tax-mediated activation of this transcription unit and blocks the specific binding of two inducible cellular factors. These kappa B-specific proteins (80 to 90 and 50 to 55 kilodaltons) similarly interact with the functional kappa B enhancer present in the IL-2R alpha promoter. These data suggest that these kappa B-specific proteins have a role in the coordinate regulation of this growth factor-growth factor receptor gene system that controls T cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoyos, B -- Ballard, D W -- Bohnlein, E -- Siekevitz, M -- Greene, W C -- A127053-01/PHS HHS/ -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):457-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Medical Center, Department of Microbiology, New York, NY 10029.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497518" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/metabolism ; DNA-Binding Proteins/*metabolism ; *Enhancer Elements, Genetic ; *Gene Expression Regulation ; Genes, Viral ; HIV-1/genetics ; HTLV-I Antigens/pharmacology ; Humans ; Immunoglobulin kappa-Chains/*genetics ; Interleukin-2/*genetics ; Molecular Weight ; Mutation ; Phytohemagglutinins/pharmacology ; Plasmids ; Promoter Regions, Genetic ; RNA, Messenger/biosynthesis ; T-Lymphocytes/metabolism ; Tetradecanoylphorbol Acetate/pharmacology ; Trans-Activators ; Transcription Factors/pharmacology ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Indole-2-carboxylic acid: a competitive antagonist of potentiation by glycine at the NMDA receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Bacterial blight of soybean: regulation of a pathogen gene determining host cultivar specificity (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-22
    Description: Soybean cultivars resistant to Pseudomonas syringae pathovar glycinea (Psg), the causal agent of bacterial blight, exhibit a hypersensitive (necrosis) reaction (HR) to infection. Psg strains carrying the avrB gene elicit the HR in soybean cultivars carrying the resistance gene Rpg1. Psg expressing avrB at a high level and capable of eliciting the HR in the absence of de novo bacterial RNA synthesis have been obtained in in vitro culture. Nutritional signals and regions within the Psg hrp gene cluster, an approximately 20-kilobase genomic region also necessary for pathogenicity, control avrB transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huynh, T V -- Dahlbeck, D -- Staskawicz, B J -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1374-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Plant Pathology, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781284" target="_blank"〉PubMed〈/a〉
    Keywords: Cloning, Molecular ; DNA Mutational Analysis ; Gene Expression Regulation ; Genes, Bacterial ; *Plant Diseases ; Promoter Regions, Genetic ; Pseudomonas/*genetics/growth & development/pathogenicity ; Regulatory Sequences, Nucleic Acid ; Restriction Mapping ; Soybeans/*genetics/microbiology ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Effects of glucocorticoids and norepinephrine on the excitability in the hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    Fibroblasts transformed with v-src show enhanced formation of an inositol tetrakisphosphate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    Golf: an olfactory neuron specific-G protein involved in odorant signal transduction (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    Increased expression of DNA cointroduced with nuclear protein in adult rat liver (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    Corticosteroid modulation of hippocampal potentials: increased effect with aging (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 11
    facet.materialart.
    Unknown
    Effect of antisense c-raf-1 on tumorigenicity and radiation sensitivity of a human squamous carcinoma (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-10
    Description: Antisense RNA-mediated inhibition of gene expression was used to investigate the biological function of the c-raf-1 gene in a radiation-resistant human squamous carcinoma cell line, SQ-20B. S1 nuclease protection assays revealed that transfection of full-length raf complementary DNA in the antisense orientation (AS) leads to a specific reduction (greater than tenfold) of steady-state levels of the endogenous c-raf-1 sense (S) transcript in SQ-20B cells. In nude mice, the malignant potential of SQ-20B cells transfected with raf (S) was significantly increased relative to that of SQ-20B cells transfected with raf (AS). SQ-20B cells containing transfected raf (S) maintained a radiation-resistant phenotype as compared to those cells harboring the AS version, which appeared to have enhanced radiation sensitivity. These data indicate that the reduced expression of endogenous c-raf-1 is sufficient to modulate the tumorigenicity and the radiation-resistant phenotype of SQ-20B cells, thus implicating c-raf-1 in a pathway important to the genesis of this type of cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kasid, U -- Pfeifer, A -- Brennan, T -- Beckett, M -- Weichselbaum, R R -- Dritschilo, A -- Mark, G E -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1354-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiation Medicine, Vincent T. Lombardi Comprehensive Cancer Research Center, Georgetown University Medical Center, Washington 20007.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466340" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Southern ; Carcinoma, Squamous Cell/*genetics ; Cell Line ; Cell Survival/*radiation effects ; Clone Cells ; Dose-Response Relationship, Radiation ; *Gene Expression Regulation ; Humans ; Kinetics ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Nucleic Acid Hybridization ; *Proto-Oncogenes ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors ; Transcription, Genetic ; Transfection ; Transplantation, Heterologous ; Tumor Cells, Cultured/*radiation effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 12
    facet.materialart.
    Unknown
    Potassium channels in cardiac cells activated by arachidonic acid and phospholipids (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 13
    facet.materialart.
    Unknown
    cis-trans models for post-transcriptional gene regulation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Klausner, R D -- Harford, J B -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):870-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683086" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; *Gene Expression Regulation ; *Models, Genetic ; Molecular Sequence Data ; Nucleic Acid Conformation ; *Protein Biosynthesis ; RNA, Messenger/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 14
    facet.materialart.
    Unknown
    Switch protein alters specificity of RNA polymerase containing a compartment-specific sigma factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: During sporulation in Bacillus subtilis, expression of developmental genes spoIVCB and cotD is induced in the mother cell compartment of the sporangium at morphological stages IV and V, respectively. A 27-kilodalton RNA polymerase sigma factor called sigma K (or sigma 27) has been found that causes weak transcription of spoIVCB and strong transcription of cotD. A 14-kD protein was also discovered that changes the specificity of sigma K-containing RNA polymerase, greatly stimulating spoIVCB transcription and markedly repressing cotD transcription. Both sigma K and the 14-kD protein are products of genes known to be required for expression of specific genes in the mother cell. Thus, sigma K directs gene expression in the mother cell and it is proposed that inactivation or sequestering of the 14-kD protein switches the temporal pattern of gene expression during the transition from stages IV to V of development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kroos, L -- Kunkel, B -- Losick, R -- GM18568/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):526-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cellular and Developmental Biology, Harvard University, Cambridge, Massachusetts 02138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492118" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Bacillus subtilis/*genetics/physiology ; Cloning, Molecular ; DNA-Directed RNA Polymerases/*genetics/isolation & purification ; Electrophoresis, Polyacrylamide Gel ; Gene Expression Regulation ; Molecular Sequence Data ; Promoter Regions, Genetic ; Sigma Factor/*genetics/isolation & purification ; Spores, Bacterial/genetics ; Transcription Factors/*genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 15
    facet.materialart.
    Unknown
    The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 16
    facet.materialart.
    Unknown
    The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 17
    facet.materialart.
    Unknown
    S phase of the cell cycle (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-03
    Description: In each cell cycle the complex structure of the chromosome must be replicated accurately. In the last few years there have been major advances in understanding eukaryotic chromosome replication. Patterns of replication origins have been mapped accurately in yeast chromosomes. Cellular replication proteins have been identified by fractionating cell extracts that replicate viral DNA templates in vitro. Cell-free systems that initiate eukaryotic DNA replication in vitro have demonstrated the importance of complex nuclear architecture in the control of DNA replication. Although the events of S phase were relatively neglected for many years, knowledge of DNA replication is now advancing rapidly in step with other phases of the cell cycle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Laskey, R A -- Fairman, M P -- Blow, J J -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):609-14.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Zoology, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683076" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Nucleus/physiology/ultrastructure ; Chromatin/physiology ; Chromosomes/physiology ; *DNA Replication ; *Interphase ; Models, Biological ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 18
    facet.materialart.
    Unknown
    Secretion of activin by interstitial cells in the testis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 19
    facet.materialart.
    Unknown
    Repression of the IgH enhancer in teratocarcinoma cells associated with a novel octamer factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Embryonal carcinoma (EC) cell lines are models for early cells in mouse embryogenesis. A 300-base pair fragment of the heavy chain enhancer was inactive in F9 EC cells, unlike in other nonlymphoid cells where it has significant activity. Alterations of the octamer motif increased enhancer activity. Nuclear extracts from F9 cells contained an octamer binding protein (NF-A3) that was unique to EC cells; the amount of NF-A3 decreased upon differentiation. It is proposed that NF-A3 represses specific regulatory sequences that contain the octamer motif. Thus, the same DNA sequence mediates either negative or positive transcriptional effects, depending on the cell type.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lenardo, M J -- Staudt, L -- Robbins, P -- Kuang, A -- Mulligan, R C -- Baltimore, D -- CA 01074/CA/NCI NIH HHS/ -- HD0063/HD/NICHD NIH HHS/ -- HL37569/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):544-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536195" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bucladesine/pharmacology ; Cell Differentiation ; DNA/metabolism ; Embryonal Carcinoma Stem Cells ; *Enhancer Elements, Genetic ; Immunoglobulin Heavy Chains/*genetics ; Macromolecular Substances ; Mice ; Mutation ; Neoplastic Stem Cells/*metabolism ; RNA, Messenger/biosynthesis ; Regulatory Sequences, Nucleic Acid ; Repressor Proteins/genetics ; Transcription, Genetic ; Transfection ; Tretinoin/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 20
    facet.materialart.
