ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (6)
  • American Association for the Advancement of Science (AAAS)  (6)
  • 1
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Hirschsprung disease is linked to defects in neural crest stem cell function (2003)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2003-08-16
    Description: Genes associated with Hirschsprung disease, a failure to form enteric ganglia in the hindgut, were highly up-regulated in gut neural crest stem cells relative to whole-fetus RNA. One of these genes, the glial cell line-derived neurotrophic factor (GDNF) receptor Ret, was necessary for neural crest stem cell migration in the gut. GDNF promoted the migration of neural crest stem cells in culture but did not affect their survival or proliferation. Gene expression profiling, combined with reverse genetics and analyses of stem cell function, suggests that Hirschsprung disease is caused by defects in neural crest stem cell function.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2614078/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2614078/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Iwashita, Toshihide -- Kruger, Genevieve M -- Pardal, Ricardo -- Kiel, Mark J -- Morrison, Sean J -- CA46592/CA/NCI NIH HHS/ -- DK58771/DK/NIDDK NIH HHS/ -- NIH5P60-DK20572/DK/NIDDK NIH HHS/ -- P30 AR48310/AR/NIAMS NIH HHS/ -- P60-AR20557/AR/NIAMS NIH HHS/ -- R01 NS040750/NS/NINDS NIH HHS/ -- R01 NS040750-01/NS/NINDS NIH HHS/ -- R01 NS40750-01/NS/NINDS NIH HHS/ -- R21 HD40760-02/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 2003 Aug 15;301(5635):972-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute and Department of Internal Medicine, University of Michigan, Ann Arbor, MI 48109-0934, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/12920301" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Differentiation ; Cell Division ; Cell Movement ; Cell Separation ; Cell Survival ; Cells, Cultured ; Digestive System/cytology/*embryology/innervation/metabolism ; Fetus/metabolism ; Gene Expression Profiling ; *Gene Expression Regulation, Developmental ; Glial Cell Line-Derived Neurotrophic Factor ; Glial Cell Line-Derived Neurotrophic Factor Receptors ; Hirschsprung Disease/*etiology/genetics ; Mice ; Multipotent Stem Cells/*physiology ; Nerve Growth Factors/genetics/metabolism/pharmacology ; Neural Crest/*cytology/physiology ; Oligonucleotide Array Sequence Analysis ; Proto-Oncogene Proteins/*genetics/metabolism ; Proto-Oncogene Proteins c-ret ; Rats ; Rats, Sprague-Dawley ; Receptor Protein-Tyrosine Kinases/*genetics/metabolism ; Reverse Transcriptase Polymerase Chain Reaction ; Signal Transduction ; Up-Regulation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Epidermal growth factor immunoreactive material in the central nervous system: location and development (1984)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1984-06-08
    Description: Epidermal growth factor (EGF) is a potent mitogen with hormonal activity in the gastrointestinal tract. Material cross-reacting with EGF was detected in the central nervous system of the developing and adult albino rat by the indirect immunofluorescence technique. High concentrations of EGF-cross-reacting material were identified in forebrain and midbrain structures of pallidal areas of the brain. These include the globus pallidus, ventral pallidum, entopeduncular nucleus, substantia nigra pars reticulata, and the islands of Calleja . Thus, EGF may represent another gut-brain peptide with potential neurotransmitter-neuromodulator functions in pallidal structures of the extrapyramidal motor systems of the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fallon, J H -- Seroogy, K B -- Loughlin, S E -- Morrison, R S -- Bradshaw, R A -- Knaver, D J -- Cunningham, D D -- GM31609/GM/NIGMS NIH HHS/ -- NS16017/NS/NINDS NIH HHS/ -- NS19964/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1984 Jun 8;224(4653):1107-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6144184" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/growth & development/*physiology ; Epidermal Growth Factor/*physiology ; Fluorescent Antibody Technique ; Globus Pallidus/physiology ; Mitogens/physiology ; Neurotransmitter Agents/physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Noradrenergic innervation of cerebral cortex: widespread effects of local cortical lesions (1979)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1979-07-20
