ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Animals  (30)
  • American Association for the Advancement of Science (AAAS)  (30)
  • 1
    facet.materialart.
    Unknown
    Badgers and bovine TB: conflicts between conservation and health (1998)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1998-02-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Krebs, J R -- Anderson, R M -- Clutton-Brock, T -- Donnelly, C A -- Frost, S -- Morrison, W I -- Woodroffe, R -- Young, D -- New York, N.Y. -- Science. 1998 Feb 6;279(5352):817-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Natural Environment Research Council, Swindon, Wilts, SN2 1EU, UK. hqpo@wpo.nerc.ac.uk〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/9480550" target="_blank"〉PubMed〈/a〉
    Keywords: Animal Husbandry ; Animals ; Carnivora/*microbiology ; Cattle ; Disease Reservoirs/*veterinary ; Great Britain/epidemiology ; Incidence ; *Pest Control ; Research ; Tuberculosis/transmission/*veterinary ; Tuberculosis, Bovine/epidemiology/*prevention & control/*transmission
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Development. p73--guilt by association? (2000)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2000-08-05
    Description: It has been assumed that the new members of the p53 protein family, p63 and p73, would have the same job as p53, namely, forcing cells to die if they or their DNA is damaged. Now, as Morrison and Kinoshita explain in their Perspective, one particular form of p73 has been found to be a survival factor rather than a death factor for sympathetic neurons during development (Pozniak et al.).〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, R S -- Kinoshita, Y -- New York, N.Y. -- Science. 2000 Jul 14;289(5477):257-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington School of Medicine, Box 356470, Seattle, WA 98195-6470, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/10917851" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Apoptosis ; DNA-Binding Proteins/genetics/*physiology ; Genes, Tumor Suppressor ; Mice ; Neurons/*physiology ; Nuclear Proteins/genetics/*physiology ; Sympathetic Nervous System/cytology/*growth & development/physiology ; Tumor Suppressor Protein p53/genetics/physiology ; Tumor Suppressor Proteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Comparative genomics of the eukaryotes (2000)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2000-03-24
    Description: A comparative analysis of the genomes of Drosophila melanogaster, Caenorhabditis elegans, and Saccharomyces cerevisiae-and the proteins they are predicted to encode-was undertaken in the context of cellular, developmental, and evolutionary processes. The nonredundant protein sets of flies and worms are similar in size and are only twice that of yeast, but different gene families are expanded in each genome, and the multidomain proteins and signaling pathways of the fly and worm are far more complex than those of yeast. The fly has orthologs to 177 of the 289 human disease genes examined and provides the foundation for rapid analysis of some of the basic processes involved in human disease.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2754258/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2754258/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rubin, G M -- Yandell, M D -- Wortman, J R -- Gabor Miklos, G L -- Nelson, C R -- Hariharan, I K -- Fortini, M E -- Li, P W -- Apweiler, R -- Fleischmann, W -- Cherry, J M -- Henikoff, S -- Skupski, M P -- Misra, S -- Ashburner, M -- Birney, E -- Boguski, M S -- Brody, T -- Brokstein, P -- Celniker, S E -- Chervitz, S A -- Coates, D -- Cravchik, A -- Gabrielian, A -- Galle, R F -- Gelbart, W M -- George, R A -- Goldstein, L S -- Gong, F -- Guan, P -- Harris, N L -- Hay, B A -- Hoskins, R A -- Li, J -- Li, Z -- Hynes, R O -- Jones, S J -- Kuehl, P M -- Lemaitre, B -- Littleton, J T -- Morrison, D K -- Mungall, C -- O'Farrell, P H -- Pickeral, O K -- Shue, C -- Vosshall, L B -- Zhang, J -- Zhao, Q -- Zheng, X H -- Lewis, S -- P4IHG00739/HG/NHGRI NIH HHS/ -- P50HG00750/HG/NHGRI NIH HHS/ -- R01 GM037193/GM/NIGMS NIH HHS/ -- R01 GM037193-14/GM/NIGMS NIH HHS/ -- R01 GM037193-15/GM/NIGMS NIH HHS/ -- R01 GM060988/GM/NIGMS NIH HHS/ -- R01 GM060988-01/GM/NIGMS NIH HHS/ -- R01 NS040296/NS/NINDS NIH HHS/ -- R01 NS040296-01/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 2000 Mar 24;287(5461):2204-15.