    Unknown
    Selective amplification and cloning of four new members of the G protein-coupled receptor family (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-05
    Description: An approach based on the polymerase chain reaction has been devised to clone new members of the family of genes encoding guanosine triphosphate-binding protein (G protein)-coupled receptors. Degenerate primers corresponding to consensus sequences of the third and sixth transmembrane segments of available receptors were used to selectively amplify and clone members of this gene family from thyroid complementary DNA. Clones encoding three known receptors and four new putative receptors were obtained. Sequence comparisons established that the new genes belong to the G protein-coupled receptor family. Close structural similarity was observed between one of the putative receptors and the 5HT1a receptor. Two other molecules displayed common sequence characteristics, suggesting that they are members of a new subfamily of receptors with a very short nonglycosylated (extracellular) amino-terminal extension.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Libert, F -- Parmentier, M -- Lefort, A -- Dinsart, C -- Van Sande, J -- Maenhaut, C -- Simons, M J -- Dumont, J E -- Vassart, G -- New York, N.Y. -- Science. 1989 May 5;244(4904):569-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Campus Erasme, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541503" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; DNA/genetics ; DNA-Directed DNA Polymerase ; GTP-Binding Proteins/*metabolism ; *Gene Amplification ; Humans ; Molecular Sequence Data ; Receptors, Adrenergic, alpha/genetics ; Receptors, Adrenergic, beta/genetics ; Receptors, Muscarinic/genetics ; Receptors, Neurokinin-2 ; Receptors, Neurotransmitter/*genetics ; Receptors, Serotonin/genetics ; Sequence Homology, Nucleic Acid ; Thyroid Gland/analysis ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 21
    facet.materialart.
    Unknown
    Atrial natriuretic peptide inhibits a cation channel in renal inner medullary collecting duct cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 22
    facet.materialart.
    Unknown
    Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: Quiescent T cells can be induced to express many genes by mitogen or antigen stimulation. The messenger RNAs of some of these genes undergo relatively rapid degradation compared to messenger RNAs from constitutively expressed genes. A T cell activation pathway that specifically regulates the stability of messenger RNAs for the lymphokines interleukin-2, interferon-gamma, tumor necrosis factor-alpha, and granulocyte-macrophage colony-stimulating factor is induced by stimulation of the CD28 surface molecule. This pathway does not directly affect the steady-state messenger RNA level, transcription, or messenger RNA half-life of other T cell activation genes, including c-myc, c-fos, IL-2 receptor, and the 4F2HC surface antigen. These data show that stimuli received at the cell surface can alter gene expression by inducing specific changes in messenger RNA degradation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lindstein, T -- June, C H -- Ledbetter, J A -- Stella, G -- Thompson, C B -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):339-43.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of Michigan, Ann Arbor 48109.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2540528" target="_blank"〉PubMed〈/a〉
    Keywords: Antigens, CD28 ; Antigens, CD3 ; Antigens, Differentiation, T-Lymphocyte/immunology ; Colony-Stimulating Factors/genetics ; Drug Stability ; Gene Expression Regulation ; Granulocyte-Macrophage Colony-Stimulating Factor ; Growth Substances/genetics ; Interferon-gamma/genetics ; Interleukin-2/genetics ; *Lymphocyte Activation ; Lymphokines/*genetics ; RNA, Messenger/genetics/*metabolism ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology ; Transcription, Genetic ; Tumor Necrosis Factor-alpha/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 23
    facet.materialart.
    Unknown
    Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 24
    facet.materialart.
    Unknown
    Specific block of calcium channel expression by a fragment of dihydropyridine receptor cDNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 25
    facet.materialart.
    Unknown
    Pavlovian conditioning of rat mucosal mast cells to secrete rat mast cell protease II (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 26
    facet.materialart.
    Unknown
    Relation of the amyloid beta protein precursor to heparan sulfate proteoglycans (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 27
    facet.materialart.
    Unknown
    Human KGF is FGF-related with properties of a paracrine effector of epithelial cell growth (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-18
    Description: Keratinocyte growth factor (KGF) is a human mitogen that is specific for epithelial cells. The complementary DNA sequence of KGF demonstrates that it is a member of the fibroblast growth factor family. The KGF transcript was present in stromal cells derived from epithelial tissues. By comparison with the expression of other epithelial cell mitogens, only KGF, among known human growth factors, has the properties of a stromal mediator of epithelial cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Finch, P W -- Rubin, J S -- Miki, T -- Ron, D -- Aaronson, S A -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):752-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475908" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Division ; Codon ; DNA/genetics/isolation & purification ; Epithelial Cells ; Epithelium/analysis/metabolism ; Fibroblast Growth Factor 10 ; Fibroblast Growth Factor 7 ; *Fibroblast Growth Factors/genetics ; Fibroblasts/metabolism ; Gene Expression Regulation ; Growth Substances/*genetics/physiology ; Humans ; Mesoderm/metabolism ; Mice ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oligonucleotide Probes ; RNA/analysis ; Sequence Homology, Nucleic Acid ; Skin/analysis ; Tissue Distribution ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 28
    facet.materialart.
    Unknown
    Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 29
    facet.materialart.
    Unknown
    A pertussis toxin-sensitive G protein in hippocampal long-term potentiation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 30
    facet.materialart.
    Unknown
    Quisqualate activates a rapidly inactivating high conductance ionic channel in hippocampal neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 31
    facet.materialart.
    Unknown
    5-bromo-2'-deoxyuridine blocks myogenesis by extinguishing expression of MyoD1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The pyrimidine analog 5-bromodeoxyuridine (BUdR) competes with thymidine for incorporation into DNA. Substitution of BUdR for thymidine does not significantly affect cell viability but does block cell differentiation in many different lineages. BUdR substitution in a mouse myoblast line blocked myogenic differentiation and extinguished the expression of the myogenic determination gene MyoD1. Forced expression of MyoD1 from a transfected expression vector in a BUdR-substituted myoblast overcame the block to differentiation imposed by BUdR. Activation of BUdR-substituted muscle structural genes and apparently normal differentiation were observed in transfected myoblasts. This shows that BUdR blocks myogenesis at the level of a myogenic regulatory gene, possibly MyoD1, not by directly inhibiting the activation of muscle structural genes. It is consistent with the idea that BUdR selectively blocks a class of regulatory genes, each member of which is important for the development of a different cell lineage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tapscott, S J -- Lassar, A B -- Davis, R L -- Weintraub, H -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):532-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Fred Hutchinson Cancer Research Center, Seattle, WA 98104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547249" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bromodeoxyuridine/metabolism/*pharmacology ; Cell Differentiation/drug effects ; Cell Line ; Creatine Kinase/genetics ; DNA/metabolism ; Desmin/genetics ; Gene Expression Regulation/*drug effects ; Genes ; Mice ; Muscle Proteins/*genetics ; Muscles/*cytology ; Myogenin ; Nuclear Proteins/*genetics ; Plasmids ; RNA, Messenger/genetics ; Repetitive Sequences, Nucleic Acid ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 32
    facet.materialart.
    Unknown
    Beta-adrenergic inhibition of cardiac sodium channels by dual G-protein pathways (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 33
    facet.materialart.
    Unknown
    The anticodon contains a major element of the identity of arginine transfer RNAs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: The contribution of the anticodon to the discrimination between cognate and noncognate tRNAs by Escherichia coli Arg-tRNA synthetase has been investigated by in vitro synthesis and aminoacylation of elongator methionine tRNA (tRNA(mMet) mutants. Substitution of the Arg anticodon CCG for the Met anticodon CAU leads to a dramatic increase in Arg acceptance by tRNA(mMet). A nucleotide (A20) previously identified by others in the dihydrouridine loop of tRNA(Arg)s makes a smaller contribution to the conversion of tRNA(mMet) identity from Met to Arg. The combined anticodon and dihydrouridine loop mutations yield a tRNA(mMet) derivative that is aminoacylated with near-normal kinetics by the Arg-tRNA synthetase.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schulman, L H -- Pelka, H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1595-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology and Cancer, Albert Einstein College of Medicine, Bronx, NY 10461.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688091" target="_blank"〉PubMed〈/a〉
    Keywords: Anticodon/*genetics ; Arginine-tRNA Ligase/metabolism ; Base Sequence ; Escherichia coli/enzymology/genetics ; Kinetics ; Methionine-tRNA Ligase/metabolism ; Molecular Sequence Data ; Nucleic Acid Conformation ; RNA, Transfer/*genetics ; RNA, Transfer, Amino Acid-Specific/*genetics ; RNA, Transfer, Arg/*genetics ; Substrate Specificity ; T-Phages/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 34
    facet.materialart.
    Unknown
    Brain region and gene specificity of neuropeptide gene expression in cultured astrocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 35
    facet.materialart.
    Unknown
    Inescapable versus escapable shock modulates long-term potentiation in the rat hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 36
    facet.materialart.
    Unknown
    Mouse lymph node homing receptor cDNA clone encodes a glycoprotein revealing tandem interaction domains (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-03
    Description: Isolation of a clone encoding the mouse lymph node homing receptor reveals a deduced protein with an unusual protein mosaic architecture, containing a separate carbohydrate-binding (lectin) domain, an epidermal growth factor-like (EGF) domain, and an extracellular precisely duplicated repeat unit, which preserves the motif seen in the homologous repeat structure of complement regulatory proteins and other proteins. The receptor molecule is potentially highly glycosylated, and contains an apparent transmembrane region. Analysis of messenger RNA transcripts reveals a predominantly lymphoid distribution in direct relation to the cell surface expression of the MEL-14 determinant, and the cDNA clone is shown to confer the MEL-14 epitope in heterologous cells. The many novel features, including ubiquitination, embodied in this single receptor molecule form the basis for numerous approaches to the study of cell-cell interactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siegelman, M H -- van de Rijn, M -- Weissman, I L -- AI09022/AI/NIAID NIH HHS/ -- OIG43551/PHS HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1165-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646713" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Base Sequence ; Binding Sites ; Carbohydrate Metabolism ; Cell Membrane/metabolism ; DNA/*genetics ; Epidermal Growth Factor ; Glycosylation ; Lymph Nodes/*metabolism ; Membrane Glycoproteins/*genetics ; Mice ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; Receptors, Lymphocyte Homing ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 37
    facet.materialart.
    Unknown
    A liver-specific enhancer in the core promoter region of human hepatitis B virus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-03
    Description: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cell Line ; Chloramphenicol O-Acetyltransferase/genetics ; Chromosome Deletion ; *Enhancer Elements, Genetic ; *Genes, Viral ; Hepatitis B virus/*genetics ; Liver/*metabolism ; Molecular Sequence Data ; Mutation ; *Promoter Regions, Genetic ; Simplexvirus/enzymology/genetics ; Thymidine Kinase/genetics ; Transcription, Genetic ; Transfection ; Viral Structural Proteins/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 38
    facet.materialart.
