ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Ihre E-Mail wurde erfolgreich gesendet. Bitte prüfen Sie Ihren Maileingang.

Leider ist ein Fehler beim E-Mail-Versand aufgetreten. Bitte versuchen Sie es erneut.

Vorgang fortführen?

Exportieren
Filter
  • Transfection  (44)
  • American Association for the Advancement of Science (AAAS)  (44)
  • American Association of Petroleum Geologists (AAPG)
  • International Union of Crystallography (IUCr)
  • Springer Nature
  • 1985-1989  (44)
  • 1989  (44)
Sammlung
Verlag/Herausgeber
  • American Association for the Advancement of Science (AAAS)  (44)
  • American Association of Petroleum Geologists (AAPG)
  • International Union of Crystallography (IUCr)
  • Springer Nature
Erscheinungszeitraum
  • 1985-1989  (44)
Jahr
  • 1
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-01-20
    Beschreibung: Human and murine mononuclear phagocytes express a high-affinity receptor for immunoglobulin G that plays a central role in macrophage antibody-dependent cellular cytotoxicity and clearance of immune complexes. The receptor (FcRI) may also be involved in CD4-independent infection of human macrophages by human immunodeficiency virus. This report describes the isolation of cDNA clones encoding the human FcRI by a ligand-mediated selection technique. Expression of the cDNAs in COS cells gave rise to immunoglobulin G binding of the expected affinity and subtype specificity. RNA blot analysis revealed expression of a 1.7-kilobase transcript in macrophages and in cells of the promonocytic cell line U937 induced with interferon-gamma. The extracellular region of FcRI consists of three immunoglobulin-like domains, two of which share homology with low-affinity receptor domains.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Allen, J M -- Seed, B -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):378-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911749" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Blotting, Northern ; Cercopithecus aethiops ; Cloning, Molecular ; DNA/genetics ; Gene Expression Regulation ; Humans ; Molecular Sequence Data ; Molecular Weight ; Polymorphism, Genetic ; Receptors, Fc/*genetics ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 2
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-05-05
    Beschreibung: Tumor promoters may bring about events that lead to neoplastic transformation by inducing specific promotion-relevant effector genes. Functional activation of the transacting transcription factor AP-1 by the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) may play an essential role in this process. Clonal genetic variants of mouse epidermal JB6 cells that are genetically susceptible (P+) or resistant (P-) to promotion of transformation by TPA were transfected with 3XTRE-CAT, a construct that has AP-1 cis-enhancer sequences attached to a reporter gene encoding chloramphenicol acetyltransferase (CAT). Transfected JB6 P+, but not P- variants, showed TPA-inducible CAT synthesis. Epidermal growth factor, another transformation promoter in JB6 cells, also caused P+ specific induction of CAT gene expression. These results demonstrate an association between induced AP-1 function and sensitivity to promotion of neoplastic transformation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bernstein, L R -- Colburn, N H -- New York, N.Y. -- Science. 1989 May 5;244(4904):566-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Johns Hopkins University, Department of Biology, Baltimore, MD 21218.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541502" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Chloramphenicol O-Acetyltransferase/genetics ; Cloning, Molecular ; DNA-Binding Proteins/genetics/*physiology ; Epidermal Growth Factor/pharmacology ; Epidermis ; Gene Expression Regulation ; Genetic Variation ; Kinetics ; Mice ; Nucleic Acid Hybridization ; Plasmids ; Promoter Regions, Genetic ; Proto-Oncogene Proteins ; Proto-Oncogene Proteins c-jun ; Simplexvirus/genetics ; Tetradecanoylphorbol Acetate/*pharmacology ; Transcription Factors/genetics/*physiology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 3
    Publikationsdatum: 1989-04-28
    Beschreibung: Transcriptional activation of the human interleukin-2 (IL-2) gene, like induction of the IL-2 receptor alpha (IL-2R alpha) gene and the type 1 human immunodeficiency virus (HIV-1), is shown to be modulated by a kappa B-like enhancer element. Mutation of a kappa B core sequence identified in the IL-2 promoter (-206 to -195) partially inhibits both mitogen- and HTLV-I Tax-mediated activation of this transcription unit and blocks the specific binding of two inducible cellular factors. These kappa B-specific proteins (80 to 90 and 50 to 55 kilodaltons) similarly interact with the functional kappa B enhancer present in the IL-2R alpha promoter. These data suggest that these kappa B-specific proteins have a role in the coordinate regulation of this growth factor-growth factor receptor gene system that controls T cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoyos, B -- Ballard, D W -- Bohnlein, E -- Siekevitz, M -- Greene, W C -- A127053-01/PHS HHS/ -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):457-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Medical Center, Department of Microbiology, New York, NY 10029.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497518" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/metabolism ; DNA-Binding Proteins/*metabolism ; *Enhancer Elements, Genetic ; *Gene Expression Regulation ; Genes, Viral ; HIV-1/genetics ; HTLV-I Antigens/pharmacology ; Humans ; Immunoglobulin kappa-Chains/*genetics ; Interleukin-2/*genetics ; Molecular Weight ; Mutation ; Phytohemagglutinins/pharmacology ; Plasmids ; Promoter Regions, Genetic ; RNA, Messenger/biosynthesis ; T-Lymphocytes/metabolism ; Tetradecanoylphorbol Acetate/pharmacology ; Trans-Activators ; Transcription Factors/pharmacology ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 4
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-05-19
    Beschreibung: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 5
    Publikationsdatum: 1989-09-15
    Beschreibung: Gene targeting via homologous recombination-mediated disruption in murine embryonic stem (ES) cells has been described for a number of different genes expressed in these cells; it has not been reported for any nonexpressed genes. Pluripotent stem cell lines were isolated with homologously recombined insertions at three different loci: c-fos, which is expressed at a low level in ES cells, and two genes, adipsin and adipocyte P2 (aP2), which are transcribed specifically in adipose cells and are not expressed at detectable levels in ES cells. The frequencies at which homologous recombination events occurred did not correlate with levels of expression of the targeted genes, but did occur at rates comparable to those previously reported for genes that are actively expressed in ES cells. Injection of successfully targeted cells into mouse blastocysts resulted in the formation of chimeric mice. These studies demonstrate the feasibility of altering genes in ES cells that are expressed in a tissue-specific manner in the mouse, in order to study their function at later developmental stages.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R S -- Sheng, M -- Greenberg, M E -- Kolodner, R D -- Papaioannou, V E -- Spiegelman, B M -- DK 31405/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1234-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506639" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adipose Tissue/cytology ; Animals ; Blotting, Northern ; Blotting, Southern ; Carrier Proteins/biosynthesis/*genetics ; Cell Line ; Chimera ; Complement Factor D ; DNA, Recombinant ; DNA-Binding Proteins/biosynthesis/genetics ; Fatty Acid-Binding Proteins ; Fatty Acids/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; *Neoplasm Proteins ; *Nerve Tissue Proteins ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-fos ; RNA, Messenger/biosynthesis/genetics ; *Recombination, Genetic ; Serine Endopeptidases/*genetics ; Stem Cells/*metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 6