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular and Cell Biology, Berkeley Drosophila Genome Project, University of California, Berkeley, CA 94720, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/10731134" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Apoptosis/genetics ; Biological Evolution ; Caenorhabditis elegans/chemistry/*genetics/physiology ; Cell Adhesion/genetics ; Cell Cycle/genetics ; Drosophila melanogaster/chemistry/*genetics/physiology ; Fungal Proteins/chemistry/genetics ; Genes, Duplicate ; Genetic Diseases, Inborn/genetics ; Genetics, Medical ; *Genome ; Helminth Proteins/chemistry/genetics ; Humans ; Immunity/genetics ; Insect Proteins/chemistry/genetics ; Multigene Family ; Neoplasms/genetics ; Protein Structure, Tertiary ; *Proteome ; Saccharomyces cerevisiae/chemistry/*genetics/physiology ; Signal Transduction/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Life and death of neurons in the aging brain (1997)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1997-10-23
    Description: Neurodegenerative disorders are characterized by extensive neuron death that leads to functional decline, but the neurobiological correlates of functional decline in normal aging are less well defined. For decades, it has been a commonly held notion that widespread neuron death in the neocortex and hippocampus is an inevitable concomitant of brain aging, but recent quantitative studies suggest that neuron death is restricted in normal aging and unlikely to account for age-related impairment of neocortical and hippocampal functions. In this article, the qualitative and quantitative differences between aging and Alzheimer's disease with respect to neuron loss are discussed, and age-related changes in functional and biochemical attributes of hippocampal circuits that might mediate functional decline in the absence of neuron death are explored. When these data are viewed comprehensively, it appears that the primary neurobiological substrates for functional impairment in aging differ in important ways from those in neurodegenerative disorders such as Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, J H -- Hof, P R -- AG05138/AG/NIA NIH HHS/ -- AG06647/AG/NIA NIH HHS/ -- MHDA52145/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1997 Oct 17;278(5337):412-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurobiology of Aging Laboratories, the Fishberg Research Center for Neurobiology, and the Department of Geriatrics and Adult Development, Mount Sinai School of Medicine, New York, NY 10029, USA. morrison@cortex.neuro.mssm.edu〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/9334292" target="_blank"〉PubMed〈/a〉
    Keywords: *Aging ; Alzheimer Disease/pathology ; Animals ; Cell Death ; Cell Survival ; Entorhinal Cortex/pathology ; Estrogens/physiology ; Female ; Hippocampus/cytology/pathology/*physiology ; Humans ; Male ; Memory ; Neocortex/cytology/pathology/*physiology ; *Nerve Degeneration ; Neurofibrillary Tangles/pathology ; Neurofilament Proteins/metabolism ; Neurons/cytology/pathology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Marine mammals join the Navy (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-16
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, D C -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1503-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201237" target="_blank"〉PubMed〈/a〉
    Keywords: Animal Welfare ; Animals ; *Dolphins ; *Military Science ; *Pinnipedia ; *Seals, Earless ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Research on animals: unforseen benefits (1991)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1991-10-11