    Unknown
    Transneuronal transfer of herpes virus from peripheral nerves to cortex and brainstem (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 39
    facet.materialart.
    Unknown
    Metastatic hibernomas in transgenic mice expressing an alpha-amylase-SV40 T antigen hybrid gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-28
    Description: Mice transgenic for a hybrid gene containing the liver promoter of the mouse amylase gene (Amy-1a) fused to the SV40 tumor antigen coding region unexpected developed malignant brown adipose tissue tumors (malignant hibernomas). Expression of the alpha-amylase gene had previously been thought to be confined to the liver parotid, and pancreas; however, analysis of white and brown adipose tissue from nontransgenic mice revealed expression of the endogenous Amy-1a gene in these tissues. Gene constructs driven by the Amy-1a liver promoter thus provide a means of targeting gene expression to the adipocyte cell lineage in transgenic mice. Moreover the high frequency of metastases in the liver, lungs, spleen, heart, and adrenals of these mice provides an experimental system in which to study the development of disseminated malignancy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fox, N -- Crooke, R -- Hwang, L H -- Schibler, U -- Knowles, B B -- Solter, D -- CA-10815/CA/NCI NIH HHS/ -- CA-18470/CA/NCI NIH HHS/ -- CA-21124/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):460-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785714" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/metabolism/pathology ; *Adipose Tissue, Brown/metabolism/pathology ; Animals ; Antigens, Polyomavirus Transforming/*genetics ; Cloning, Molecular ; Gene Expression Regulation ; Liver/metabolism ; Mice ; Mice, Transgenic ; Neoplasm Metastasis ; Neoplasms, Experimental/*genetics/pathology ; Nucleic Acid Hybridization ; Promoter Regions, Genetic ; RNA, Messenger/metabolism ; Tissue Distribution ; Transcription, Genetic ; alpha-Amylases/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 40
    facet.materialart.
    Unknown
    In vitro transcription enhancement by purified derivatives of the glucocorticoid receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 41
    facet.materialart.
    Unknown
    Pathological changes induced in cerebrocortical neurons by phencyclidine and related drugs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 42
    facet.materialart.
    Unknown
    Molecular cloning of the thyrotropin receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: The pituitary hormone thyrotropin, or thyroid-stimulating hormone (TSH), is the main physiological agent that regulates the thyroid gland. The thyrotropin receptor (TSHR) was cloned by selective amplification with the polymerase chain reaction of DNA segments presenting sequence similarity with genes for G protein-coupled receptors. Out of 11 new putative receptor clones obtained from genomic DNA, one had sequence characteristics different from all the others. Although this clone did not hybridize to thyroid transcripts, screening of a dog thyroid complementary DNA (cDNA) library at moderate stringency identified a cDNA encoding a 4.9-kilobase thyroid-specific transcript. The polypeptide encoded by this thyroid-specific transcript consisted of a 398-amino acid residue amino-terminal segment, constituting a putative extracellular domain, connected to a 346-residue carboxyl-terminal domain that contained seven putative transmembrane segments. Expression of the cDNA conferred TSH responsiveness to Xenopus oocytes and Y1 cells and a TSH binding phenotype to COS cells. The TSHR and the receptor for luteinizing hormone-choriogonadotropin constitute a subfamily of G protein-coupled receptors with distinct sequence characteristics.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parmentier, M -- Libert, F -- Maenhaut, C -- Lefort, A -- Gerard, C -- Perret, J -- Van Sande, J -- Dumont, J E -- Vassart, G -- R01-DK21732/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1620-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556796" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Blotting, Northern ; Cell Line ; *Cloning, Molecular ; Cyclic AMP ; Dogs ; Female ; *Genes ; Molecular Sequence Data ; Oocytes/drug effects/metabolism ; Organ Specificity ; Polymerase Chain Reaction/methods ; RNA, Messenger/genetics ; Receptors, Thyrotropin/*genetics ; Thyrotropin/pharmacology ; Transcription, Genetic ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 43
    facet.materialart.
    Unknown
    Factors that predict individual vulnerability to amphetamine self-administration (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 44
    facet.materialart.
    Unknown
    Interferon-alpha but not AZT suppresses HIV expression in chronically infected cell lines (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-05
    Description: Promonocytic (U1) and T lymphocytic (ACH-2) cell lines chronically infected with human immunodeficiency virus type 1 (HIV-1) constitutively express low levels of virus, but expression can be induced by phorbol esters and cytokines. Whereas ACH-2 cells produce infectious virions, U1 cells produce defective, noninfectious particles. Although 3'-azido-3'-deoxythimidine (AZT) prevented acute HIV infection of susceptible cells, it did not prevent the induction of HIV expression in the infected cell lines. In contrast, interferon alpha (IFN-alpha) inhibited the release of reverse transcriptase and viral antigens into the culture supernatant after phorbol ester stimulation of both cell lines. Further, IFN-alpha suppressed the production or release (or both) of whole HIV virions, but had no effect on the amount of cell-associated viral proteins. Also, after phorbol ester stimulation of ACH-2 cells, IFN-alpha reduced the number of infectious viral particles secreted into the culture supernatant, but had no effect on the infectivity of cell-associated virus. These findings lend support to the combined use of antiviral agents that have action at both the early (AZT) and the late (IFN-alpha) stages of HIV replication.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Poli, G -- Orenstein, J M -- Kinter, A -- Folks, T M -- Fauci, A S -- New York, N.Y. -- Science. 1989 May 5;244(4904):575-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2470148" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/therapy ; Cell Line ; Cell Membrane/microbiology ; Drug Therapy, Combination ; Gene Expression Regulation ; HIV-1/drug effects/*physiology/ultrastructure ; Immunoblotting ; Interferon Type I/administration & dosage/*pharmacology ; Microscopy, Electron ; Monocytes/microbiology ; RNA-Directed DNA Polymerase/metabolism ; Recombinant Proteins ; T-Lymphocytes/microbiology ; Tetradecanoylphorbol Acetate/pharmacology ; Transcription, Genetic ; Vacuoles/microbiology ; Virion/drug effects/physiology/ultrastructure ; Virus Replication/*drug effects ; Zidovudine/administration & dosage/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 45
    facet.materialart.
    Unknown
    Inhibitors of angiotensin-converting enzyme prevent myointimal proliferation after vascular injury (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 46
    facet.materialart.
    Unknown
    Glial cell diversification in the rat optic nerve (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 47
    facet.materialart.
    Unknown
    A genetic polymorphism in the renin gene of Dahl rats cosegregates with blood pressure (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 48
    facet.materialart.
    Unknown
    elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 49
    facet.materialart.
    Unknown
    Autoimmune target in Heymann nephritis is a glycoprotein with homology to the LDL receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 50
    facet.materialart.
    Unknown
    Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-08
    Description: Overlapping complementary DNA clones were isolated from epithelial cell libraries with a genomic DNA segment containing a portion of the putative cystic fibrosis (CF) locus, which is on chromosome 7. Transcripts, approximately 6500 nucleotides in size, were detectable in the tissues affected in patients with CF. The predicted protein consists of two similar motifs, each with (i) a domain having properties consistent with membrane association and (ii) a domain believed to be involved in ATP (adenosine triphosphate) binding. A deletion of three base pairs that results in the omission of a phenylalanine residue at the center of the first predicted nucleotide-binding domain was detected in CF patients.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riordan, J R -- Rommens, J M -- Kerem, B -- Alon, N -- Rozmahel, R -- Grzelczak, Z -- Zielenski, J -- Lok, S -- Plavsic, N -- Chou, J L -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1066-73.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475911" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Biological Transport ; Cloning, Molecular/methods ; Cystic Fibrosis/*genetics/metabolism/pathology ; Cystic Fibrosis Transmembrane Conductance Regulator ; DNA/*isolation & purification ; *Genes ; *Genes, Recessive ; Humans ; Ion Channels/pathology ; Membrane Proteins/*genetics/isolation & purification ; Molecular Sequence Data ; Peptides/*genetics/isolation & purification ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 51
    facet.materialart.
    Unknown
    Treatment with tin prevents the development of hypertension in spontaneously hypertensive rats (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 52
    facet.materialart.
    Unknown
    Tonic activation of NMDA receptors by ambient glutamate enhances excitability of neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 53
    facet.materialart.
    Unknown
    Nucleotides in yeast tRNAPhe required for the specific recognition by its cognate synthetase (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-10
    Description: An analysis of the aminoacylation kinetics of unmodified yeast tRNAPhe mutants revealed that five single-stranded nucleotides are important for its recognition by yeast phenylalanyl-tRNA synthetase, provided they were positioned correctly in a properly folded tRNA structure. When four other tRNAs were changed to have these five nucleotides, they became near-normal substrates for the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sampson, J R -- DiRenzo, A B -- Behlen, L S -- Uhlenbeck, O C -- GM 37552/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1363-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646717" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acyl-tRNA Synthetases/*metabolism ; Base Sequence ; Escherichia coli/genetics ; Models, Molecular ; Molecular Sequence Data ; Mutation ; Nucleic Acid Conformation ; Phenylalanine-tRNA Ligase/*metabolism ; Plants/genetics ; RNA, Transfer, Amino Acid-Specific/*genetics ; RNA, Transfer, Phe/*genetics/metabolism ; Schizosaccharomyces/genetics ; Transcription, Genetic ; Triticum/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 54
    facet.materialart.
    Unknown
    The product of the mos proto-oncogene as a candidate "initiator" for oocyte maturation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: The endogenous c-mos product, pp39mos, is required for progesterone-induced meiotic maturation in Xenopus oocytes. Treatment of oocytes with progesterone induced a rapid increase in pp39mos that preceded both the activation of maturation promoting factor (MPF) and germinal vesicle breakdown (GVBD). Microinjection of synthetic mos RNA into oocytes activated MPF and induced GVBD in the absence of progesterone. Thus, the mos proto-oncogene product may qualify as a candidate "initiator" protein of MPF and is at least one of the "triggers" for G2 to M transition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagata, N -- Daar, I -- Oskarsson, M -- Showalter, S D -- Vande Woude, G F -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):643-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉BRI-Basic Research Program, National Cancer Institute, Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474853" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cycloheximide/pharmacology ; Female ; Growth Substances/physiology ; Kinetics ; Maturation-Promoting Factor ; Meiosis/drug effects ; Microinjections ; Oocytes/*physiology ; Progesterone/pharmacology ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*physiology ; Proto-Oncogene Proteins c-mos ; RNA/genetics ; Transcription, Genetic ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 55
    facet.materialart.