    Publikationsdatum: 1989-06-02
    Beschreibung: Neurotransmitter receptors are usually restricted to neuronal cells, but the signaling pathways activated by these receptors are widely distributed in both neural and non-neural cells. The functional consequences of activating a brain-specific neurotransmitter receptor, the serotonin 5HT1c receptor, in the unnatural environment of a fibroblast were examined. Introduction of functional 5HT1c receptors into NIH 3T3 cells results, at high frequency, in the generation of transformed foci. Moreover, the generation and maintenance of transformed foci requires continued activation of the serotonin receptor. In addition, the injection of cells derived from transformed foci into nude mice results in the generation of tumors. The serotonin 5HT1c receptor therefore functions as a protooncogene when expressed in NIH 3T3 fibroblasts.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Julius, D -- Livelli, T J -- Jessell, T M -- Axel, R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1057-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, College of Physicians and Surgeons, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727693" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Calcium/pharmacology ; Cell Division ; Cell Line ; *Cell Transformation, Neoplastic ; Cloning, Molecular ; Fibroblasts/metabolism ; *Gene Expression Regulation ; Genetic Vectors ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Receptors, Serotonin/*genetics/physiology ; Second Messenger Systems ; Serotonin/pharmacology/physiology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 7
    Publikationsdatum: 1989-03-10
    Beschreibung: Antisense RNA-mediated inhibition of gene expression was used to investigate the biological function of the c-raf-1 gene in a radiation-resistant human squamous carcinoma cell line, SQ-20B. S1 nuclease protection assays revealed that transfection of full-length raf complementary DNA in the antisense orientation (AS) leads to a specific reduction (greater than tenfold) of steady-state levels of the endogenous c-raf-1 sense (S) transcript in SQ-20B cells. In nude mice, the malignant potential of SQ-20B cells transfected with raf (S) was significantly increased relative to that of SQ-20B cells transfected with raf (AS). SQ-20B cells containing transfected raf (S) maintained a radiation-resistant phenotype as compared to those cells harboring the AS version, which appeared to have enhanced radiation sensitivity. These data indicate that the reduced expression of endogenous c-raf-1 is sufficient to modulate the tumorigenicity and the radiation-resistant phenotype of SQ-20B cells, thus implicating c-raf-1 in a pathway important to the genesis of this type of cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kasid, U -- Pfeifer, A -- Brennan, T -- Beckett, M -- Weichselbaum, R R -- Dritschilo, A -- Mark, G E -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1354-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Radiation Medicine, Vincent T. Lombardi Comprehensive Cancer Research Center, Georgetown University Medical Center, Washington 20007.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466340" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Blotting, Southern ; Carcinoma, Squamous Cell/*genetics ; Cell Line ; Cell Survival/*radiation effects ; Clone Cells ; Dose-Response Relationship, Radiation ; *Gene Expression Regulation ; Humans ; Kinetics ; Mice ; Mice, Nude ; Neoplasm Transplantation ; Nucleic Acid Hybridization ; *Proto-Oncogenes ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors ; Transcription, Genetic ; Transfection ; Transplantation, Heterologous ; Tumor Cells, Cultured/*radiation effects
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 8
    Publikationsdatum: 1989-02-17
    Beschreibung: Mouse 3T3 cell lines capable of constitutively synthesizing an RNA complementary to the messenger RNA encoding TIMP, tissue inhibitor of metalloproteinases, were constructed by transfection with appropriate plasmid constructs. Many of the lines were down-modulated for TIMP messenger RNA levels and secreted less TIMP into the culture medium. In comparison to noninvasive, nontumorigenic controls, these cells not only were invasive in a human amnion invasion assay, but also were tumorigenic and metastatic in athymic mice. These results indicate that TIMP suppresses oncogenicity, at least in immortal murine 3T3 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Khokha, R -- Waterhouse, P -- Yagel, S -- Lala, P K -- Overall, C M -- Norton, G -- Denhardt, D T -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):947-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Western Ontario, London, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2465572" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Cells, Cultured ; Enzyme Inhibitors/*genetics/metabolism ; Female ; Metalloendopeptidases/antagonists & inhibitors ; Mice ; Mice, Nude ; Neoplasm Metastasis ; Pituitary Neoplasms/genetics/pathology ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors/genetics ; Tissue Inhibitor of Metalloproteinases ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 9
    Publikationsdatum: 1989-06-30
    Beschreibung: Complementary DNA's that encode an adenylyl cyclase were isolated from a bovine brain library. Most of the deduced amino acid sequence of 1134 residues is divisible into two alternating sets of hydrophobic and hydrophilic domains. Each of the two large hydrophobic domains appears to contain six transmembrane spans. Each of the two large hydrophilic domains contains a sequence that is homologous to a single cytoplasmic domain of several guanylyl cyclases; these sequences may represent nucleotide binding sites. An unexpected topographical resemblance between adenylyl cyclase and various plasma membrane channels and transporters was observed. This structural complexity suggests possible, unappreciated functions for this important enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Krupinski, J -- Coussen, F -- Bakalyar, H A -- Tang, W J -- Feinstein, P G -- Orth, K -- Slaughter, C -- Reed, R R -- Gilman, A G -- CA16519/CA/NCI NIH HHS/ -- GM12230/GM/NIGMS NIH HHS/ -- GM34497/GM/NIGMS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1558-64.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas 75235.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472670" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): *Adenylyl Cyclases/genetics/isolation & purification ; Amino Acid Sequence ; Animals ; Base Sequence ; Brain/enzymology ; *Carrier Proteins ; Cattle ; Cell Line ; Cloning, Molecular ; DNA/genetics ; Electrophoresis, Polyacrylamide Gel ; *Ion Channels ; Membrane Proteins ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Protein Conformation ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 10