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, A R -- New York, N.Y. -- Science. 1991 Oct 11;254(5029):176.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1925566" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Animals, Laboratory ; Female ; Guinea Pigs ; Humans ; Neuroblastoma/diagnosis ; *Research ; Thoracic Neoplasms/diagnosis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    Cloning of a delta opioid receptor by functional expression (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-12-28
    Description: Opiate drugs have potent analgesic and addictive properties. These drugs interact with receptors that also mediate the response to endogenous opioid peptide ligands. However, the receptors for opioids have eluded definitive molecular characterization. By transient expression in COS cells and screening with an iodinated analog of the opioid peptide enkephalin, a complementary DNA clone encoding a functional delta opioid receptor has been identified. The sequence shows homology to G protein-coupled receptors, in particular the receptors for somatostatin, angiotensin, and interleukin-8.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Evans, C J -- Keith, D E Jr -- Morrison, H -- Magendzo, K -- Edwards, R H -- DA05010/DA/NIDA NIH HHS/ -- P50 DA005010/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 1992 Dec 18;258(5090):1952-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, University of California, School of Medicine, Los Angeles 90024-1759.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1335167" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding, Competitive ; Blotting, Northern ; Blotting, Southern ; Cell Line ; Cyclic AMP/metabolism ; Diprenorphine/metabolism ; Enkephalin, D-Penicillamine (2,5)- ; Enkephalins/pharmacology ; Etorphine/pharmacology ; Gene Expression ; Humans ; Kinetics ; Models, Structural ; Molecular Sequence Data ; Naloxone/pharmacology ; Narcotics/pharmacology ; Protein Structure, Secondary ; Receptors, Opioid, delta/chemistry/*genetics/*metabolism ; Sequence Homology, Amino Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    Human-specific gain of function in a developmental enhancer (2008)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2008-09-06
    Description: Changes in gene regulation are thought to have contributed to the evolution of human development. However, in vivo evidence for uniquely human developmental regulatory function has remained elusive. In transgenic mice, a conserved noncoding sequence (HACNS1) that evolved extremely rapidly in humans acted as an enhancer of gene expression that has gained a strong limb expression domain relative to the orthologous elements from chimpanzee and rhesus macaque. This gain of function was consistent across two developmental stages in the mouse and included the presumptive anterior wrist and proximal thumb. In vivo analyses with synthetic enhancers, in which human-specific substitutions were introduced into the chimpanzee enhancer sequence or reverted in the human enhancer to the ancestral state, indicated that 13 substitutions clustered in an 81-base pair module otherwise highly constrained among terrestrial vertebrates were sufficient to confer the human-specific limb expression domain.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2658639/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2658639/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Prabhakar, Shyam -- Visel, Axel -- Akiyama, Jennifer A -- Shoukry, Malak -- Lewis, Keith D -- Holt, Amy -- Plajzer-Frick, Ingrid -- Morrison, Harris -- Fitzpatrick, David R -- Afzal, Veena -- Pennacchio, Len A -- Rubin, Edward M -- Noonan, James P -- 1-F32-GM074367/GM/NIGMS NIH HHS/ -- F32 GM074367/GM/NIGMS NIH HHS/ -- F32 GM074367-02/GM/NIGMS NIH HHS/ -- HG003988/HG/NHGRI NIH HHS/ -- HL066681/HL/NHLBI NIH HHS/ -- MC_U127561093/Medical Research Council/United Kingdom -- New York, N.Y. -- Science. 2008 Sep 5;321(5894):1346-50. doi: 10.1126/science.1159974.