ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Base Sequence  (3)
  • American Association for the Advancement of Science (AAAS)  (3)
Collection
Publisher
  • American Association for the Advancement of Science (AAAS)  (3)
Years
  • 1
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    Publication Date: 2008-09-06
    Description: Changes in gene regulation are thought to have contributed to the evolution of human development. However, in vivo evidence for uniquely human developmental regulatory function has remained elusive. In transgenic mice, a conserved noncoding sequence (HACNS1) that evolved extremely rapidly in humans acted as an enhancer of gene expression that has gained a strong limb expression domain relative to the orthologous elements from chimpanzee and rhesus macaque. This gain of function was consistent across two developmental stages in the mouse and included the presumptive anterior wrist and proximal thumb. In vivo analyses with synthetic enhancers, in which human-specific substitutions were introduced into the chimpanzee enhancer sequence or reverted in the human enhancer to the ancestral state, indicated that 13 substitutions clustered in an 81-base pair module otherwise highly constrained among terrestrial vertebrates were sufficient to confer the human-specific limb expression domain.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2658639/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2658639/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Prabhakar, Shyam -- Visel, Axel -- Akiyama, Jennifer A -- Shoukry, Malak -- Lewis, Keith D -- Holt, Amy -- Plajzer-Frick, Ingrid -- Morrison, Harris -- Fitzpatrick, David R -- Afzal, Veena -- Pennacchio, Len A -- Rubin, Edward M -- Noonan, James P -- 1-F32-GM074367/GM/NIGMS NIH HHS/ -- F32 GM074367/GM/NIGMS NIH HHS/ -- F32 GM074367-02/GM/NIGMS NIH HHS/ -- HG003988/HG/NHGRI NIH HHS/ -- HL066681/HL/NHLBI NIH HHS/ -- MC_U127561093/Medical Research Council/United Kingdom -- New York, N.Y. -- Science. 2008 Sep 5;321(5894):1346-50. doi: 10.1126/science.1159974.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genomics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/18772437" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Body Patterning/*genetics ; Conserved Sequence ; Embryonic Development ; *Enhancer Elements, Genetic ; Evolution, Molecular ; Extremities/*embryology ; Gene Expression Profiling ; *Gene Expression Regulation, Developmental ; Humans ; Limb Buds/embryology/metabolism ; Macaca mulatta/genetics ; Mice ; Mice, Transgenic ; Molecular Sequence Data ; Mutation ; PAX9 Transcription Factor/metabolism ; Pan troglodytes/genetics ; Selection, Genetic ; Transcription Factors/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    Publication Date: 2009-01-10
    Description: Strict one-to-one correspondence between codons and amino acids is thought to be an essential feature of the genetic code. However, we report that one codon can code for two different amino acids with the choice of the inserted amino acid determined by a specific 3' untranslated region structure and location of the dual-function codon within the messenger RNA (mRNA). We found that the codon UGA specifies insertion of selenocysteine and cysteine in the ciliate Euplotes crassus, that the dual use of this codon can occur even within the same gene, and that the structural arrangements of Euplotes mRNA preserve location-dependent dual function of UGA when expressed in mammalian cells. Thus, the genetic code supports the use of one codon to code for multiple amino acids.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3088105/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3088105/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turanov, Anton A -- Lobanov, Alexey V -- Fomenko, Dmitri E -- Morrison, Hilary G -- Sogin, Mitchell L -- Klobutcher, Lawrence A -- Hatfield, Dolph L -- Gladyshev, Vadim N -- AI058054/AI/NIAID NIH HHS/ -- GM061603/GM/NIGMS NIH HHS/ -- GM065204/GM/NIGMS NIH HHS/ -- R01 GM061603/GM/NIGMS NIH HHS/ -- R01 GM061603-04S2/GM/NIGMS NIH HHS/ -- ZIA BC010767-03/Intramural NIH HHS/ -- New York, N.Y. -- Science. 2009 Jan 9;323(5911):259-61. doi: 10.1126/science.1164748.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Redox Biology Center, University of Nebraska, Lincoln, NE 68588, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/19131629" target="_blank"〉PubMed〈/a〉
    Keywords: 3' Untranslated Regions ; Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Codon/*genetics ; Codon, Terminator/*genetics ; Cysteine/*genetics/metabolism ; Euplotes/chemistry/*genetics ; *Genetic Code ; Humans ; Molecular Sequence Data ; Mutation ; Protozoan Proteins/biosynthesis/chemistry/genetics ; RNA, Protozoan/genetics/metabolism ; RNA, Transfer, Amino Acid-Specific/chemistry/genetics ; RNA, Transfer, Cys/chemistry/genetics ; Recombinant Fusion Proteins/metabolism ; Selenocysteine/*genetics/metabolism ; Selenoproteins/biosynthesis/chemistry/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...