ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 11
    facet.materialart.
    Unknown
    Comparative genomics of the eukaryotes (2000)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2000-03-24
    Description: A comparative analysis of the genomes of Drosophila melanogaster, Caenorhabditis elegans, and Saccharomyces cerevisiae-and the proteins they are predicted to encode-was undertaken in the context of cellular, developmental, and evolutionary processes. The nonredundant protein sets of flies and worms are similar in size and are only twice that of yeast, but different gene families are expanded in each genome, and the multidomain proteins and signaling pathways of the fly and worm are far more complex than those of yeast. The fly has orthologs to 177 of the 289 human disease genes examined and provides the foundation for rapid analysis of some of the basic processes involved in human disease.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2754258/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2754258/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rubin, G M -- Yandell, M D -- Wortman, J R -- Gabor Miklos, G L -- Nelson, C R -- Hariharan, I K -- Fortini, M E -- Li, P W -- Apweiler, R -- Fleischmann, W -- Cherry, J M -- Henikoff, S -- Skupski, M P -- Misra, S -- Ashburner, M -- Birney, E -- Boguski, M S -- Brody, T -- Brokstein, P -- Celniker, S E -- Chervitz, S A -- Coates, D -- Cravchik, A -- Gabrielian, A -- Galle, R F -- Gelbart, W M -- George, R A -- Goldstein, L S -- Gong, F -- Guan, P -- Harris, N L -- Hay, B A -- Hoskins, R A -- Li, J -- Li, Z -- Hynes, R O -- Jones, S J -- Kuehl, P M -- Lemaitre, B -- Littleton, J T -- Morrison, D K -- Mungall, C -- O'Farrell, P H -- Pickeral, O K -- Shue, C -- Vosshall, L B -- Zhang, J -- Zhao, Q -- Zheng, X H -- Lewis, S -- P4IHG00739/HG/NHGRI NIH HHS/ -- P50HG00750/HG/NHGRI NIH HHS/ -- R01 GM037193/GM/NIGMS NIH HHS/ -- R01 GM037193-14/GM/NIGMS NIH HHS/ -- R01 GM037193-15/GM/NIGMS NIH HHS/ -- R01 GM060988/GM/NIGMS NIH HHS/ -- R01 GM060988-01/GM/NIGMS NIH HHS/ -- R01 NS040296/NS/NINDS NIH HHS/ -- R01 NS040296-01/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 2000 Mar 24;287(5461):2204-15.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular and Cell Biology, Berkeley Drosophila Genome Project, University of California, Berkeley, CA 94720, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/10731134" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Apoptosis/genetics ; Biological Evolution ; Caenorhabditis elegans/chemistry/*genetics/physiology ; Cell Adhesion/genetics ; Cell Cycle/genetics ; Drosophila melanogaster/chemistry/*genetics/physiology ; Fungal Proteins/chemistry/genetics ; Genes, Duplicate ; Genetic Diseases, Inborn/genetics ; Genetics, Medical ; *Genome ; Helminth Proteins/chemistry/genetics ; Humans ; Immunity/genetics ; Insect Proteins/chemistry/genetics ; Multigene Family ; Neoplasms/genetics ; Protein Structure, Tertiary ; *Proteome ; Saccharomyces cerevisiae/chemistry/*genetics/physiology ; Signal Transduction/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 12
    facet.materialart.
