ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-12-16
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, D C -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1503-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201237" target="_blank"〉PubMed〈/a〉
    Keywords: Animal Welfare ; Animals ; *Dolphins ; *Military Science ; *Pinnipedia ; *Seals, Earless ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-18
    Description: An assessment of the effects of airline deregulation on travelers and carriers indicates that deregulation has provided travelers and carriers with $14.9 billion of annual benefits (1988 dollars). Airport congestion, airline safety, airline bankruptcy, and mergers are also analyzed and found in most cases to have reduced benefits. But, these costs should not be attributed to deregulation per se, but to failures by the government to pursue appropriate policies in these areas. Pursuit of policies that promote airline competition and efficient use of airport capacity would significantly increase the benefits from deregulation and would provide valuable guidance for other industries undergoing the transition to deregulation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, S A -- Winston, C -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):707-11.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17791709" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, D C -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):447-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17788687" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    Publication Date: 1989-12-15
    Description: Voyager 2 images of Neptune reveal a windy planet characterized by bright clouds of methane ice suspended in an exceptionally clear atmosphere above a lower deck of hydrogen sulfide or ammonia ices. Neptune's atmosphere is dominated by a large anticyclonic storm system that has been named the Great Dark Spot (GDS). About the same size as Earth in extent, the GDS bears both many similarities and some differences to the Great Red Spot of Jupiter. Neptune's zonal wind profile is remarkably similar to that of Uranus. Neptune has three major rings at radii of 42,000, 53,000, and 63,000 kilometers. The outer ring contains three higher density arc-like segments that were apparently responsible for most of the ground-based occultation events observed during the current decade. Like the rings of Uranus, the Neptune rings are composed of very dark material; unlike that of Uranus, the Neptune system is very dusty. Six new regular satellites were found, with dark surfaces and radii ranging from 200 to 25 kilometers. All lie inside the orbit of Triton and the inner four are located within the ring system. Triton is seen to be a differentiated body, with a radius of 1350 kilometers and a density of 2.1 grams per cubic centimeter; it exhibits clear evidence of early episodes of surface melting. A now rigid crust of what is probably water ice is overlain with a brilliant coating of nitrogen frost, slightly darkened and reddened with organic polymer material. Streaks of organic polymer suggest seasonal winds strong enough to move particles of micrometer size or larger, once they become airborne. At least two active plumes were seen, carrying dark material 8 kilometers above the surface before being transported downstream by high level winds. The plumes may be driven by solar heating and the subsequent violent vaporization of subsurface nitrogen.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Smith, B A -- Soderblom, L A -- Banfield, D -- Barnet, C -- Basilevsky, A T -- Beebe, R F -- Bollinger, K -- Boyce, J M -- Brahic, A -- Briggs, G A -- Brown, R H -- Chyba, C -- Collins, S A -- Colvin, T -- Cook, A F 2nd -- Crisp, D -- Croft, S K -- Cruikshank, D -- Cuzzi, J N -- Danielson, G E -- Davies, M E -- De Jong, E -- Dones, L -- Godfrey, D -- Goguen, J -- Grenier, I -- Haemmerle, V R -- Hammel, H -- Hansen, C J -- Helfenstein, C P -- Howell, C -- Hunt, G E -- Ingersoll, A P -- Johnson, T V -- Kargel, J -- Kirk, R -- Kuehn, D I -- Limaye, S -- Masursky, H -- McEwen, A -- Morrison, D -- Owen, T -- Owen, W -- Pollack, J B -- Porco, C C -- Rages, K -- Rogers, P -- Rudy, D -- Sagan, C -- Schwartz, J -- Shoemaker, E M -- Showalter, M -- Sicardy, B -- Simonelli, D -- Spencer, J -- Sromovsky, L A -- Stoker, C -- Strom, R G -- Suomi, V E -- Synott, S P -- Terrile, R J -- Thomas, P -- Thompson, W R -- Verbiscer, A -- Veverka, J -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1422-49.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17755997" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    Publication Date: 1989-10-20
