ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Molecular Sequence Data  (6)
  • American Association for the Advancement of Science (AAAS)  (6)
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (6)
Years
  • 1
    facet.materialart.
    Unknown
    Cloning of a delta opioid receptor by functional expression (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-12-28
    Description: Opiate drugs have potent analgesic and addictive properties. These drugs interact with receptors that also mediate the response to endogenous opioid peptide ligands. However, the receptors for opioids have eluded definitive molecular characterization. By transient expression in COS cells and screening with an iodinated analog of the opioid peptide enkephalin, a complementary DNA clone encoding a functional delta opioid receptor has been identified. The sequence shows homology to G protein-coupled receptors, in particular the receptors for somatostatin, angiotensin, and interleukin-8.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Evans, C J -- Keith, D E Jr -- Morrison, H -- Magendzo, K -- Edwards, R H -- DA05010/DA/NIDA NIH HHS/ -- P50 DA005010/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 1992 Dec 18;258(5090):1952-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, University of California, School of Medicine, Los Angeles 90024-1759.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1335167" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding, Competitive ; Blotting, Northern ; Blotting, Southern ; Cell Line ; Cyclic AMP/metabolism ; Diprenorphine/metabolism ; Enkephalin, D-Penicillamine (2,5)- ; Enkephalins/pharmacology ; Etorphine/pharmacology ; Gene Expression ; Humans ; Kinetics ; Models, Structural ; Molecular Sequence Data ; Naloxone/pharmacology ; Narcotics/pharmacology ; Protein Structure, Secondary ; Receptors, Opioid, delta/chemistry/*genetics/*metabolism ; Sequence Homology, Amino Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Human-specific gain of function in a developmental enhancer (2008)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2008-09-06
    Description: Changes in gene regulation are thought to have contributed to the evolution of human development. However, in vivo evidence for uniquely human developmental regulatory function has remained elusive. In transgenic mice, a conserved noncoding sequence (HACNS1) that evolved extremely rapidly in humans acted as an enhancer of gene expression that has gained a strong limb expression domain relative to the orthologous elements from chimpanzee and rhesus macaque. This gain of function was consistent across two developmental stages in the mouse and included the presumptive anterior wrist and proximal thumb. In vivo analyses with synthetic enhancers, in which human-specific substitutions were introduced into the chimpanzee enhancer sequence or reverted in the human enhancer to the ancestral state, indicated that 13 substitutions clustered in an 81-base pair module otherwise highly constrained among terrestrial vertebrates were sufficient to confer the human-specific limb expression domain.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2658639/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2658639/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Prabhakar, Shyam -- Visel, Axel -- Akiyama, Jennifer A -- Shoukry, Malak -- Lewis, Keith D -- Holt, Amy -- Plajzer-Frick, Ingrid -- Morrison, Harris -- Fitzpatrick, David R -- Afzal, Veena -- Pennacchio, Len A -- Rubin, Edward M -- Noonan, James P -- 1-F32-GM074367/GM/NIGMS NIH HHS/ -- F32 GM074367/GM/NIGMS NIH HHS/ -- F32 GM074367-02/GM/NIGMS NIH HHS/ -- HG003988/HG/NHGRI NIH HHS/ -- HL066681/HL/NHLBI NIH HHS/ -- MC_U127561093/Medical Research Council/United Kingdom -- New York, N.Y. -- Science. 2008 Sep 5;321(5894):1346-50. doi: 10.1126/science.1159974.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genomics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/18772437" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Body Patterning/*genetics ; Conserved Sequence ; Embryonic Development ; *Enhancer Elements, Genetic ; Evolution, Molecular ; Extremities/*embryology ; Gene Expression Profiling ; *Gene Expression Regulation, Developmental ; Humans ; Limb Buds/embryology/metabolism ; Macaca mulatta/genetics ; Mice ; Mice, Transgenic ; Molecular Sequence Data ; Mutation ; PAX9 Transcription Factor/metabolism ; Pan troglodytes/genetics ; Selection, Genetic ; Transcription Factors/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Isolation of Succinivibrionaceae implicated in low methane emissions from Tammar wallabies (2011)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2011-07-02
    Description: The Tammar wallaby (Macropus eugenii) harbors unique gut bacteria and produces only one-fifth the amount of methane produced by ruminants per unit of digestible energy intake. We have isolated a dominant bacterial species (WG-1) from the wallaby microbiota affiliated with the family Succinivibrionaceae and implicated in lower methane emissions from starch-containing diets. This was achieved by using a partial reconstruction of the bacterium's metabolism from binned metagenomic data (nitrogen and carbohydrate utilization pathways and antibiotic resistance) to devise cultivation-based strategies that produced axenic WG-1 cultures. Pure-culture studies confirm that the bacterium is capnophilic and produces succinate, further explaining a microbiological basis for lower methane emissions from macropodids. This knowledge also provides new strategic targets for redirecting fermentation and reducing methane production in livestock.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pope, P B -- Smith, W -- Denman, S E -- Tringe, S G -- Barry, K -- Hugenholtz, P -- McSweeney, C S -- McHardy, A C -- Morrison, M -- New York, N.Y. -- Science. 2011 Jul 29;333(6042):646-8. doi: 10.1126/science.1205760. Epub 2011 Jun 30.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉CSIRO Livestock Industries, Queensland Bioscience Precinct, St Lucia 4067, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/21719642" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Carbohydrate Metabolism ; Digestive System/*microbiology ; Female ; Fermentation ; Genome, Bacterial ; Macropodidae/*microbiology ; Metagenome ; Methane/*metabolism ; Molecular Sequence Data ; Starch/metabolism ; Succinic Acid/*metabolism ; Succinivibrionaceae/genetics/growth & development/*isolation & ; purification/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Genomic minimalism in the early diverging intestinal parasite Giardia lamblia (2007)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2007-09-29