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-08-18
    Beschreibung: CD4 is a cell surface glycoprotein that is thought to interact with nonpolymorphic determinants of class II major histocompatibility (MHC) molecules. CD4 is also the receptor for the human immunodeficiency virus (HIV), binding with high affinity to the HIV-1 envelope glycoprotein, gp120. Homolog-scanning mutagenesis was used to identify CD4 regions that are important in class II MHC binding and to determine whether the gp120 and class II MHC binding sites of CD4 are related. Class II MHC binding was abolished by mutations in each of the first three immunoglobulin-like domains of CD4. The gp120 binding could be abolished without affecting class II MHC binding and vice versa, although at least one mutation examined reduced both functions significantly. These findings indicate that, while there may be overlap between the gp120 and class II MHC binding sites of CD4, these sites are distinct and can be separated. Thus it should be possible to design CD4 analogs that can block HIV infectivity but intrinsically lack the ability to affect the normal immune response by binding to class II MHC molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lamarre, D -- Ashkenazi, A -- Fleury, S -- Smith, D H -- Sekaly, R P -- Capon, D J -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):743-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549633" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Antigens, Surface ; Binding Sites ; DNA, Recombinant ; HIV/*metabolism ; HIV Envelope Protein gp120 ; HLA-DP Antigens/immunology ; Histocompatibility Antigens Class II/*immunology ; Humans ; Hybridomas ; Mice ; Molecular Sequence Data ; Mutation ; Receptors, HIV ; Receptors, Virus/genetics/immunology/*metabolism ; Retroviridae Proteins/immunology/*metabolism ; Rosette Formation ; Structure-Activity Relationship ; T-Lymphocytes/immunology/metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 11
    Publikationsdatum: 1989-12-22
    Beschreibung: CD16 is a low-affinity immunoglobulin G (IgG) Fc receptor that is expressed on natural killer (NK) cells, granulocytes, activated macrophages, and some T lymphocytes. Two similar genes, CD16-I and CD16-II, encode membrane glycoproteins that are anchored by phosphatidylinositol (PI)-glycan and transmembrane polypeptides, respectively. The primary structural requirements for PI-linkage were examined by constructing a series of hybrid cDNA molecules. Although both cDNA's have an identical COOH-terminal hydrophobic segment, CD16-I has Ser203 whereas CD16-II has Phe203. Conversion of Phe to Ser in CD16-II permits expression of a PI-glycan-anchored glycoprotein, whereas conversion of Ser to Phe in CD16-I prevents PI-glycan linkage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lanier, L L -- Cwirla, S -- Yu, G -- Testi, R -- Phillips, J H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Becton Dickinson Monoclonal Center, Inc., Mountain View, CA 94043.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531919" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, CD/*genetics ; Antigens, Differentiation/*genetics/metabolism ; Base Sequence ; Cell Line ; Cell Membrane/immunology ; Codon/genetics ; *Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; *Phenylalanine ; Receptors, Fc/*genetics/metabolism ; Receptors, IgG ; *Serine ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 12
    Publikationsdatum: 1989-01-27
    Beschreibung: Embryonal carcinoma (EC) cell lines are models for early cells in mouse embryogenesis. A 300-base pair fragment of the heavy chain enhancer was inactive in F9 EC cells, unlike in other nonlymphoid cells where it has significant activity. Alterations of the octamer motif increased enhancer activity. Nuclear extracts from F9 cells contained an octamer binding protein (NF-A3) that was unique to EC cells; the amount of NF-A3 decreased upon differentiation. It is proposed that NF-A3 represses specific regulatory sequences that contain the octamer motif. Thus, the same DNA sequence mediates either negative or positive transcriptional effects, depending on the cell type.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lenardo, M J -- Staudt, L -- Robbins, P -- Kuang, A -- Mulligan, R C -- Baltimore, D -- CA 01074/CA/NCI NIH HHS/ -- HD0063/HD/NICHD NIH HHS/ -- HL37569/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):544-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536195" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Bucladesine/pharmacology ; Cell Differentiation ; DNA/metabolism ; Embryonal Carcinoma Stem Cells ; *Enhancer Elements, Genetic ; Immunoglobulin Heavy Chains/*genetics ; Macromolecular Substances ; Mice ; Mutation ; Neoplastic Stem Cells/*metabolism ; RNA, Messenger/biosynthesis ; Regulatory Sequences, Nucleic Acid ; Repressor Proteins/genetics ; Transcription, Genetic ; Transfection ; Tretinoin/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 13
    Publikationsdatum: 1989-11-24
    Beschreibung: Ciliary neurotrophic factor (CNTF) is one of a small number of proteins with neurotrophic activities distinct from nerve growth factor (NGF). CNTF has now been purified and cloned and the primary structure of CNTF from rabbit sciatic nerve has been determined. Biologically active CNTF has been transiently expressed from a rabbit complementary DNA clone. CNTF is a neural effector without significant sequence homologies to any previously reported protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lin, L F -- Mismer, D -- Lile, J D -- Armes, L G -- Butler, E T 3rd -- Vannice, J L -- Collins, F -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1023-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Protein Chemistry Group, Synergen, Inc., Boulder, CO 80301.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587985" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Cell Line ; Ciliary Neurotrophic Factor ; Cloning, Molecular ; DNA/genetics ; Molecular Sequence Data ; Nerve Growth Factors/*genetics ; Nerve Tissue Proteins/biosynthesis/*genetics/isolation & purification ; Rabbits ; Recombinant Proteins/biosynthesis ; Sciatic Nerve/metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 14
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-08-04