    Unknown
    High-level recombinant gene expression in rabbit endothelial cells transduced by retroviral vectors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 56
    facet.materialart.
    Unknown
    The neostriatal mosaic: striatal patch-matrix organization is related to cortical lamination (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 57
    facet.materialart.
    Unknown
    Identification of a thyroid hormone receptor that is pituitary-specific (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 58
    facet.materialart.
    Unknown
    Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 59
    facet.materialart.
    Unknown
    The EGF receptor kinase substrate p35 in the floor plate of the embryonic rat CNS (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 60
    facet.materialart.
    Unknown
    Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 61
    facet.materialart.
    Unknown
    Novel sites of expression of functional angiotensin II receptors in the late gestation fetus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 62
    facet.materialart.
    Unknown
    Expression of high-affinity binding of human immunoglobulin E by transfected cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 63
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 64
    facet.materialart.
    Unknown
    Regulation of calcium release is gated by calcium current, not gating charge, in cardiac myocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: In skeletal muscle, intramembrane charge movement initiates the processes that lead to the release of calcium from the sarcoplasmic reticulum. In cardiac muscle, in contrast, the similarity of the voltage dependence of developed tension and intracellular calcium transients to that of calcium current suggests that the calcium current may gate the release of calcium. Nevertheless, a mechanism similar to that of skeletal muscle continues to be postulated for cardiac muscle. By using rapid exchange (20 to 50 milliseconds) of the extracellular solutions in rat ventricular myocytes in which the intracellular calcium transients or cell shortening were measured, it has now been shown that the influx of calcium through the calcium channel is a mandatory link in the processes that couple membrane depolarization to the release of calcium. Thus, intramembrane charge movement does not contribute to the release of calcium in heart muscle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nabauer, M -- Callewaert, G -- Cleemann, L -- Morad, M -- R01-HL16152/HL/NHLBI NIH HHS/ -- R01-HL33720/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):800-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Pennsylvania, Department of Physiology, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543067" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Barium/metabolism/pharmacology ; Benzofurans ; Buffers ; Calcium/*metabolism ; Calcium Channels/*physiology ; Dialysis ; Egtazic Acid/pharmacology ; Extracellular Space/metabolism ; Fluorescent Dyes ; Fura-2 ; Heart/drug effects/*physiology ; Heart Ventricles ; Membrane Potentials ; Myocardial Contraction ; Rats ; Sarcoplasmic Reticulum/metabolism ; Sodium/metabolism ; Spectrometry, Fluorescence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 65
    facet.materialart.
    Unknown
    Angiotensin II: does it have a direct obligate role in ovulation? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Naftolin, F -- Andrade-Gordon, P -- Pellicer, A -- Palumbo, A -- Apa, R -- Zreik, T -- Yoon, T K -- DeCherney, A -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):870-1.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Obstetrics and Gynecology, Yale University, New Haven, CT 06510-8063.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772639" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Sarcosine-8-Isoleucine Angiotensin II/pharmacology ; Angiotensin II/*physiology ; Animals ; Chorionic Gonadotropin/pharmacology ; Female ; Gonadotropins, Equine/pharmacology ; *Ovulation ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/analysis ; Receptors, LH/analysis ; Saralasin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 66
    facet.materialart.
    Unknown
    Mechanisms for regulating expression of membrane isoforms of Fc gamma RIII (CD16) (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: Granulocyte and natural killer (NK) cell Fc receptors for immunoglobulin G (CD16) differ in only a few amino acids, yet have phosphatidylinositol glycan (PIG) or polypeptide membrane anchors, respectively. Mutagenesis shows that anchoring is regulated by a serine residue near the PIG anchor attachment site in the extracellular domain. The NK cell isoform was not expressed on the surface of COS cells unless cotransfected with a subunit that was expressed in NK cells and that was identical to the gamma subunit of the high affinity IgE Fc receptor (Fc epsilon RI). However, the CD16 sequence and not expression of the gamma subunit is dominant in regulating PIG reanchoring.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hibbs, M L -- Selvaraj, P -- Carpen, O -- Springer, T A -- Kuster, H -- Jouvin, M H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531918" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/genetics ; Antigens, Differentiation/*genetics ; Cell Line ; Cell Membrane/immunology ; Flow Cytometry ; *Gene Expression Regulation ; Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Immunoglobulin G ; Killer Cells, Natural/immunology ; L Cells (Cell Line)/immunology ; Mice ; Mutation ; RNA, Messenger/genetics/isolation & purification ; Receptors, Fc/*genetics ; Receptors, IgG ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 67
    facet.materialart.
    Unknown
    Protection of dentate hilar cells from prolonged stimulation by intracellular calcium chelation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-13
    Description: Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein-negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Scharfman, H E -- Schwartzkroin, P A -- NS-01744/NS/NINDS NIH HHS/ -- NS-15317/NS/NINDS NIH HHS/ -- NS-18895/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):257-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2508225" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Calcium/*metabolism ; Calcium-Binding Proteins/metabolism ; Egtazic Acid/pharmacology ; Electric Stimulation ; Female ; Hippocampus/cytology/drug effects/*physiology ; In Vitro Techniques ; Neurons/drug effects/physiology ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 68
    facet.materialart.
    Unknown
    Sindbis virus: an efficient, broad host range vector for gene expression in animal cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-03
    Description: Sindbis virus, an enveloped virus with a single-stranded RNA genome, was engineered to express a bacterial protein, chloramphenicol acetyltransferase (CAT), in cultured insect, avian, and mammalian cells. The vectors were self-replicating and gene expression was efficient and rapid; up to 10(8) CAT polypeptides were produced per infected cell in 16 to 20 hours. CAT expression could be made temperature-sensitive by means of a derivative that incorporated a temperature-sensitive mutation in viral RNA synthesis. Vector genomic RNAs were packaged into infectious particles when Sindbis helper virus was used to supply virion structural proteins. The vector RNAs were stable to at least seven cycles of infection. The expression of CAT increased about 10(3)-fold, despite a 10(15)-fold dilution during the passaging. Sindbis virus vectors should prove useful for expressing large quantities of gene products in a variety of animal cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Xiong, C -- Levis, R -- Shen, P -- Schlesinger, S -- Rice, C M -- Huang, H V -- AG05681/AG/NIA NIH HHS/ -- AI11377/AI/NIAID NIH HHS/ -- AI24134/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1188-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922607" target="_blank"〉PubMed〈/a〉
    Keywords: Aedes ; Animals ; Bacteria/enzymology ; Cells, Cultured ; Chick Embryo ; Chloramphenicol O-Acetyltransferase/*genetics ; Codon ; Cricetinae ; DNA/genetics ; Drosophila ; Gene Amplification ; Gene Expression Regulation ; *Genetic Engineering ; *Genetic Vectors ; Humans ; Quail ; RNA, Viral/*genetics ; Sindbis Virus/*genetics ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 69
    facet.materialart.
    Unknown
    Reversible cleavage and ligation of hepatitis delta virus RNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: A 148-nucleotide subfragment of hepatitis delta virus RNA was shown to undergo cleavage and ligation reversibly. The direction of the reaction is determined by the presence or absence of Mg2+ ions, with the presence of Mg2+ favoring the cleavage reaction. Ligation requires specific conformation of the RNA molecules involved and occurs only between two cleaved RNA fragments that are still held together by hydrogen bonds. The ligation reaction occurs rapidly on removal of Mg2+ by EDTA. This represents a new class of RNA enzymes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wu, H N -- Lai, M M -- AI26741/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):652-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492677" target="_blank"〉PubMed〈/a〉
    Keywords: Edetic Acid/pharmacology ; Electrophoresis, Polyacrylamide Gel ; Hepatitis Delta Virus/*genetics ; Hot Temperature ; Hydrogen Bonding ; Magnesium/pharmacology ; Nucleic Acid Conformation ; Plasmids ; RNA, Viral/biosynthesis/*metabolism ; T-Phages/enzymology ; Transcription, Genetic ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 70
    facet.materialart.
    Unknown
    Selective loss of hippocampal granule cells in the mature rat brain after adrenalectomy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Adrenalectomy of adult male rats resulted in a nearly complete loss of hippocampal granule cells 3 to 4 months after surgery. Nissl and immunocytochemical staining of hippocampal neurons revealed that the granule cell loss was selective; there was no apparent loss of hippocampal pyramidal cells or of gamma-amino butyric acid (GABA)-, somatostatin-, neuropeptide Y-, calcium binding protein-, or parvalbumin-containing hippocampal interneurons. The hippocampal CA1 pyramidal cells of adrenalectomized animals exhibited normal electrophysiological responses to afferent stimulation, whereas responses evoked in the dentate gyrus were severely attenuated. Corticosterone replacement prevented both the adrenalectomy-induced granule cell loss and the attenuated physiological response. Thus, the adrenal glands play a role in maintaining the structural integrity of the normal adult brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sloviter, R S -- Valiquette, G -- Abrams, G M -- Ronk, E C -- Sollas, A L -- Paul, L A -- Neubort, S -- NS18201/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):535-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurology Research Center, Helen Hayes Hospital, New York State Department of Health, West Haverstraw 10993.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911756" target="_blank"〉PubMed〈/a〉
    Keywords: *Adrenalectomy ; Animals ; Annexin A6 ; Calcium-Binding Proteins/analysis ; Corticosterone/pharmacology ; Cytoplasmic Granules ; Electrophysiology ; Evoked Potentials ; Hippocampus/*cytology/drug effects/physiology ; Immunohistochemistry ; Male ; Neurons/cytology/physiology ; Potassium/blood ; Rats ; Sodium/blood ; Weight Gain
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 71
    facet.materialart.