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genomics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/18772437" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Body Patterning/*genetics ; Conserved Sequence ; Embryonic Development ; *Enhancer Elements, Genetic ; Evolution, Molecular ; Extremities/*embryology ; Gene Expression Profiling ; *Gene Expression Regulation, Developmental ; Humans ; Limb Buds/embryology/metabolism ; Macaca mulatta/genetics ; Mice ; Mice, Transgenic ; Molecular Sequence Data ; Mutation ; PAX9 Transcription Factor/metabolism ; Pan troglodytes/genetics ; Selection, Genetic ; Transcription Factors/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    Endocannabinoid hydrolysis generates brain prostaglandins that promote neuroinflammation (2011)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2011-10-25
    Description: Phospholipase A(2)(PLA(2)) enzymes are considered the primary source of arachidonic acid for cyclooxygenase (COX)-mediated biosynthesis of prostaglandins. Here, we show that a distinct pathway exists in brain, where monoacylglycerol lipase (MAGL) hydrolyzes the endocannabinoid 2-arachidonoylglycerol to generate a major arachidonate precursor pool for neuroinflammatory prostaglandins. MAGL-disrupted animals show neuroprotection in a parkinsonian mouse model. These animals are spared the hemorrhaging caused by COX inhibitors in the gut, where prostaglandins are instead regulated by cytosolic PLA(2). These findings identify MAGL as a distinct metabolic node that couples endocannabinoid to prostaglandin signaling networks in the nervous system and suggest that inhibition of this enzyme may be a new and potentially safer way to suppress the proinflammatory cascades that underlie neurodegenerative disorders.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3249428/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3249428/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nomura, Daniel K -- Morrison, Bradley E -- Blankman, Jacqueline L -- Long, Jonathan Z -- Kinsey, Steven G -- Marcondes, Maria Cecilia G -- Ward, Anna M -- Hahn, Yun Kyung -- Lichtman, Aron H -- Conti, Bruno -- Cravatt, Benjamin F -- 5P01DA009789/DA/NIDA NIH HHS/ -- AG028040/AG/NIA NIH HHS/ -- DA017259/DA/NIDA NIH HHS/ -- DA026261/DA/NIDA NIH HHS/ -- F31 DA026261-03/DA/NIDA NIH HHS/ -- K99 DA030908/DA/NIDA NIH HHS/ -- K99 DA030908-01/DA/NIDA NIH HHS/ -- K99DA030908/DA/NIDA NIH HHS/ -- P01 DA009789/DA/NIDA NIH HHS/ -- P01 DA009789-14/DA/NIDA NIH HHS/ -- P01 DA017259/DA/NIDA NIH HHS/ -- P01 DA017259-08/DA/NIDA NIH HHS/ -- P01DA01725/DA/NIDA NIH HHS/ -- R00 DA030908/DA/NIDA NIH HHS/ -- R00 DA030908-02/DA/NIDA NIH HHS/ -- R00DA030908/DA/NIDA NIH HHS/ -- R01 AG028040/AG/NIA NIH HHS/ -- R01 AG028040-04/AG/NIA NIH HHS/ -- R03 DA027936/DA/NIDA NIH HHS/ -- R03 DA027936-02/DA/NIDA NIH HHS/ -- R03DA027936/DA/NIDA NIH HHS/ -- T32 DA007027/DA/NIDA NIH HHS/ -- T32 DA007027-33/DA/NIDA NIH HHS/ -- T32DA007027/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 2011 Nov 11;334(6057):809-13. doi: 10.1126/science.1209200. Epub 2011 Oct 20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉The Skaggs Institute for Chemical Biology and Department of Chemical Physiology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA. dnomura@berkeley.edu〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/22021672" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid/metabolism ; Arachidonic Acids/*metabolism ; Benzodioxoles/pharmacology ; Brain/drug effects/*metabolism/pathology ; Cannabinoid Receptor Modulators/*metabolism ; Cyclooxygenase 1/metabolism ; Cytokines/metabolism ; Eicosanoids/metabolism ; *Endocannabinoids ; Enzyme Inhibitors/pharmacology ; Glycerides/*metabolism ; Hydrolysis ; Inflammation/*metabolism/pathology ; Inflammation Mediators/pharmacology ; Lipopolysaccharides/pharmacology ; Liver/metabolism ; Lung/metabolism ; Metabolomics ; Mice ; Mice, Inbred C57BL ; Monoacylglycerol Lipases/antagonists & inhibitors/genetics/*metabolism ; Neuroprotective Agents/pharmacology ; Parkinsonian Disorders/metabolism/pathology ; Phospholipases A2/genetics/metabolism ; Piperidines/pharmacology ; Prostaglandins/biosynthesis/*metabolism ; Signal Transduction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...