    Beschreibung: The pyrimidine analog 5-bromodeoxyuridine (BUdR) competes with thymidine for incorporation into DNA. Substitution of BUdR for thymidine does not significantly affect cell viability but does block cell differentiation in many different lineages. BUdR substitution in a mouse myoblast line blocked myogenic differentiation and extinguished the expression of the myogenic determination gene MyoD1. Forced expression of MyoD1 from a transfected expression vector in a BUdR-substituted myoblast overcame the block to differentiation imposed by BUdR. Activation of BUdR-substituted muscle structural genes and apparently normal differentiation were observed in transfected myoblasts. This shows that BUdR blocks myogenesis at the level of a myogenic regulatory gene, possibly MyoD1, not by directly inhibiting the activation of muscle structural genes. It is consistent with the idea that BUdR selectively blocks a class of regulatory genes, each member of which is important for the development of a different cell lineage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tapscott, S J -- Lassar, A B -- Davis, R L -- Weintraub, H -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):532-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Fred Hutchinson Cancer Research Center, Seattle, WA 98104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547249" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Bromodeoxyuridine/metabolism/*pharmacology ; Cell Differentiation/drug effects ; Cell Line ; Creatine Kinase/genetics ; DNA/metabolism ; Desmin/genetics ; Gene Expression Regulation/*drug effects ; Genes ; Mice ; Muscle Proteins/*genetics ; Muscles/*cytology ; Myogenin ; Nuclear Proteins/*genetics ; Plasmids ; RNA, Messenger/genetics ; Repetitive Sequences, Nucleic Acid ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 15
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-06-02
    Beschreibung: Cytotoxic T lymphocytes (CTLs) recognize foreign antigens, including viral proteins, in association with major histocompatibility complex (MHC) class I molecules. Brefeldin A, a specific inhibitor of exocytosis, completely and reversibly inhibited the presentation of viral proteins, but not exogenous peptides, to MHC class I-restricted CTLs directed against influenza virus antigens. The effect of brefeldin A on antigen presentation correlated with its inhibition of intracellular transport of newly synthesized class I molecules. Brefeldin A is thus a specific inhibitor of antigen processing for class I-restricted T cell recognition. Its effect on antigen presentation supports the idea that exogenous peptide antigens associate with cell surface class I molecules, whereas protein antigens processed via the cytosolic route associate with nascent class I molecules before they leave the trans-Golgi complex.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yewdell, J W -- Bennink, J R -- New York, N.Y. -- Science. 1989 Jun 2;244(4908):1072-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory for Viral Diseases, National Institute of Allergy and Infectious Diseases, Rockville, MD 20852.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471266" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigen-Presenting Cells/*drug effects/immunology ; Antigens, Viral/*immunology ; Biological Transport/drug effects ; Brefeldin A ; Cell Membrane/immunology ; Cyclopentanes/*pharmacology ; Endoplasmic Reticulum/immunology ; Epitopes/immunology ; Exocytosis/drug effects ; Golgi Apparatus/immunology ; H-2 Antigens/immunology ; Hemagglutinins/genetics/immunology ; Histocompatibility Antigens Class I/immunology ; Mice ; Nucleoproteins/immunology ; Orthomyxoviridae/immunology ; T-Lymphocytes, Cytotoxic/drug effects/*immunology ; Transfection ; Viral Proteins/*immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 16
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-11-03
    Beschreibung: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Cell Line ; Chloramphenicol O-Acetyltransferase/genetics ; Chromosome Deletion ; *Enhancer Elements, Genetic ; *Genes, Viral ; Hepatitis B virus/*genetics ; Liver/*metabolism ; Molecular Sequence Data ; Mutation ; *Promoter Regions, Genetic ; Simplexvirus/enzymology/genetics ; Thymidine Kinase/genetics ; Transcription, Genetic ; Transfection ; Viral Structural Proteins/genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 17
    Publikationsdatum: 1989-06-09
    Beschreibung: The neuron-specific protein GAP-43 is associated with the membrane of the nerve growth cone and thus may be important to the activity of this distinctive neuronal structure. Transient transfection of COS and NIH 3T3 cells with appropriate vectors resulted in expression of GAP-43 in these non-neuronal cells; as in neurons, transfected GAP-43 associated with the membrane. In addition, many long fine filopodial processes extended from the periphery of such transfected cells. Stable CHO cell lines expressing GAP-43 also exhibited processes that were more numerous, far longer, and more complex than those of CHO cell lines not transfected or transfected with control plasmids. Thus GAP-43 may directly contribute to growth cone activity by regulating cell membrane structure and enhancing extension of filopodial processes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zuber, M X -- Goodman, D W -- Karns, L R -- Fishman, M C -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1193-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Developmental Biology Laboratory, Massachusetts General Hospital Cancer Center, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658062" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Cell Membrane/*ultrastructure ; Cells, Cultured ; Fluorescent Antibody Technique ; GAP-43 Protein ; Growth Substances/*physiology ; Membrane Proteins/genetics/*physiology ; Mice ; Nerve Tissue Proteins/genetics/*physiology ; Recombinant Proteins/pharmacology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 18
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-09-22
    Beschreibung: GABAA (gamma-aminobutyric acid A)-benzodiazepine receptors expressed in mammalian cells and assembled from one of three different alpha subunit variants (alpha 1, alpha 2, or alpha 3) in combination with a beta 1 and a gamma 2 subunit display the pharmacological properties of either type I or type II receptor subtypes. These receptors contain high-affinity binding sites for benzodiazepines. However, CL 218 872, 2-oxoquazepam, and methyl beta-carboline-3-carboxylate (beta-CCM) show a temperature-modulated selectivity for alpha 1 subunit-containing receptors. There were no significant differences in the binding of clonazepam, diazepam, Ro 15-1788, or dimethoxy-4-ethyl-beta-carboline-3-carboxylate (DMCM) to all three recombinant receptors. Receptors containing the alpha 3 subunit show greater GABA potentiation of benzodiazepine binding than receptors containing the alpha 1 or alpha 2 subunit, indicating that there are subtypes within the type II class. Thus, diversity in benzodiazepine pharmacology is generated by heterogeneity of the alpha subunit of the GABAA receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pritchett, D B -- Luddens, H -- Seeburg, P H -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1389-92.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Neuroendocrinology, Zentrum fur Molekulare Biologie, Universitat Heidelberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2551039" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Cell Line ; Diazepam/metabolism ; Flumazenil/metabolism ; Flunitrazepam/metabolism ; Humans ; Molecular Weight ; Pyridazines/metabolism ; Receptors, GABA-A/classification/*genetics/metabolism ; Recombinant Proteins/metabolism ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 19
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-03-03