    Unknown
    Regulation of proenkephalin by Fos and Jun (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: Fos and Jun form a heterodimeric complex that associates with the nucleotide sequence motif known as the AP-1 binding site. Although this complex has been proposed to function as a transcriptional regulator in neurons, no specific target gene has yet been identified. Proenkephalin mRNA increased in the hippocampus during seizure just after an increase in c-fos and c-jun expression was detected. Fos-Jun complexes bound specifically to a regulatory sequence in the 5' control region of the proenkephalin gene. Furthermore, c-fos and c-jun stimulated transcription from this control region synergistically in transactivation assays. These data suggest that the proenkephalin gene may be a physiological target for Fos and Jun in the hippocampus and indicate that these proto-oncogene transcription factors may play a role in neuronal responses to stimulation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sonnenberg, J L -- Rauscher, F J 3rd -- Morgan, J I -- Curran, T -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1622-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Oncology, Molecular Biology, Roche Research Center, Nutley, NJ 07110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512642" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Brain/*metabolism ; Cell Line ; DNA-Binding Proteins/*genetics/metabolism ; Enhancer Elements, Genetic ; Enkephalins/*genetics ; *Gene Expression Regulation ; *Genes ; Hippocampus/metabolism ; Mice ; Molecular Sequence Data ; Promoter Regions, Genetic ; Protein Precursors/*genetics ; Protein-Tyrosine Kinases/*genetics ; Proto-Oncogene Proteins/*genetics/metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; *Proto-Oncogenes ; RNA, Messenger/genetics ; Teratoma ; Transcription Factors/*genetics/metabolism ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 72
    facet.materialart.
    Unknown
    Hyperpolarizing vasodilators activate ATP-sensitive K+ channels in arterial smooth muscle (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Vasodilators are used clinically for the treatment of hypertension and heart failure. The effects of some vasodilators seem to be mediated by membrane hyperpolarization. The molecular basis of this hyperpolarization has been investigated by examining the properties of single K+ channels in arterial smooth muscle cells. The presence of adenosine triphosphate (ATP)-sensitive K+ channels in these cells was demonstrated at the single channel level. These channels were opened by the hyperpolarizing vasodilator cromakalim and inhibited by the ATP-sensitive K+ channel blocker glibenclamide. Furthermore, in arterial rings the vasorelaxing actions of the drugs diazoxide, cromakalim, and pinacidil and the hyperpolarizing actions of vasoactive intestinal polypeptide and acetylcholine were blocked by inhibitors of the ATP-sensitive K+ channels, suggesting that all these agents may act through a common pathway in smooth muscle by opening ATP-sensitive K+ channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Standen, N B -- Quayle, J M -- Davies, N W -- Brayden, J E -- Huang, Y -- Nelson, M T -- HL 35911/HL/NHLBI NIH HHS/ -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):177-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Leicester, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501869" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholine/pharmacology ; Adenosine Triphosphate/*metabolism ; Animals ; Benzopyrans/antagonists & inhibitors/pharmacology ; Cerebral Arteries ; Cromakalim ; Diazoxide/pharmacology ; Glyburide/pharmacology ; Guanidines/pharmacology ; Mesenteric Arteries ; Muscle, Smooth, Vascular/*metabolism ; Pinacidil ; Potassium Channels/*drug effects/metabolism ; Pyrroles/antagonists & inhibitors/pharmacology ; Rabbits ; Rats ; Tolbutamide/pharmacology ; Vasoactive Intestinal Peptide/pharmacology ; Vasodilator Agents/antagonists & inhibitors/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 73
    facet.materialart.
    Unknown
    NMDA antagonists differentiate epileptogenesis from seizure expression in an in vitro model (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: In an electrographic model of seizures in the hippocampal slice, both of the N-methyl-D-aspartate (NMDA) antagonists 2-amino-5-phosphonovaleric acid and 5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohepten-5,10-imine maleate (MK-801) prevented the progressive development of seizures but did not block previously induced seizures. Thus, a process dependent on the NMDA receptor-ionophore complex establishes a long-lasting, seizure-prone state; thereafter the seizures depend on non-NMDA receptor-ionophore mechanisms. This suggests that there is an important distinction between epileptogenesis and seizure expression and between antiepileptogenic and anticonvulsant pharmacological agents.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stasheff, S F -- Anderson, W W -- Clark, S -- Wilson, W A -- NS 17771/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):648-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Epilepsy Center, Veterans Administration Medical Center, Durham, NC 27705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569762" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate ; Animals ; Anticonvulsants/pharmacology ; Aspartic Acid/*analogs & derivatives/antagonists & inhibitors ; Dibenzocycloheptenes/pharmacology ; *Disease Models, Animal ; Dizocilpine Maleate ; Electric Stimulation ; Electrophysiology ; Epilepsy/*physiopathology ; Evoked Potentials ; Hippocampus/*physiopathology ; In Vitro Techniques ; N-Methylaspartate ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Seizures/*physiopathology ; Valine/analogs & derivatives/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 74
    facet.materialart.
    Unknown
    Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The discovery that the AP-1 family of enhancer binding factors includes a complex of the cellular Fos (cFos) and cellular Jun (cJun) proteins established a direct and important link between oncogenesis and transcriptional regulation. Homodimeric cJun protein synthesized in vitro is capable of binding selectively to AP-1 recognition sites, whereas the cFos polypeptide is not. When cotranslated, the cFos and cJun proteins can form a stable, heterodimeric complex with the DNA binding properties of AP-1/cJun. The related proteins Jun B and vJun are also able to form DNA binding complexes with cFos. Directed mutagenesis of the cFos protein reveals that a leucine repeat structure is required for binding to cJun, in a manner consistent with the proposed function of the "leucine zipper." A novel domain adjacent to, but distinct from, the leucine repeat of cFos is required for DNA binding by cFos-cJun heterodimers. Thus experimental evidence is presented that leucine repeats can mediate complex formation between heterologous proteins and that promotes further understanding of the molecular mechanisms underlying the function of two proto-oncogene products.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turner, R -- Tjian, R -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1689-94.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494701" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Chromatography, Affinity ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation ; Humans ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Oncogenes ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 75
    facet.materialart.
    Unknown
    The cholinergic neuronal differentiation factor from heart cells is identical to leukemia inhibitory factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 76
    facet.materialart.
    Unknown
    Two NF1 translocations map within a 600-kilobase segment of 17q11.2 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-02
    Description: Balanced translocations, each involving chromosome 17q11.2, have been described in two patients with von Recklinghausen neurofibromatosis (NF1). To better localize the end points of these translocation events, and the NF1 gene (NF1) itself, human cosmids were isolated and mapped in the immediate vicinity of NF1. One cosmid probe, c11-1F10, demonstrated that both translocation breakpoints, and presumably NF1, are contained within a 600-kilobase Nru I fragment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Connell, P -- Leach, R -- Cawthon, R M -- Culver, M -- Stevens, J -- Viskochil, D -- Fournier, R E -- Rich, D C -- Ledbetter, D H -- White, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1087-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of Utah, Salt Lake City 84132.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543077" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Mapping ; *Chromosomes, Human, Pair 17 ; Cosmids ; DNA Restriction Enzymes ; Deoxyribonucleases, Type II Site-Specific ; Electrophoresis ; Genetic Linkage ; Humans ; Hybrid Cells ; Neurofibromatosis 1/*genetics ; Rats ; *Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 77
    facet.materialart.
    Unknown
    Parallel association of Fos and Jun leucine zippers juxtaposes DNA binding domains (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The protein products of the fos and jun proto-oncogenes form a heterodimeric complex that participates in a stable high affinity interaction with DNA elements containing AP-1 binding sites. The effects of deletions and point mutations in Fos and Jun on protein complex formation and DNA binding have been examined. The data suggest that Fos and Jun dimerize via a parallel interaction of helical domains containing a heptad repeat of leucine residues (the leucine zipper). Dimerization is required for DNA binding and results in the appropriate juxtaposition of basic amino acid regions from Fos and Jun, both of which are required for association with DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gentz, R -- Rauscher, F J 3rd -- Abate, C -- Curran, T -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1695-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Oncology, Roche Institute of Molecular Biology, Nutley, NJ 07110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494702" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Cross-Linking Reagents ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Glutaral ; Immunosorbent Techniques ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Protein Conformation ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 78
    facet.materialart.
    Unknown
    Histone H5 in the control of DNA synthesis and cell proliferation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: The linker histones (H1, H5, H1 degrees) are involved in the condensation of chromatin into the 30-nanometer fiber. This supranucleosome organization correlates with the resting state of chromatin, and it is therefore possible that the linker histones play an active role in the control of chromatin activity. The effect of H5 has been directly determined by expression of an inducible transfected H5 gene in rat sarcoma cells, which do not produce H5. Transfection resulted in the reversible inhibition of DNA replication and arrest of cells in G1, at which time H5 concentrations approached that of terminally differentiated avian erythrocytes. The arrest of proliferation was accompanied by specific changes in gene expression probably related to the cell cycle block. The selectivity of these effects suggest that H5 plays an active role in the control of DNA replication and cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, J M -- Wiaderkiewicz, R -- Ruiz-Carrillo, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):68-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cancer Research Center, Laval University School of Medicine, L'Hotel-Dieu du Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740916" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Cycle ; Cell Division ; Cell Line ; Chickens ; DNA/*biosynthesis ; *DNA Replication ; Histones/genetics/*physiology ; Rats ; Receptors, Glucocorticoid/biosynthesis ; Recombinant Proteins/pharmacology ; Sarcoma, Experimental ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 79
    facet.materialart.