    Description: The genome of the eukaryotic protist Giardia lamblia, an important human intestinal parasite, is compact in structure and content, contains few introns or mitochondrial relics, and has simplified machinery for DNA replication, transcription, RNA processing, and most metabolic pathways. Protein kinases comprise the single largest protein class and reflect Giardia's requirement for a complex signal transduction network for coordinating differentiation. Lateral gene transfer from bacterial and archaeal donors has shaped Giardia's genome, and previously unknown gene families, for example, cysteine-rich structural proteins, have been discovered. Unexpectedly, the genome shows little evidence of heterozygosity, supporting recent speculations that this organism is sexual. This genome sequence will not only be valuable for investigating the evolution of eukaryotes, but will also be applied to the search for new therapeutics for this parasite.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, Hilary G -- McArthur, Andrew G -- Gillin, Frances D -- Aley, Stephen B -- Adam, Rodney D -- Olsen, Gary J -- Best, Aaron A -- Cande, W Zacheus -- Chen, Feng -- Cipriano, Michael J -- Davids, Barbara J -- Dawson, Scott C -- Elmendorf, Heidi G -- Hehl, Adrian B -- Holder, Michael E -- Huse, Susan M -- Kim, Ulandt U -- Lasek-Nesselquist, Erica -- Manning, Gerard -- Nigam, Anuranjini -- Nixon, Julie E J -- Palm, Daniel -- Passamaneck, Nora E -- Prabhu, Anjali -- Reich, Claudia I -- Reiner, David S -- Samuelson, John -- Svard, Staffan G -- Sogin, Mitchell L -- AI42488/AI/NIAID NIH HHS/ -- AI43273/AI/NIAID NIH HHS/ -- AI51687/AI/NIAID NIH HHS/ -- R01 AI043273/AI/NIAID NIH HHS/ -- R01 AI048082/AI/NIAID NIH HHS/ -- R01 HG004164/HG/NHGRI NIH HHS/ -- R01 HG004164-01/HG/NHGRI NIH HHS/ -- New York, N.Y. -- Science. 2007 Sep 28;317(5846):1921-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Marine Biological Laboratory, Woods Hole, MA 02543-1015, USA. morrison@mbl.edu〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17901334" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; *Biological Evolution ; DNA Replication/genetics ; *Eukaryotic Cells ; Gene Transfer, Horizontal ; Genes, Protozoan ; *Genome, Protozoan ; Genomics ; Giardia lamblia/classification/*genetics/physiology ; Metabolic Networks and Pathways/genetics ; Molecular Sequence Data ; Phylogeny ; Protein Kinases/genetics/metabolism ; Protozoan Proteins/chemistry/genetics/metabolism ; RNA Processing, Post-Transcriptional ; Signal Transduction ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Genetic code supports targeted insertion of two amino acids by one codon (2009)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2009-01-10
    Description: Strict one-to-one correspondence between codons and amino acids is thought to be an essential feature of the genetic code. However, we report that one codon can code for two different amino acids with the choice of the inserted amino acid determined by a specific 3' untranslated region structure and location of the dual-function codon within the messenger RNA (mRNA). We found that the codon UGA specifies insertion of selenocysteine and cysteine in the ciliate Euplotes crassus, that the dual use of this codon can occur even within the same gene, and that the structural arrangements of Euplotes mRNA preserve location-dependent dual function of UGA when expressed in mammalian cells. Thus, the genetic code supports the use of one codon to code for multiple amino acids.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3088105/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3088105/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turanov, Anton A -- Lobanov, Alexey V -- Fomenko, Dmitri E -- Morrison, Hilary G -- Sogin, Mitchell L -- Klobutcher, Lawrence A -- Hatfield, Dolph L -- Gladyshev, Vadim N -- AI058054/AI/NIAID NIH HHS/ -- GM061603/GM/NIGMS NIH HHS/ -- GM065204/GM/NIGMS NIH HHS/ -- R01 GM061603/GM/NIGMS NIH HHS/ -- R01 GM061603-04S2/GM/NIGMS NIH HHS/ -- ZIA BC010767-03/Intramural NIH HHS/ -- New York, N.Y. -- Science. 2009 Jan 9;323(5911):259-61. doi: 10.1126/science.1164748.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Redox Biology Center, University of Nebraska, Lincoln, NE 68588, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/19131629" target="_blank"〉PubMed〈/a〉
    Keywords: 3' Untranslated Regions ; Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Codon/*genetics ; Codon, Terminator/*genetics ; Cysteine/*genetics/metabolism ; Euplotes/chemistry/*genetics ; *Genetic Code ; Humans ; Molecular Sequence Data ; Mutation ; Protozoan Proteins/biosynthesis/chemistry/genetics ; RNA, Protozoan/genetics/metabolism ; RNA, Transfer, Amino Acid-Specific/chemistry/genetics ; RNA, Transfer, Cys/chemistry/genetics ; Recombinant Fusion Proteins/metabolism ; Selenocysteine/*genetics/metabolism ; Selenoproteins/biosynthesis/chemistry/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...