ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Transfection  (3)
  • American Association for the Advancement of Science (AAAS)  (3)
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (3)
Years
  • 1
    facet.materialart.
    Unknown
    Cloning of a delta opioid receptor by functional expression (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-12-28
    Description: Opiate drugs have potent analgesic and addictive properties. These drugs interact with receptors that also mediate the response to endogenous opioid peptide ligands. However, the receptors for opioids have eluded definitive molecular characterization. By transient expression in COS cells and screening with an iodinated analog of the opioid peptide enkephalin, a complementary DNA clone encoding a functional delta opioid receptor has been identified. The sequence shows homology to G protein-coupled receptors, in particular the receptors for somatostatin, angiotensin, and interleukin-8.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Evans, C J -- Keith, D E Jr -- Morrison, H -- Magendzo, K -- Edwards, R H -- DA05010/DA/NIDA NIH HHS/ -- P50 DA005010/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 1992 Dec 18;258(5090):1952-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, University of California, School of Medicine, Los Angeles 90024-1759.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1335167" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding, Competitive ; Blotting, Northern ; Blotting, Southern ; Cell Line ; Cyclic AMP/metabolism ; Diprenorphine/metabolism ; Enkephalin, D-Penicillamine (2,5)- ; Enkephalins/pharmacology ; Etorphine/pharmacology ; Gene Expression ; Humans ; Kinetics ; Models, Structural ; Molecular Sequence Data ; Naloxone/pharmacology ; Narcotics/pharmacology ; Protein Structure, Secondary ; Receptors, Opioid, delta/chemistry/*genetics/*metabolism ; Sequence Homology, Amino Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    A critical role for conserved residues in the cleft of HLA-A2 in presentation of a nonapeptide to T cells (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-08-14
    Description: The peptide binding cleft of the class I human histocompatibility antigen, HLA-A2, contains conserved amino acid residues clustered in the two ends of the cleft in pockets A and F as well as polymorphic residues. The function of two conserved tyrosines in the A pocket was investigated by mutating them to phenylalanines and of a conserved tyrosine and threonine in the F pocket by mutating them to phenylalanine and valine, respectively. Presentation of influenza virus peptides and of intact virus to cytolytic T lymphocytes (CTLs) was then examined. The magnitude of the reduction seen by the mutation of the two tyrosines in the A pocket suggests that hydrogen bonds involving them have a critical function in the binding of the NH2-terminal NH3+ of the peptide nonamer and possibly of all bound peptide nonamers. In contrast, the mutations in the F pocket had no effect on CTL recognition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Latron, F -- Pazmany, L -- Morrison, J -- Moots, R -- Saper, M A -- McMichael, A -- Strominger, J L -- AI 20182/AI/NIAID NIH HHS/ -- CA 47554/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1992 Aug 14;257(5072):964-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1380181" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; B-Lymphocytes/immunology ; Binding Sites ; Cell Line ; Cloning, Molecular ; Epitopes/immunology/metabolism ; HLA-A2 Antigen/chemistry/genetics/*metabolism ; Influenza A virus ; Kinetics ; Models, Molecular ; Mutagenesis, Site-Directed ; Oligopeptides/immunology/*metabolism ; Protein Conformation ; Recombinant Proteins/chemistry/metabolism ; T-Lymphocytes, Cytotoxic/*immunology ; Transfection ; Viral Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...