    Unknown
    Access to a messenger RNA sequence or its protein product is not limited by tissue or species specificity (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: RNA amplification with transcript sequencing (RAWTS) is a rapid and sensitive method of direct sequencing that involves complementary DNA synthesis, polymerase chain reaction (PCR) with a primer or primers containing a phage promoter, transcription from the phage promoter, and reverse transcriptase-mediated sequencing. By means of RAWTS, it was possible to sequence each of four tissue-specific human messenger RNAs (blue pigment, factor IX, phenylalanine hydroxylase, and tyrosine hydroxylase) in four cell types examined (white blood cells, liver, K562 erythroleukemia cells, and chorionic villus cells). These results indicate that there is a basal rate of transcription, splicing, and polyadenylation of tissue-specific mRNAs in adult and embryonic tissues. In addition to revealing sequence information, it is possible to generate a desired in vitro translation product by incorporating a translation initiation signal into the appropriate PCR primer. RAWTS can be used to obtain novel mRNA sequence information from other species as illustrated with a segment of the catalytic domain of factor IX. In general, the ability to obtain mRNA sequences rapidly across species boundaries should aid both the study of protein evolution and the identification of sequences crucial for protein structure and function.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sarkar, G -- Sommer, S S -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):331-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology and Molecular Biology, Mayo Clinic/Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2565599" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Chorionic Villi/analysis ; DNA/biosynthesis ; DNA-Directed DNA Polymerase/metabolism ; Factor IX/*genetics ; Gene Amplification ; Humans ; Leukemia, Erythroblastic, Acute/metabolism ; Leukocytes/analysis ; Liver/analysis ; Molecular Sequence Data ; Phenylalanine Hydroxylase/*genetics ; Promoter Regions, Genetic ; Protein Biosynthesis ; RNA, Messenger/*genetics ; Retinal Pigments/*genetics ; Species Specificity ; Tissue Distribution ; Transcription, Genetic ; Tumor Cells, Cultured ; Tyrosine 3-Monooxygenase/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 80
    facet.materialart.
    Unknown
    Activation of bacterial porin gene expression by a chimeric signal transducer in response to aspartate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-15
    Description: The Tar chemoreceptor of Escherichia coli is a membrane-bound sensory protein that facilitates bacterial chemotaxis in response to aspartate. The EnvZ molecule has a membrane topology similar to Tar and is a putative osmosensor that is required for osmoregulation of the genes for the major outer membrane porin proteins, OmpF and OmpC. The cytoplasmic signaling domain of Tar was replaced with the carboxyl portion of EnvZ, and the resulting chimeric receptor activated transcription of the ompC gene in response to aspartate. The activation of ompC by the chimeric receptor was absolutely dependent on OmpR, a transcriptional activator for ompF and ompC.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Utsumi, R -- Brissette, R E -- Rampersaud, A -- Forst, S A -- Oosawa, K -- Inouye, M -- GM12350/GM/NIGMS NIH HHS/ -- GM1553/GM/NIGMS NIH HHS/ -- GM19043-16/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1246-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, Piscataway 08854.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476847" target="_blank"〉PubMed〈/a〉
    Keywords: Aspartic Acid/*pharmacology ; Bacterial Outer Membrane Proteins/*genetics/metabolism ; Bacterial Proteins ; Chemoreceptor Cells ; Chimera ; Escherichia coli/*genetics/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Ion Channels ; Osmolar Concentration ; Plasmids ; Porins ; Signal Transduction/*drug effects ; Transcription, Genetic ; Triethylenephosphoramide ; Water-Electrolyte Balance
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 81
    facet.materialart.
    Unknown
    The design and catalytic properties of a simplified ribonuclease P RNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-30
    Description: Ribonuclease P (RNase P) RNA is the catalytic moiety of the ribonucleoprotein enzyme that removes precursor sequences from the 5' ends of pre-transfer RNAs in eubacteria. Phylogenetic variation according to recently proposed secondary structure models was used to identify structural elements of the RNase P RNA that are dispensable for catalysis. A simplified RNase P RNA that consists only of evolutionarily conserved features was designed, synthesized, and characterized. Although the simplified RNA (Min 1 RNA) is only 263 nucleotides in length, in contrast to the 354 to 417 nucleotides of naturally occurring RNase P RNAs, its specificity of pre-tRNA cleavage is identical to that of the native enzymes. Moreover, the catalytic efficiencies of the Min 1 RNA and the native RNA enzymes are similar. These results focus the search for the catalytic elements of RNase P RNAs to their conserved structure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Waugh, D S -- Green, C J -- Pace, N R -- GM29231/GM/NIGMS NIH HHS/ -- GM34527/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1569-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Indiana University, Bloomington 47405.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472671" target="_blank"〉PubMed〈/a〉
    Keywords: Bacillus megaterium/enzymology ; Base Sequence ; Biological Evolution ; Catalysis ; Cloning, Molecular ; DNA-Directed RNA Polymerases/genetics ; Endoribonucleases/genetics/*metabolism ; Escherichia coli/enzymology ; *Escherichia coli Proteins ; Molecular Sequence Data ; Nucleic Acid Conformation ; Plasmids ; Promoter Regions, Genetic ; RNA, Bacterial/genetics/*metabolism ; Ribonuclease P ; Species Specificity ; T-Phages/enzymology/genetics ; Temperature ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 82
    facet.materialart.
    Unknown
    Amyloid beta protein enhances the survival of hippocampal neurons in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: The beta-amyloid protein is progressively deposited in Alzheimer's disease as vascular amyloid and as the amyloid cores of neuritic plaques. Contrary to its metabolically inert appearance, this peptide may have biological activity. To evaluate this possibility, a peptide ligand homologous to the first 28 residues of the beta-amyloid protein (beta 1-28) was tested in cultures of hippocampal pyramidal neurons for neurotrophic or neurotoxic effects. The beta 1-28 appeared to have neurotrophic activity because it enhanced neuronal survival under the culture conditions examined. This finding may help elucidate the sequence of events leading to plaque formation and neuronal damage in Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Whitson, J S -- Selkoe, D J -- Cotman, C W -- AG00538/AG/NIA NIH HHS/ -- AG07918/AG/NIA NIH HHS/ -- MH19691/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1488-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928783" target="_blank"〉PubMed〈/a〉
    Keywords: Amyloid/*pharmacology ; *Amyloid beta-Peptides ; *Amyloid beta-Protein Precursor ; Animals ; Cell Adhesion/drug effects ; Cell Survival ; Cells, Cultured ; Hippocampus/*cytology/embryology ; Neurons/cytology ; Peptide Fragments/*pharmacology ; Rats ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 83
    facet.materialart.
    Unknown
    Specific expression of nuclear proto-oncogenes before entry into meiotic prophase of spermatogenesis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-18
    Description: The expression of proto-oncogenes representative of several functional categories has been investigated during development of mouse male germ cells. The c-raf proto-oncogene and three members of the c-ras gene family were expressed in mitotically active stem cells, throughout the prophase of meiosis and to varying extents in post-meiotic cell types. In contrast, the nuclear proto-oncogenes c-fos, c-jun, and c-myc were specifically expressed at high levels in type B spermatogonia. High levels of c-myc and c-jun RNAs were also detected in spermatocytes early in the prophase of meiosis. The type B spermatogonia represent the last mitotic cell division before entry into meiotic prophase; therefore, these nuclear proto-oncogenes may be involved in altering programs of gene expression at this developmental transition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wolfes, H -- Kogawa, K -- Millette, C F -- Cooper, G M -- CA 21082/CA/NCI NIH HHS/ -- CA 28946/CA/NCI NIH HHS/ -- HD 15269/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):740-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475907" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Nucleus/*metabolism ; DNA-Binding Proteins/genetics ; *Gene Expression Regulation ; Male ; *Meiosis ; Mice ; Nucleic Acid Hybridization ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Proto-Oncogene Proteins c-myc ; Proto-Oncogene Proteins c-raf ; Proto-Oncogene Proteins p21(ras) ; *Proto-Oncogenes ; RNA/analysis ; Spermatids/metabolism ; Spermatocytes/metabolism ; *Spermatogenesis ; Spermatogonia/metabolism ; Spermatozoa/analysis/metabolism/*ultrastructure ; Transcription Factors/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 84
    facet.materialart.
    Unknown
    Neural connections between the lateral geniculate nucleus and visual cortex in vitro (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Neural connections were established in cocultures of rat visual cortex (VC) and lateral geniculate nucleus (LGN), which were isolated in early infancy. Morphological and electrophysiological studies showed that the cortical laminar organization of afferent and efferent connections in the coculture preparations was similar to that in the adult VC. The results indicate the existence of intrinsic mechanisms in VC and LGN that guide the formation of synaptic connections with the appropriate targets.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamoto, N -- Kurotani, T -- Toyama, K -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):192-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Kyoto Prefectural School of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749258" target="_blank"〉PubMed〈/a〉
    Keywords: Afferent Pathways/physiology ; Animals ; Axons/physiology ; Culture Techniques ; Efferent Pathways/physiology ; Electrophysiology ; Geniculate Bodies/cytology/*physiology ; Organ Culture Techniques ; Rats ; Rats, Inbred Strains ; Synapses/physiology ; Visual Cortex/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 85
    facet.materialart.
    Unknown
    The periaqueductal gray matter mediates opiate-induced immunosuppression (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The periaqueductal gray matter of the mesencephalon (PAG) subserves a variety of diverse autonomic functions and also appears to be a site for opiate action in the induction of immunosuppression. Microinjections of morphine into the PAG, but not into other opiate receptor-containing neuroanatomical sites, result in a rapid suppression of natural killer (NK) cell activity. The NK cell suppression can be blocked by prior peripheral administration of the opiate antagonist naltrexone. These findings demonstrate that certain central actions of opiates that produce changes in NK cell function are mediated through opiate receptors in the PAG and identify a brain region involved in opiate regulation of immune function.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weber, R J -- Pert, A -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):188-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Medicinal Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749256" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immune Tolerance ; Killer Cells, Natural/drug effects/immunology ; Male ; Mesencephalon/drug effects/*immunology ; Microinjections ; Morphine/administration & dosage/antagonists & inhibitors/*pharmacology ; Naltrexone/pharmacology ; Rats ; Rats, Inbred F344
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 86
    facet.materialart.