    Unknown
    Life and death of neurons in the aging brain (1997)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1997-10-23
    Description: Neurodegenerative disorders are characterized by extensive neuron death that leads to functional decline, but the neurobiological correlates of functional decline in normal aging are less well defined. For decades, it has been a commonly held notion that widespread neuron death in the neocortex and hippocampus is an inevitable concomitant of brain aging, but recent quantitative studies suggest that neuron death is restricted in normal aging and unlikely to account for age-related impairment of neocortical and hippocampal functions. In this article, the qualitative and quantitative differences between aging and Alzheimer's disease with respect to neuron loss are discussed, and age-related changes in functional and biochemical attributes of hippocampal circuits that might mediate functional decline in the absence of neuron death are explored. When these data are viewed comprehensively, it appears that the primary neurobiological substrates for functional impairment in aging differ in important ways from those in neurodegenerative disorders such as Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, J H -- Hof, P R -- AG05138/AG/NIA NIH HHS/ -- AG06647/AG/NIA NIH HHS/ -- MHDA52145/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1997 Oct 17;278(5337):412-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurobiology of Aging Laboratories, the Fishberg Research Center for Neurobiology, and the Department of Geriatrics and Adult Development, Mount Sinai School of Medicine, New York, NY 10029, USA. morrison@cortex.neuro.mssm.edu〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/9334292" target="_blank"〉PubMed〈/a〉
    Keywords: *Aging ; Alzheimer Disease/pathology ; Animals ; Cell Death ; Cell Survival ; Entorhinal Cortex/pathology ; Estrogens/physiology ; Female ; Hippocampus/cytology/pathology/*physiology ; Humans ; Male ; Memory ; Neocortex/cytology/pathology/*physiology ; *Nerve Degeneration ; Neurofibrillary Tangles/pathology ; Neurofilament Proteins/metabolism ; Neurons/cytology/pathology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 13
    facet.materialart.
    Unknown
    Marine mammals join the Navy (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-16
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, D C -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1503-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201237" target="_blank"〉PubMed〈/a〉
    Keywords: Animal Welfare ; Animals ; *Dolphins ; *Military Science ; *Pinnipedia ; *Seals, Earless ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 14
    facet.materialart.
    Unknown
    Multiproxy evidence highlights a complex evolutionary legacy of maize in South America (2018)
    American Association for the Advancement of Science (AAAS)
    In: Science
    Details
    Publication Date: 2018-12-14
    Description: Domesticated maize evolved from wild teosinte under human influences in Mexico beginning around 9000 years before the present (yr B.P.), traversed Central America by ~7500 yr B.P., and spread into South America by ~6500 yr B.P. Landrace and archaeological maize genomes from South America suggest that the ancestral population to South American maize was brought out of the domestication center in Mexico and became isolated from the wild teosinte gene pool before traits of domesticated maize were fixed. Deeply structured lineages then evolved within South America out of this partially domesticated progenitor population. Genomic, linguistic, archaeological, and paleoecological data suggest that the southwestern Amazon was a secondary improvement center for partially domesticated maize. Multiple waves of human-mediated dispersal are responsible for the diversity and biogeography of modern South American maize.
    Keywords: Anthropology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Geosciences , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 15
    facet.materialart.
    Unknown
    Longitudinal studies of effects of divorce on children in Great Britain and the United States (1991)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1991-06-07
    Description: National, longitudinal surveys from Great Britain and the United States were used to investigate the effects of divorce on children. In both studies, a subsample of children who were in two-parent families during the initial interview (at age 7 in the British data and at ages 7 to 11 in the U.S. data) were followed through the next interview (at age 11 and ages 11 to 16, respectively). At both time points in the British data, parents and teachers independently rated the children's behavior problems, and the children were given reading and mathematics achievement tests. At both time points in the U.S. data, parents rated the children's behavior problems. Children whose parents divorced or separated between the two time points were compared to children whose families remained intact. For boys, the apparent effect of separation or divorce on behavior problems and achievement at the later time point was sharply reduced by considering behavior problems, achievement levels, and family difficulties that were present at the earlier time point, before any of the families had broken up. For girls, the reduction in the apparent effect of divorce occurred to a lesser but still noticeable extent once preexisting conditions were considered.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cherlin, A J -- Furstenberg, F F Jr -- Chase-Lansdale, L -- Kiernan, K E -- Robins, P K -- Morrison, D R -- Teitler, J O -- HD25936/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1991 Jun 7;252(5011):1386-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Sociology, Johns Hopkins University, Baltimore, MD 21218.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2047851" target="_blank"〉PubMed〈/a〉
    Keywords: Achievement ; Adolescent ; Child ; Child Behavior ; Divorce/*psychology ; England ; Female ; Humans ; Longitudinal Studies ; Male ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 16
    facet.materialart.