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1134-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922602" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Abortion, Induced ; *Advisory Committees ; DNA, Recombinant ; *Ethics, Medical ; Federal Government ; Genetic Engineering ; Genetic Markers ; *Genetic Therapy ; Humans ; Legislation, Medical ; National Institutes of Health (U.S.) ; Transfection ; United States
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 20
    Publikationsdatum: 1989-06-23
    Beschreibung: Adipsin is a serine protease that is secreted by adipocytes into the bloodstream; it is deficient in several animal models of obesity, representing a striking example of defective gene expression in this disorder. Recombinant mouse adipsin was purified and its biochemical and enzymatic properties were studied in order to elucidate the function of this protein. Activated adipsin has little or no proteolytic activity toward most substrates but has the same activity as human complement factor D, cleaving complement factor B when it is complexed with activated complement component C3. Like authentic factor D, adipsin can activate the alternative pathway of complement, resulting in red blood cell lysis. Decreased (58 to 80 percent) complement factor D activity, relative to lean controls, was observed as a common feature of several experimental models of obesity, including the ob/ob, db/db, and monosodium glutamate (MSG)-injected mouse and the fa/fa rat. These results suggest that adipsin and the alternative pathway of complement may play an unexpected but important role in the regulation of systemic energy balance in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosen, B S -- Cook, K S -- Yaglom, J -- Groves, D L -- Volanakis, J E -- Damm, D -- White, T -- Spiegelman, B M -- DK31403/DK/NIDDK NIH HHS/ -- DK34605/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1483-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734615" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adipose Tissue/metabolism ; Amino Acid Sequence ; Animals ; Cell Line ; Complement Activating Enzymes/*metabolism ; Complement Factor D/*metabolism ; Complement Pathway, Alternative ; Cricetinae ; DNA/genetics ; Gene Expression Regulation ; Humans ; Immunoblotting ; Mice ; Molecular Sequence Data ; Obesity/genetics/*immunology/metabolism ; RNA, Messenger/metabolism ; Recombinant Proteins ; Serine Endopeptidases/genetics/isolation & purification/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 21
    Publikationsdatum: 1989-08-11
    Beschreibung: The endogenous c-mos product, pp39mos, is required for progesterone-induced meiotic maturation in Xenopus oocytes. Treatment of oocytes with progesterone induced a rapid increase in pp39mos that preceded both the activation of maturation promoting factor (MPF) and germinal vesicle breakdown (GVBD). Microinjection of synthetic mos RNA into oocytes activated MPF and induced GVBD in the absence of progesterone. Thus, the mos proto-oncogene product may qualify as a candidate "initiator" protein of MPF and is at least one of the "triggers" for G2 to M transition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagata, N -- Daar, I -- Oskarsson, M -- Showalter, S D -- Vande Woude, G F -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):643-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉BRI-Basic Research Program, National Cancer Institute, Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474853" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Cycloheximide/pharmacology ; Female ; Growth Substances/physiology ; Kinetics ; Maturation-Promoting Factor ; Meiosis/drug effects ; Microinjections ; Oocytes/*physiology ; Progesterone/pharmacology ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*physiology ; Proto-Oncogene Proteins c-mos ; RNA/genetics ; Transcription, Genetic ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 22
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-06-16
    Beschreibung: Current therapies for most human genetic diseases are inadequate. In response to the need for effective treatments, modern molecular genetics is providing tools for an unprecedented new approach to disease treatment through an attack directly on mutant genes. Recent results with several target organs and gene transfer techniques have led to broad medical and scientific acceptance of the feasibility of this "gene therapy" concept for disorders of the bone marrow, liver, and central nervous system; some kinds of cancer; and deficiencies of circulating enzymes, hormones, and coagulation factors. The most well-developed models involve alteration of mutant target genes by gene transfer with recombinant pathogenic viruses in order to express new genetic information and to correct disease phenotypes--the conversion of the swords of pathology into the plowshares of therapy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Friedmann, T -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660259" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Bone Marrow/physiology ; Brain/physiology ; Ethics, Medical ; Gene Expression Regulation ; Genetic Diseases, Inborn ; Genetic Therapy/*methods/trends ; Genetic Vectors ; Humans ; Liver/physiology ; Neoplasms/genetics ; Risk Assessment ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 23
    Publikationsdatum: 1989-03-17
    Beschreibung: Ornithine decarboxylase (ODC) was converted from a protein with a short intracellular half-life in mammalian cells to a stable protein by truncating 37 residues at its carboxyl terminus. Cells expressing wild-type protein lost ODC activity with a half-life of approximately 1 hour. Cells expressing the truncated protein, however, retained full activity for at least 4 hours. Pulse-chase experiments in which immunoprecipitation and gel electrophoresis were used confirmed the stabilizing effect of the truncation. Thus, a carboxyl-terminal domain is responsible for the rapid intracellular degradation of murine ODC.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ghoda, L -- van Daalen Wetters, T -- Macrae, M -- Ascherman, D -- Coffino, P -- CA 09043/CA/NCI NIH HHS/ -- CA 29048/CA/NCI NIH HHS/ -- CA 47721/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1493-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928784" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Cloning, Molecular ; Mice ; Ornithine Decarboxylase/genetics/*metabolism ; Recombinant Proteins/metabolism ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 24
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-10-27
    Beschreibung: Activation of protein kinase C is thought to require association of the kinase with the cell membrane. It has been assumed that cellular substrates for the kinase must likewise be associated with membranes, and previous studies with membrane-associated myristoylated proteins have supported this view. It is now shown that a mutation that prevents the normal amino-terminal myristoylation of a prominent cellular substrate of protein kinase C, and appears to prevent its membrane association, does not prevent the normal phosphorylation of this protein in intact cells in response to phorbol esters. Thus, membrane association may not be required in order for protein kinase C substrates to undergo phosphorylation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Graff, J M -- Gordon, J I -- Blackshear, P J -- 2T32-GM 07171/GM/NIGMS NIH HHS/ -- AI27179/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):503-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratories, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814478" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Cells, Cultured ; Chickens ; Enzyme Activation ; *Intracellular Signaling Peptides and Proteins ; Membrane Proteins/metabolism ; Mutation ; Myristic Acid ; Myristic Acids ; Phosphorylation ; Protein Kinase C/*metabolism ; Proteins/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 25