    Unknown
    Functionally distinct NF-kappa B binding sites in the immunoglobulin kappa and IL-2 receptor alpha chain genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-28
    Description: The interleukin-2 receptor alpha (IL-2R alpha) chain gene contains a sequence similar to the immunoglobulin (Ig) kappa (kappa) enhancer NF-kappa B binding site. This site, which is bound by the nuclear protein, NF-kappa B, is critical for Ig kappa gene expression. The major T cell nuclear factor that binds to the IL-2R alpha site in vitro appears indistinguishable from NF-kappa B. NF-kappa B binds to IL-2R alpha and kappa sequences with similar affinities; however, only the kappa site potently activates transcription from heterologous promoters. Thus, high-affinity NF-kappa B binding in vitro cannot be equated with transcriptional activation in vivo. Mutation of the NF-kappa B binding site in the context of an IL-2 R alpha promoter construct markedly diminished promoter activity in human T cell lymphotropic virus type I (HTLV-I)-transformed MT-2 cells but not in phorbol myristate acetate-stimulated Jurkat T cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cross, S L -- Halden, N F -- Lenardo, M J -- Leonard, W J -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):466-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497520" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Cell Line, Transformed ; DNA-Binding Proteins/*metabolism ; *Enhancer Elements, Genetic ; *Gene Expression Regulation ; HIV-1/genetics ; HeLa Cells ; Human T-lymphotropic virus 1 ; Humans ; Immunoglobulin kappa-Chains/*genetics ; Mice ; Molecular Sequence Data ; Mutation ; NF-kappa B ; Promoter Regions, Genetic ; Receptors, Interleukin-2/*genetics ; T-Lymphocytes/metabolism ; Tetradecanoylphorbol Acetate/pharmacology ; Transcription Factors/*metabolism ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 87
    facet.materialart.
    Unknown
    Fenfluramine studies (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Derome-Tremblay, M -- Nathan, C -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):991.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922597" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Fenfluramine/administration & dosage/therapeutic use/*toxicity ; Humans ; Obesity/drug therapy ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 88
    facet.materialart.
    Unknown
    AIDS-Kaposi's sarcoma-derived cells express cytokines with autocrine and paracrine growth effects (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: When grown in vitro, cells from Kaposi's sarcoma lesions of AIDS patients (AIDS-KS cells) constitutively release several growth promoting activities. When inoculated into nude mice, the AIDS-KS cells induce a KS-like lesion of mouse origin. Here it is shown that the AIDS-KS cells express messenger RNA for a complex mixture of cytokines that correlate with several of the biological activities of these cells. Basic fibroblast growth factor, which is a potent angiogenic factor, and interleukin-1 messenger RNAs are expressed at very high levels and seem to account for a large proportion of the activities, since their corresponding proteins are released in biologically active form into the culture media where they induce autocrine and paracrine growth effects.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ensoli, B -- Nakamura, S -- Salahuddin, S Z -- Biberfeld, P -- Larsson, L -- Beaver, B -- Wong-Staal, F -- Gallo, R C -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):223-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Tumor Cell Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2643161" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*complications ; Biological Factors/*genetics ; Cytokines ; Fibroblast Growth Factors/genetics ; Humans ; Interleukin-1/genetics ; RNA, Messenger/genetics/isolation & purification ; Reference Values ; Sarcoma, Kaposi/etiology/*genetics/pathology ; Transcription, Genetic ; Tumor Cells, Cultured/*cytology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 89
    facet.materialart.
    Unknown
    An ultraviolet-sensitive RNA structural element in a viroid-like domain of the hepatitis delta virus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: The RNA genome of the hepatitis delta virus (HDV) appears to be made up of two parts: a small domain with a high degree of sequence conservation and structural features likely to promote replication; plus a second, larger domain that is less conserved and encodes the delta antigen. This report focuses on one of the several sets of data that have led to the proposal of this model: the existence of a novel structural element in HDV genomic RNA. This structural element lies within the highly conserved domain of HDV RNA and may be related to the local tertiary structure previously mapped to the central conserved region of the plant viroid genome. Both elements occur in regions with no apparent coding capacity and are distinctively responsive to ultraviolet (UV) light. Transcripts containing partial and full-length genomic sequences of HDV readily undergo a UV-induced crosslinking reaction, which establishes a covalent bond between two noncontiguous segments. By locking two segments of the overall structure into place, this crosslink has permitted the unbranched, rodlike model of HDV RNA to be examined and confirmed in the portion of the RNA analyzed. The clustering of the novel tertiary structure and the recently discovered self-cleavage sites into a highly conserved, but apparently noncoding, portion of the genome defines a viroid-like domain in HDV RNA and raises questions about the possible events leading up to the association of free-living RNAs with messenger RNAs and other RNA molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Branch, A D -- Benenfeld, B J -- Baroudy, B M -- Wells, F V -- Gerin, J L -- Robertson, H D -- DA-5130/DA/NIDA NIH HHS/ -- GM-28294/GM/NIGMS NIH HHS/ -- N01-AI-72623/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):649-52.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Genetics, Rockefeller University, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492676" target="_blank"〉PubMed〈/a〉
    Keywords: DNA/genetics ; Electrophoresis, Polyacrylamide Gel ; *Genes ; *Genes, Viral ; Hepatitis Delta Virus/*genetics ; Macromolecular Substances ; RNA, Ribosomal, 5S ; RNA, Viral/metabolism/*radiation effects ; Ribonuclease T1/metabolism ; Ribonuclease, Pancreatic/metabolism ; Transcription, Genetic ; *Ultraviolet Rays
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 90
    facet.materialart.
    Unknown
    Perineurium originates from fibroblasts: demonstration in vitro with a retroviral marker (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: A cellular sheath, the perineurium, forms a protective barrier around fascicles of nerve fibers throughout the peripheral nervous system. In a study to determine the cellular origin of perineurium, a culture system was used in which perineurium forms after purified populations of sensory neurons, Schwann cells, and fibroblasts are recombined. Before recombination, the Schwann cells or the fibroblasts were labeled by infection with a defective recombinant retrovirus whose gene product, beta-galactosidase, is histochemically detectable in the progeny of infected cells. Perineurial cells were labeled when fibroblasts had been infected but not when Schwann cells had been infected. Thus, perineurium arises from fibroblasts in vitro and, by implication, in vivo as well.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bunge, M B -- Wood, P M -- Tynan, L B -- Bates, M L -- Sanes, J R -- NS09923/NS/NINDS NIH HHS/ -- NS22828/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):229-31.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492115" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/ultrastructure ; Cell Transformation, Viral ; Cells, Cultured ; *Connective Tissue Cells ; Fetus ; Fibroblasts/*cytology ; Ganglia, Spinal/*cytology ; Genes ; Neurons/*cytology ; Rats ; Retroviridae/enzymology/*genetics ; Schwann Cells/cytology ; beta-Galactosidase/analysis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 91
    facet.materialart.
    Unknown
    A role for a 70-kilodalton heat shock protein in lysosomal degradation of intracellular proteins (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-20
    Description: A 73-kilodalton (kD) intracellular protein was found to bind to peptide regions that target intracellular proteins for lysosomal degradation in response to serum withdrawal. This protein cross-reacted with a monoclonal antibody raised to a member of the 70-kD heat shock protein (hsp70) family, and sequences of two internal peptides of the 73-kD protein confirm that it is a member of this family. In response to serum withdrawal, the intracellular concentration of the 73-kD protein increased severalfold. In the presence of adenosine 5'-triphosphate (ATP) and MgCl2, the 73-kD protein enhanced protein degradation in two different cell-free assays for lysosomal proteolysis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chiang, H L -- Terlecky, S R -- Plant, C P -- Dice, J F -- AG06116/AG/NIA NIH HHS/ -- DK07542/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):382-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Tufts University School of Medicine, Boston, MA 02111.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799391" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Heat-Shock Proteins/genetics/*physiology ; Immunoblotting ; Lysosomes/*metabolism ; Molecular Sequence Data ; Rats ; Ribonuclease, Pancreatic/genetics/*metabolism ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 92
    facet.materialart.
    Unknown
    The protein kinase domain of the ANP receptor is required for signaling (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-22
    Description: A plasma membrane form of guanylate cyclase is a cell surface receptor for atrial natriuretic peptide (ANP). In response to ANP binding, the receptor-enzyme produces increased amounts of the second messenger, guanosine 3',5'-monophosphate. Maximal activation of the cyclase requires the presence of adenosine 5'-triphosphate (ATP) or nonhydrolyzable ATP analogs. The intracellular region of the receptor contains at least two domains with homology to other proteins, one possessing sequence similarity to protein kinase catalytic domains, the other to regions of unknown function in a cytoplasmic form of guanylate cyclase and in adenylate cyclase. It is now shown that the protein kinase-like domain functions as a regulatory element and that the second domain possesses catalytic activity. When the kinase-like domain was removed by deletion mutagenesis, the resulting ANP receptor retained guanylate cyclase activity, but this activity was independent of ANP and its stimulation by ATP was markedly reduced. A model for signal transduction is suggested in which binding of ANP to the extracellular domain of its receptor initiates a conformational change in the protein kinase-like domain, resulting in derepression of guanylate cyclase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chinkers, M -- Garbers, D L -- GM31362/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1392-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2571188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Atrial Natriuretic Factor/*physiology ; Cyclic GMP/physiology ; DNA Mutational Analysis ; Guanylate Cyclase/metabolism ; Magnesium/physiology ; Protein Kinases/*physiology ; Rats ; Receptors, Atrial Natriuretic Factor ; Receptors, Cell Surface/*physiology/ultrastructure ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 93
    facet.materialart.
    Unknown
    Cloning and expression of a Xenopus embryonic gap junction protein (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-03
    Description: Gap junctions in the early amphibian embryo may play a fundamental role in the regulation of differentiation by mediating the cell-to-cell transfer of chemical signals. A complementary DNA encoding a gap junction present in Xenopus oocytes and early embryos has now been cloned and sequenced. This protein sequence is homologous to the well-characterized gap junction structural proteins rat connexin32 and connexin43. RNA blot analysis of total Xenopus oocyte RNA showed hybridization to a single 1.6-kilobase band. This messenger RNA is abundant in oocytes, decreases to levels below the sensitivity of our assay by stage 15 (18 hours), and is not detectable in RNA from a number of adult organs. To confirm that the oocyte cDNA encodes a gap junction channel, the protein was over expressed in Xenopus oocytes by injection of RNA synthesized in vitro. Pairs of RNA-injected oocytes formed many more time- and voltage-sensitive cell-cell channels than water-injected pairs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ebihara, L -- Beyer, E C -- Swenson, K I -- Paul, D L -- Goodenough, D A -- GM18974/GM/NIGMS NIH HHS/ -- GM37751/GM/NIGMS NIH HHS/ -- HL28958-06/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1194-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466337" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cell Communication ; *Cloning, Molecular ; Connexins ; DNA Probes ; Electric Conductivity ; Female ; Gene Expression Regulation ; Intercellular Junctions/physiology ; Membrane Proteins/*genetics/physiology ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oocytes/analysis/physiology ; RNA/analysis ; RNA, Messenger/analysis ; Rats ; Tissue Distribution ; Xenopus/*embryology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 94
    facet.materialart.