    Unknown
    Research on animals: unforseen benefits (1991)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1991-10-11
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, A R -- New York, N.Y. -- Science. 1991 Oct 11;254(5029):176.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1925566" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Animals, Laboratory ; Female ; Guinea Pigs ; Humans ; Neuroblastoma/diagnosis ; *Research ; Thoracic Neoplasms/diagnosis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 17
    facet.materialart.
    Unknown
    Galileo encounter with 951 gaspra: first pictures of an asteroid (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-09-18
    Description: Galileo images of Gaspra reveal it to be an irregularly shaped object (19 by 12 by 11 kilometers) that appears to have been created by a catastrophic collisional disruption of a precursor parent body. The cratering age of the surface is about 200 million years. Subtle albedo and color variations appear to correlate with morphological features: Brighter materials are associated with craters especially along the crests of ridges, have a stronger 1-micrometer absorption, and may represent freshly excavated mafic materials; darker materials exhibiting a significantly weaker 1-micrometer absorption appear concentrated in interridge areas. One explanation of these patterns is that Gaspra is covered with a thin regolith and that some of this material has migrated downslope in some areas.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Belton, M J -- Veverka, J -- Thomas, P -- Helfenstein, P -- Simonelli, D -- Chapman, C -- Davies, M E -- Greeley, R -- Greenberg, R -- Head, J -- Murchie, S -- Klaasen, K -- Johnson, T V -- McEwen, A -- Morrison, D -- Neukum, G -- Fanale, F -- Anger, C -- Carr, M -- Pilcher, C -- New York, N.Y. -- Science. 1992 Sep 18;257(5077):1647-52.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17841160" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 18
    facet.materialart.
    Unknown
    Cloning of a delta opioid receptor by functional expression (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-12-28
    Description: Opiate drugs have potent analgesic and addictive properties. These drugs interact with receptors that also mediate the response to endogenous opioid peptide ligands. However, the receptors for opioids have eluded definitive molecular characterization. By transient expression in COS cells and screening with an iodinated analog of the opioid peptide enkephalin, a complementary DNA clone encoding a functional delta opioid receptor has been identified. The sequence shows homology to G protein-coupled receptors, in particular the receptors for somatostatin, angiotensin, and interleukin-8.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Evans, C J -- Keith, D E Jr -- Morrison, H -- Magendzo, K -- Edwards, R H -- DA05010/DA/NIDA NIH HHS/ -- P50 DA005010/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 1992 Dec 18;258(5090):1952-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, University of California, School of Medicine, Los Angeles 90024-1759.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1335167" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding, Competitive ; Blotting, Northern ; Blotting, Southern ; Cell Line ; Cyclic AMP/metabolism ; Diprenorphine/metabolism ; Enkephalin, D-Penicillamine (2,5)- ; Enkephalins/pharmacology ; Etorphine/pharmacology ; Gene Expression ; Humans ; Kinetics ; Models, Structural ; Molecular Sequence Data ; Naloxone/pharmacology ; Narcotics/pharmacology ; Protein Structure, Secondary ; Receptors, Opioid, delta/chemistry/*genetics/*metabolism ; Sequence Homology, Amino Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 19
    facet.materialart.
    Unknown
    Airline deregulation and public policy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-18
    Description: An assessment of the effects of airline deregulation on travelers and carriers indicates that deregulation has provided travelers and carriers with $14.9 billion of annual benefits (1988 dollars). Airport congestion, airline safety, airline bankruptcy, and mergers are also analyzed and found in most cases to have reduced benefits. But, these costs should not be attributed to deregulation per se, but to failures by the government to pursue appropriate policies in these areas. Pursuit of policies that promote airline competition and efficient use of airport capacity would significantly increase the benefits from deregulation and would provide valuable guidance for other industries undergoing the transition to deregulation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, S A -- Winston, C -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):707-11.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17791709" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 20
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...