    Publikationsdatum: 1989-05-05
    Beschreibung: Interleukin-2 (IL-2) binds to two distinct receptor molecules, the IL-2 receptor alpha (IL-2R alpha, p55) chain and the newly identified IL-2 receptor beta (IL-2R beta, p70-75) chain. The cDNA encoding the human IL-2R beta chain has now been isolated. The overall primary structure of the IL-2R beta chain shows no apparent homology to other known receptors. Unlike the IL-2R alpha chain, the IL-2R beta chain has a large cytoplasmic region in which a functional domain (or domains) mediating an intracellular signal transduction pathway (or pathways) may be embodied. The cDNA-encoded beta chain binds and internalizes IL-2 when expressed on T lymphoid cells but not fibroblast cells. Furthermore, the cDNA gives rise to the generation of high-affinity IL-2 receptor when co-expressed with the IL-2R alpha chain cDNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hatakeyama, M -- Tsudo, M -- Minamoto, S -- Kono, T -- Doi, T -- Miyata, T -- Miyasaka, M -- Taniguchi, T -- New York, N.Y. -- Science. 1989 May 5;244(4904):551-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785715" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; Cross-Linking Reagents ; DNA/*genetics/isolation & purification ; Fibroblasts/metabolism ; Gene Expression Regulation ; Humans ; Interleukin-2/metabolism ; Leukemia ; Molecular Sequence Data ; Nucleic Acid Hybridization ; RNA, Messenger/genetics ; Receptors, Interleukin-2/*genetics/metabolism ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Signal Transduction ; Succinimides ; T-Lymphocytes/metabolism ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 26
    Publikationsdatum: 1989-04-07
    Beschreibung: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 27
    Publikationsdatum: 1989-08-11
    Beschreibung: Cadherins are a family of Ca2+-dependent intercellular adhesion molecules. Complementary DNAs encoding mouse neural cadherin (N-cadherin) were cloned, and the cell binding specificity of this molecule was examined. Mouse N-cadherin shows 92 percent similarity in amino acid sequence to the chicken homolog, while it shows 49 percent and 43 percent similarity to epithelial cadherin and to placental cadherin of the same species, respectively. In cell binding assays, mouse N-cadherin did not cross-react with other mouse cadherins, but it did cross-react with chicken N-cadherin. The results indicate that each cadherin type confers distinct adhesive specificities on different cells, and also that the specificity of N-cadherin is conserved between mammalian and avian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miyatani, S -- Shimamura, K -- Hatta, M -- Nagafuchi, A -- Nose, A -- Matsunaga, M -- Hatta, K -- Takeichi, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):631-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2762814" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Antigens, Surface/genetics/*physiology ; Base Sequence ; Brain Chemistry ; *Cell Adhesion ; Cell Adhesion Molecules ; Chickens ; Cloning, Molecular ; DNA/genetics ; Embryo, Mammalian ; Embryo, Nonmammalian ; L Cells (Cell Line) ; Mice ; Molecular Sequence Data ; Nerve Tissue/*analysis ; Nucleic Acid Hybridization ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 28
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-05-19
    Beschreibung: T cell proliferation in response to stimulation with Staphylococcus enterotoxin A (SEA) requires accessory cells that express class II major histocompatibility complex (MHC) molecules. Murine fibroblasts transfected with genes encoding the alpha and beta subunits of HLA-DR, DQ, or DP were used to show that the proliferative response of purified human T cells to SEA is dependent on class II molecules but is not restricted by the haplotype of the responder. Binding of fluoresceinated SEA to class II transfectants and precipitation of class II heterodimers with SEA-Sepharose show that the proliferative response is a result of SEA binding to class II molecules. The binding is specific for class II molecules and is independent of class II allotype or isotype. The ability of SEA to bind class II molecules may be a general characteristic of this class of antigens, now called "superantigens".〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mollick, J A -- Cook, R G -- Rich, R R -- AI-15394/AI/NIAID NIH HHS/ -- AI-21289/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):817-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratory, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658055" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, Bacterial/immunology ; Enterotoxins/*immunology ; Fibroblasts/immunology ; Fluoresceins ; Fluorescent Dyes ; HLA-DP Antigens/genetics/immunology ; HLA-DQ Antigens/genetics/immunology ; HLA-DR Antigens/genetics/immunology ; Histocompatibility Antigens Class II/*immunology ; Immunosorbent Techniques ; Lymphocyte Activation ; Mice ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 29
    Publikationsdatum: 1989-12-01
    Beschreibung: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 30
    Publikationsdatum: 1989-10-13
    Beschreibung: Interleukin-1 (IL-1) is a major regulator of inflammation and immunity. IL-1 induces T lymphocyte growth by acting as a second signal (together with antigen) in enhancing the production of interleukin-2 (IL-2). An IL-1-responsive element in the promoter region of the human IL-2 gene was similar to the binding site for the transcription factor AP-1. IL-1 enhanced expression of c-jun messenger RNA, whereas the antigenic signal enhanced messenger RNA expression of c-fos. Thus, the two components of the AP-1 factor are independently regulated and the AP-1 factor may serve as a nuclear mediator for the many actions of IL-1 on cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Muegge, K -- Williams, T M -- Kant, J -- Karin, M -- Chiu, R -- Schmidt, A -- Siebenlist, U -- Young, H A -- Durum, S K -- 5-T32-CA-09140/CA/NCI NIH HHS/ -- AI-R01-23879/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):249-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, Program Resources Inc., Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799385" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Chloramphenicol O-Acetyltransferase/genetics ; Gene Expression Regulation ; Humans ; Interleukin-1/*physiology ; Interleukin-2/*genetics ; Mice ; Promoter Regions, Genetic/genetics ; Proto-Oncogene Proteins c-jun/*genetics ; Tetradecanoylphorbol Acetate/pharmacology ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 31
    Publikationsdatum: 1989-04-28