    Description: The trajectory of the intracortical noradrenergic fibers has been characterized by histochemical analysis following the production of cortical lesions in the rate. A large group of noradrenergic fibers enters the cortex at the frontal pole and proceeds caudally through the deep layers of dorsolateral cortex. Branches arise from these longitudinally directed fibers and form a uniform pattern of innervation throughout lateral cortex. Because these fibers travel long distances rostrocaudally within the gray matter, a large area of cortex can be deprived of noradrenergic innervation by a relatively small lesion of frontal cortex. The medial and lateral cortex can be selectively and differentially denervated of noradrenergic fibers, and there is a medial to lateral topographic relationship between deep longitudinally running fibers and overlying cortex.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, J H -- Molliver, M E -- Grzanna, R -- New York, N.Y. -- Science. 1979 Jul 20;205(4403):313-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/451605" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/*physiology ; Gyrus Cinguli/physiology ; Nerve Fibers/*ultrastructure ; Norepinephrine/*physiology ; Pia Mater/physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Trophic stimulation of cultured neurons from neonatal rat brain by epidermal growth factor (1987)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1987-10-02
    Description: Epidermal growth factor (EGF) is a potent polypeptide mitogen originally isolated from the adult male mouse submaxillary gland. It also acts as a gastrointestinal hormone. EGF-immunoreactive material has recently been identified within neuronal fibers and terminals in rodent brain. In the present study, EGF was found to enhance survival and process outgrowth of primary cultures of subneocortical telencephalic neurons of neonatal rat brain in a dose-dependent manner. This effect was observed with EGF concentrations as low as 100 picograms per milliliter (0.016 nanomolar) and was dependent on the continuous presence of EGF in the medium. Similar effects were observed with basic fibroblast growth factor, but several other growth-promoting substances, including other mitogens for glial elements, were without effect. Thus EGF, in addition to its mitogenic and hormonal activities, may act as a neurite elongation and maintenance factor for select neurons of the rodent central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, R S -- Kornblum, H I -- Leslie, F M -- Bradshaw, R A -- NS19319/NS/NINDS NIH HHS/ -- NS19964/NS/NINDS NIH HHS/ -- T32-CA0905A/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1987 Oct 2;238(4823):72-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Chemistry, College of Medicine, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3498986" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Brain/*cytology ; Cell Survival/drug effects ; Cells, Cultured ; Epidermal Growth Factor/*physiology ; Growth Substances/pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Imaging elemental distribution and ion transport in cultured cells with ion microscopy (1985)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1985-06-28
    Description: Both elemental distribution and ion transport in cultured cells have been imaged by ion microscopy. Morphological and chemical information was obtained with a spatial resolution of approximately 0.5 micron for sodium, potassium, calcium, and magnesium in freeze-fixed, cryofractured, and freeze-dried normal rat kidney cells and Chinese hamster ovary cells. Ion transport was successfully demonstrated by imaging Na+-K+ fluxes after the inhibition of Na+- and K+ -dependent adenosine triphosphatase with ouabain. This method allows measurements of elemental (isotopic) distribution to be related to cell morphology, thereby providing the means for studying ion distribution and ion transport under different physiological, pathological, and toxicological conditions in cell culture systems.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chandra, S -- Morrison, G H -- R01GM24314/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1985 Jun 28;228(4707):1543-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2990033" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcium/analysis ; Cell Line ; Cells, Cultured ; Cricetinae ; Elements/*analysis ; Female ; Freeze Fracturing ; Kidney/*ultrastructure ; Magnesium/analysis ; Microscopy/methods ; Ouabain/pharmacology ; Ovary/*ultrastructure ; Potassium/analysis ; Rats ; Sodium/analysis ; Sodium-Potassium-Exchanging ATPase/antagonists & inhibitors ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...