    Unknown
    Cyclosporin A specifically inhibits function of nuclear proteins involved in T cell activation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-22
    Description: One action of cyclosporin A thought to be central to many of its immunosuppressive effects is its ability to inhibit the early events of T lymphocyte activation such as lymphokine gene transcription in response to signals initiated at the antigen receptor. Cyclosporin A was found to specifically inhibit the appearance of DNA binding activity of NF-AT, AP-3, and to a lesser extent NF-kappa B, nuclear proteins that appear to be important in the transcriptional activation of the genes for interleukin-2 and its receptor, as well as several other lymphokines. In addition, cyclosporin A abolished the ability of the NF-AT binding site to activate a linked promoter in transfected mitogen-stimulated T lymphocytes and in lymphocytes from transgenic mice. These results indicate that cyclosporin A either directly inhibits the function of nuclear proteins critical to T lymphocyte activation or inhibits the action of a more proximal member of the signal transmission cascade leading from the antigen receptor to the nucleus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Emmel, E A -- Verweij, C L -- Durand, D B -- Higgins, K M -- Lacy, E -- Crabtree, G R -- CA 39612/CA/NCI NIH HHS/ -- HL 33942/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1617-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595372" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Cell Line ; Chromosome Deletion ; Cyclosporins/*pharmacology ; Enhancer Elements, Genetic ; Gene Expression Regulation/*drug effects ; Genes/drug effects ; Humans ; Interleukin-2/genetics ; Lymphocyte Activation/*drug effects ; Molecular Sequence Data ; Mutation ; Nuclear Proteins/*antagonists & inhibitors ; Oligonucleotide Probes ; Receptors, Interleukin-2/genetics ; Repetitive Sequences, Nucleic Acid ; T-Lymphocytes/drug effects/*immunology ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 95
    facet.materialart.
    Unknown
    Modulation of calcium channels in cardiac and neuronal cells by an endogenous peptide (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: Calcium channels mediate the generation of action potentials, pacemaking, excitation-contraction coupling, and secretion and signal integration in muscle, secretory, and neuronal cells. The physiological regulation of the L-type calcium channel is thought to be mediated primarily by guanine nucleotide-binding proteins (G proteins). A low molecular weight endogenous peptide has been isolated and purified from rat brain. This peptide regulates up and down the cardiac and neuronal calcium channels, respectively. In cardiac myocytes, the peptide-induced enhancement of the L-type calcium current had a slow onset (half-time approximately 75 seconds), occurred via a G protein-independent mechanism, and could not be inhibited by alpha 1-adrenergic, beta-adrenergic, or angiotensin II blockers. In neuronal cells, on the other hand, the negative effect had a rapid onset (half-time less than 500 milliseconds) and was observed on both T-type and L-type calcium channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Callewaert, G -- Hanbauer, I -- Morad, M -- HL16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):663-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, School of Medicine, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536955" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/antagonists & inhibitors ; Animals ; Brain Chemistry ; Calcium Channels/drug effects/*physiology ; Cell Line ; Cell Membrane/metabolism ; Chromatography, High Pressure Liquid ; Electric Conductivity ; GTP-Binding Proteins/physiology ; Guinea Pigs ; Heart/*physiology ; Hippocampus/metabolism ; Mice ; Neuroblastoma ; Neurons/*physiology ; Nitrendipine/metabolism ; Peptide Fragments ; Peptides/isolation & purification/*pharmacology ; Rats ; Serine Endopeptidases/metabolism ; Sympatholytics/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 96
    facet.materialart.
    Unknown
    Postponement of satiety by blockade of brain cholecystokinin (CCK-B) receptors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Exogenous cholecystokinin (CCK) decreases food intake and causes satiety in animals and man. However, it has not been established that endogenous CCK causes satiety or whether the response is mediated by peripheral-type (CCK-A) or brain-type (CCK-B) receptors. The development of potent and selective antagonists for CCK-A (MK-329) and CCK-B (L-365,260) receptors now allows these issues to be addressed. The CCK-A antagonist MK-329 and the CCK-B antagonist L-365,260 increased food intake in partially satiated rats and postponed the onset of satiety; however, L-365,260 was 100 times more potent than MK-329 in increasing feeding and preventing satiety. These results suggest that endogenous CCK causes satiety by an agonist action on CCK-B receptors in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dourish, C T -- Rycroft, W -- Iversen, S D -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1509-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Merck Sharp & Dohme Research Laboratories, Neuroscience Research Center, Terlings Park, Harlow, Essex, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781294" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Benzodiazepines/pharmacology ; Benzodiazepinones/pharmacology ; Brain/drug effects/*physiology ; Cholecystokinin/antagonists & inhibitors/*physiology ; Devazepide ; Male ; *Phenylurea Compounds ; Rats ; Rats, Inbred Strains ; Receptors, Cholecystokinin/drug effects/*physiology ; Satiation/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 97
    facet.materialart.
    Unknown
    Spatial selectivity of rat hippocampal neurons: dependence on preparedness for movement (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-30
    Description: The mammalian hippocampal formation appears to play a major role in the generation of internal representations of spatial relationships. In rats, this role is reflected in the spatially selective discharge of hippocampal pyramidal cells. The principal metric for coding spatial relationships might be the organism's own movements in space, that is, the spatial relationship between two locations is coded in terms of the movements executed in getting from one to the other. Thus, information from the motor programming systems (or "motor set") may contribute to coding of spatial location by hippocampal neurons. Spatially selective discharge of hippocampal neurons was abolished under conditions of restraint in which the animal had learned that locomotion was impossible. Therefore, hippocampal neuronal activity may reflect the association of movements with their spatial consequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foster, T C -- Castro, C A -- McNaughton, B L -- NS20331/NS/NINDS NIH HHS/ -- T32-HD07288/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1580-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Colorado, Boulder 80303.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740902" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electroencephalography ; Electrophysiology ; Hippocampus/*physiology ; Motor Activity/*physiology ; Neurons/*physiology ; Rats ; Restraint, Physical ; Space Perception/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 98
    facet.materialart.
    Unknown
    Limbic seizures increase neuronal production of messenger RNA for nerve growth factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-18
    Description: Nerve growth factor (NGF) produced by telencephalic neurons provides critical trophic support for cholinergic neurons of the basal forebrain. In situ hybridization and nuclease protection analyses demonstrate that limbic seizures dramatically increase the amount of messenger RNA for NGF in the neurons of the hippocampal dentate gyrus within 1 hour of seizure onset and in broadly distributed neocortical and olfactory forebrain neurons some hours later. The increased messenger RNA species is indistinguishable from messenger RNA for transcript B of the beta subunit of NGF from mouse submandibular gland. Thus, the expression of a known growth factor is affected by unusual physiological activity, suggesting one route through which trophic interactions between neurons in adult brain can be modified.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gall, C M -- Isackson, P J -- NS00915/NS/NINDS NIH HHS/ -- NS24747/NS/NINDS NIH HHS/ -- NS26748/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):758-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Neurobiology, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549634" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoradiography ; Endonucleases ; Gene Expression Regulation ; Guinea Pigs ; Hippocampus/physiopathology ; Limbic System/*physiopathology ; Mice ; Nerve Growth Factors/*genetics ; Neurons/*metabolism ; Nucleic Acid Hybridization ; RNA Probes ; RNA, Messenger/*biosynthesis ; Rats ; Seizures/*metabolism ; Single-Strand Specific DNA and RNA Endonucleases ; Telencephalon/metabolism ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 99
    facet.materialart.
    Unknown
    Correction: RuGli cell line not of human origin (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gehlsen, K -- Engvall, E -- Dillner, L -- Ruoslahti, E -- Goodman, S -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):342-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526967" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Glioma ; Humans ; Isoenzymes/analysis ; Laminin/metabolism ; Rats ; Receptors, Immunologic/*analysis ; Receptors, Laminin ; *Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 100
    facet.materialart.
    Unknown
    Pretranslational suppression of an insulin-responsive glucose transporter in rats with diabetes mellitus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-07
    Description: A prominent feature of diabetes mellitus is the inability of insulin to appropriately increase the transport of glucose into target tissues. The contributions of different glucose transport proteins to insulin resistance in rats with streptozotocin-induced diabetes was evaluated. A glucose transporter messenger RNA and its cognate protein that are exclusively expressed in muscle and adipose tissue were specifically depleted in diabetic animals, and these effects were reversed after insulin therapy; a different glucose transporter and its messenger RNA that exhibit a less restricted tissue distribution were not specifically modulated in this way. Depletion of the muscle- and adipose-specific glucose transporter species correlates with and may account for the major portion of cellular insulin resistance in diabetes in these animals.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Garvey, W T -- Huecksteadt, T P -- Birnbaum, M J -- DK 38765/DK/NIDDK NIH HHS/ -- DK 39519/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):60-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section of Endocrinology and Metabolism, VA Medical Center, Indianapolis, IN.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2662408" target="_blank"〉PubMed〈/a〉
    Keywords: 3-O-Methylglucose ; Adipose Tissue/metabolism ; Animals ; Blood Glucose/metabolism ; Brain/metabolism ; Diabetes Mellitus, Experimental/drug therapy/*metabolism ; Insulin/*therapeutic use ; Male ; Methylglucosides/metabolism ; Monosaccharide Transport Proteins/*biosynthesis/genetics ; Muscles/metabolism ; Organ Specificity ; RNA, Messenger/genetics ; Rats ; Rats, Inbred Strains ; Reference Values ; *Suppression, Genetic ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...