    Beschreibung: A strategy was devised for identifying regions of the mouse genome that are transcriptionally active in a temporally and spatially restricted manner during development. The approach is based on the introduction into embryonic stem cells of two types of lacZ reporter constructs that can be activated by flanking mouse genomic sequences. Embryonic stem cells containing the lacZ constructs were used to produce chimaeric mice. Developmental regulation of lacZ expression occurred at a high frequency. Molecular cloning of the flanking endogenous genes and introduction of these potential insertional mutations into the mouse germ line should provide an efficient means of identifying and mutating novel genes important for the control of mammalian development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gossler, A -- Joyner, A L -- Rossant, J -- Skarnes, W C -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):463-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Hospital Research Institute, Division of Molecular and Developmental Biology, Toronto, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497519" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Chimera ; Cloning, Molecular ; Embryo, Mammalian/*metabolism ; Galactosidases/*genetics ; *Gene Expression Regulation ; Genetic Vectors ; Germ Cells ; Heat-Shock Proteins/genetics ; Male ; Mice ; Promoter Regions, Genetic ; Stem Cells/*metabolism ; Transfection ; Transformation, Genetic ; beta-Galactosidase/*genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 32
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-09-22
    Beschreibung: The inhibition by charybdotoxin of A-type potassium channels expressed in Xenopus oocytes was studied for several splicing variants of the Drosophila Shaker gene and for several site-directed mutants of this channel. Charybdotoxin blocking affinity is lowered by a factor of 3.5 upon replacing glutamate-422 with glutamine, and by a factor of about 12 upon substituting lysine in this position. Replacement of glutamate-422 by aspartate had no effect on toxin affinity. Thus, the glutamate residue at position 422 of this potassium channel is near or in the externally facing mouth of the potassium conduction pathway, and the positively charged toxin is electrostatically focused toward its blocking site by the negative potential set up by glutamate-422.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacKinnon, R -- Miller, C -- AR 19826/AR/NIAMS NIH HHS/ -- GM 31768/GM/NIGMS NIH HHS/ -- NS 07292/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1382-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Brandeis University, Waltham, MA 02254.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476850" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Binding Sites ; Charybdotoxin ; DNA Mutational Analysis ; Drosophila melanogaster ; Ions ; Membrane Proteins/genetics/metabolism/ultrastructure ; Potassium Channels/*metabolism/ultrastructure ; Scorpion Venoms/*metabolism ; Structure-Activity Relationship ; Transfection ; Xenopus laevis
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 33
    Publikationsdatum: 1989-12-22
    Beschreibung: Granulocyte and natural killer (NK) cell Fc receptors for immunoglobulin G (CD16) differ in only a few amino acids, yet have phosphatidylinositol glycan (PIG) or polypeptide membrane anchors, respectively. Mutagenesis shows that anchoring is regulated by a serine residue near the PIG anchor attachment site in the extracellular domain. The NK cell isoform was not expressed on the surface of COS cells unless cotransfected with a subunit that was expressed in NK cells and that was identical to the gamma subunit of the high affinity IgE Fc receptor (Fc epsilon RI). However, the CD16 sequence and not expression of the gamma subunit is dominant in regulating PIG reanchoring.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hibbs, M L -- Selvaraj, P -- Carpen, O -- Springer, T A -- Kuster, H -- Jouvin, M H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531918" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, CD/genetics ; Antigens, Differentiation/*genetics ; Cell Line ; Cell Membrane/immunology ; Flow Cytometry ; *Gene Expression Regulation ; Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Immunoglobulin G ; Killer Cells, Natural/immunology ; L Cells (Cell Line)/immunology ; Mice ; Mutation ; RNA, Messenger/genetics/isolation & purification ; Receptors, Fc/*genetics ; Receptors, IgG ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 34
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-05-19
    Beschreibung: During frog embryogenesis, mesoderm is specified in the equatorial region of the early embryo by a signal from the vegetal hemisphere. Prospective ectodermal cells dissected from the animal hemisphere can be respecified to form mesodermal tissues by recombination with vegetal tissue or by treatment with any of several polypeptide growth factors or growth factor-like molecules. Together with the discovery that several developmental mutations in Drosophila are in genes with significant homology to mammalian mitogens and oncogenes, these observations suggest that early developmental signals may use similar transduction pathways to mitogenic signals characterized in cultured mammalian cells. Whether mesoderm can be induced by activation of intracellular signal transduction pathways implicated in mitogenesis and oncogenesis has been investigated with the viral oncogene polyoma middle T. Microinjection of middle T messenger RNA into early embryos results in the respecification of isolated prospective ectodermal tissue to form characteristic mesodermal structures. Middle T in frog blastomeres appears to associate with cellular activities similar to those observed in polyoma-transformed mouse cells, and transformation-defective middle T mutants fail to induce mesoderm. These results suggest that early inductive signals and mitogenic and oncogenic stimuli may share common signal transduction pathways.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Whitman, M -- Melton, D A -- New York, N.Y. -- Science. 1989 May 19;244(4906):803-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biology, Harvard University, Cambridge, MA 02138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658054" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, Polyomavirus Transforming/genetics ; Blastocyst/physiology ; Blastomeres/physiology ; Ectoderm/physiology ; Immunosorbent Techniques ; Mesoderm/*physiology ; Mitosis ; Morphogenesis ; Muscles/embryology ; Mutation ; *Oncogenes ; Protein-Tyrosine Kinases/metabolism ; RNA, Messenger/genetics ; *Signal Transduction ; Transfection ; Transformation, Genetic ; Xenopus/*embryology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 35
    Publikationsdatum: 1989-03-03