    Description: Novel materials have been obtained by restacking single-layer molybdenum disulfide (MoS(2)) with organic molecules included between the layers. A large variety of organic molecules can be included between layers of MoS(2) and other transition-metal dichalcogenides. The films with the included organics are formed at the interface between an aqueous suspension of the MoS(2) and a water-immiscible organic liquid. The organic molecules are not necessarily electron donors. A highly oriented, conducting film of restacked MoS(2) containing ferrocene is presented as an example.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Divigalpitiya, W M -- Frindt, R F -- Morrison, S R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):369-71.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17747918" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-02-12
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, S L -- New York, N.Y. -- Science. 1988 Feb 12;239(4841 Pt 2):G28, G48.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Columbia University College of Physicians and Surgeons, New York, New York 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3277278" target="_blank"〉PubMed〈/a〉
    Keywords: *Antibodies, Monoclonal ; Forecasting ; Genetic Engineering
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    Publication Date: 1988-05-20
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, D C -- New York, N.Y. -- Science. 1988 May 20;240(4855):973-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17731701" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    Publication Date: 1986-07-04
    Description: Voyager 2 images of the southern hemisphere of Uranus indicate that submicrometersize haze particles and particles of a methane condensation cloud produce faint patterns in the atmosphere. The alignment of the cloud bands is similar to that of bands on Jupiter and Saturn, but the zonal winds are nearly opposite. At mid-latitudes (-70 degrees to -27 degrees ), where winds were measured, the atmosphere rotates faster than the magnetic field; however, the rotation rate of the atmosphere decreases toward the equator, so that the two probably corotate at about -20 degrees . Voyager images confirm the extremely low albedo of the ring particles. High phase angle images reveal on the order of 10(2) new ringlike features of very low optical depth and relatively high dust abundance interspersed within the main rings, as well as a broad, diffuse, low optical depth ring just inside the main rings system. Nine of the newly discovered small satellites (40 to 165 kilometers in diameter) orbit between the rings and Miranda; the tenth is within the ring system. Two of these small objects may gravitationally confine the e ring. Oberon and Umbriel have heavily cratered surfaces resembling the ancient cratered highlands of Earth's moon, although Umbriel is almost completely covered with uniform dark material, which perhaps indicates some ongoing process. Titania and Ariel show crater populations different from those on Oberon and Umbriel; these were probably generated by collisions with debris confined to their orbits. Titania and Ariel also show many extensional fault systems; Ariel shows strong evidence for the presence of extrusive material. About halfof Miranda's surface is relatively bland, old, cratered terrain. The remainder comprises three large regions of younger terrain, each rectangular to ovoid in plan, that display complex sets of parallel and intersecting scarps and ridges as well as numerous outcrops of bright and dark materials, perhaps suggesting some exotic composition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Smith, B A -- Soderblom, L A -- Beebe, R -- Bliss, D -- Boyce, J M -- Brahic, A -- Briggs, G A -- Brown, R H -- Collins, S A -- Cook, A F 2nd -- Croft, S K -- Cuzzi, J N -- Danielson, G E -- Davies, M E -- Dowling, T E -- Godfrey, D -- Hansen, C J -- Harris, C -- Hunt, G E -- Ingersoll, A P -- Johnson, T V -- Krauss, R J -- Masursky, H -- Morrison, D -- Owen, T -- Plescia, J B -- Pollack, J B -- Porco, C C -- Rages, K -- Sagan, C -- Shoemaker, E M -- Sromovsky, L A -- Stoker, C -- Strom, R G -- Suomi, V E -- Synnott, S P -- Terrile, R J -- Thomas, P -- Thompson, W R -- Veverka, J -- New York, N.Y. -- Science. 1986 Jul 4;233(4759):43-64.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17812889" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1987-10-30
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, D -- New York, N.Y. -- Science. 1987 Oct 30;238(4827):598.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17816537" target="_blank"〉PubMed〈/a〉
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...