    Beschreibung: Sindbis virus, an enveloped virus with a single-stranded RNA genome, was engineered to express a bacterial protein, chloramphenicol acetyltransferase (CAT), in cultured insect, avian, and mammalian cells. The vectors were self-replicating and gene expression was efficient and rapid; up to 10(8) CAT polypeptides were produced per infected cell in 16 to 20 hours. CAT expression could be made temperature-sensitive by means of a derivative that incorporated a temperature-sensitive mutation in viral RNA synthesis. Vector genomic RNAs were packaged into infectious particles when Sindbis helper virus was used to supply virion structural proteins. The vector RNAs were stable to at least seven cycles of infection. The expression of CAT increased about 10(3)-fold, despite a 10(15)-fold dilution during the passaging. Sindbis virus vectors should prove useful for expressing large quantities of gene products in a variety of animal cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Xiong, C -- Levis, R -- Shen, P -- Schlesinger, S -- Rice, C M -- Huang, H V -- AG05681/AG/NIA NIH HHS/ -- AI11377/AI/NIAID NIH HHS/ -- AI24134/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1188-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922607" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Aedes ; Animals ; Bacteria/enzymology ; Cells, Cultured ; Chick Embryo ; Chloramphenicol O-Acetyltransferase/*genetics ; Codon ; Cricetinae ; DNA/genetics ; Drosophila ; Gene Amplification ; Gene Expression Regulation ; *Genetic Engineering ; *Genetic Vectors ; Humans ; Quail ; RNA, Viral/*genetics ; Sindbis Virus/*genetics ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 36
    Publikationsdatum: 1989-07-28
    Beschreibung: Amyloid deposition in senile plaques and the cerebral vasculature is a marker of Alzheimer's disease. Whether amyloid itself contributes to the neurodegenerative process or is simply a by-product of that process is unknown. Pheochromocytoma (PC12) and fibroblast (NIH 3T3) cell lines were transfected with portions of the gene for the human amyloid precursor protein. Stable PC12 cell transfectants expressing a specific amyloid-containing fragment of the precursor protein gradually degenerated when induced to differentiate into neuronal cells with nerve growth factor. Conditioned medium from these cells was toxic to neurons in primary hippocampal cultures, and the toxic agent could be removed by immunoabsorption with an antibody directed against the amyloid polypeptide. Thus, a peptide derived from the amyloid precursor may be neurotoxic.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yankner, B A -- Dawes, L R -- Fisher, S -- Villa-Komaroff, L -- Oster-Granite, M L -- Neve, R L -- HD 18655/HD/NICHD NIH HHS/ -- HD 18658/HD/NICHD NIH HHS/ -- NS 01240/NS/NINDS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):417-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurology, Harvard Medical School, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474201" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Alzheimer Disease/*etiology/pathology ; Amyloid/genetics/*physiology ; Blotting, Northern ; Cell Line ; Fibroblasts ; Gene Expression Regulation ; Humans ; Immunoblotting ; Neurons/pathology ; Nucleic Acid Hybridization ; Pheochromocytoma ; Protein Precursors/genetics/*physiology ; RNA/analysis/genetics ; Restriction Mapping ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 37
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-07-07
    Beschreibung: The linker histones (H1, H5, H1 degrees) are involved in the condensation of chromatin into the 30-nanometer fiber. This supranucleosome organization correlates with the resting state of chromatin, and it is therefore possible that the linker histones play an active role in the control of chromatin activity. The effect of H5 has been directly determined by expression of an inducible transfected H5 gene in rat sarcoma cells, which do not produce H5. Transfection resulted in the reversible inhibition of DNA replication and arrest of cells in G1, at which time H5 concentrations approached that of terminally differentiated avian erythrocytes. The arrest of proliferation was accompanied by specific changes in gene expression probably related to the cell cycle block. The selectivity of these effects suggest that H5 plays an active role in the control of DNA replication and cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, J M -- Wiaderkiewicz, R -- Ruiz-Carrillo, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):68-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cancer Research Center, Laval University School of Medicine, L'Hotel-Dieu du Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740916" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Cell Cycle ; Cell Division ; Cell Line ; Chickens ; DNA/*biosynthesis ; *DNA Replication ; Histones/genetics/*physiology ; Rats ; Receptors, Glucocorticoid/biosynthesis ; Recombinant Proteins/pharmacology ; Sarcoma, Experimental ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 38
    Publikationsdatum: 1989-05-12
    Beschreibung: Membrane fusion induced by the envelope glycoproteins of human and simian immunodeficiency viruses (HIV and SIVmac) is a necessary step for the infection of CD4 cells and for the formation of syncytia after infection. Identification of the region in these molecules that mediates the fusion events is important for understanding and possibly interfering with HIV/SIVmac infection and pathogenesis. Amino acid substitutions were made in the 15 NH2-terminal residues of the SIVmac gp32 transmembrane glycoprotein, and the mutants were expressed in recombinant vaccinia viruses, which were then used to infect CD4-expressing T cell lines. Mutations that increased the overall hydrophobicity of the gp32 NH2-terminus increased the ability of the viral envelope to induce syncytia formation, whereas introduction of polar or charged amino acids in the same region abolished the fusogenic function of the viral envelope. Hydrophobicity in the NH2-terminal region of gp32 may therefore be an important correlate of viral virulence in vivo and could perhaps be exploited to generate a more effective animal model for the study of acquired immunodeficiency syndrome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bosch, M L -- Earl, P L -- Fargnoli, K -- Picciafuoco, S -- Giombini, F -- Wong-Staal, F -- Franchini, G -- New York, N.Y. -- Science. 1989 May 12;244(4905):694-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Tumor Cell Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541505" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA, Viral/genetics ; *Gene Products, env ; HIV/*analysis ; HIV Antigens/metabolism ; HIV Envelope Protein gp120 ; HIV Envelope Protein gp41 ; Humans ; Membrane Glycoproteins ; Molecular Sequence Data ; Mutation ; *Retroviridae Proteins/genetics/metabolism/pharmacology ; *Retroviridae Proteins, Oncogenic ; Retroviruses, Simian/*analysis ; Structure-Activity Relationship ; T-Lymphocytes, Helper-Inducer/microbiology ; Transfection ; Vaccinia virus/genetics ; *Viral Envelope Proteins/genetics/metabolism/pharmacology ; *Viral Fusion Proteins
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 39
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-09-22
    Beschreibung: A plasma membrane form of guanylate cyclase is a cell surface receptor for atrial natriuretic peptide (ANP). In response to ANP binding, the receptor-enzyme produces increased amounts of the second messenger, guanosine 3',5'-monophosphate. Maximal activation of the cyclase requires the presence of adenosine 5'-triphosphate (ATP) or nonhydrolyzable ATP analogs. The intracellular region of the receptor contains at least two domains with homology to other proteins, one possessing sequence similarity to protein kinase catalytic domains, the other to regions of unknown function in a cytoplasmic form of guanylate cyclase and in adenylate cyclase. It is now shown that the protein kinase-like domain functions as a regulatory element and that the second domain possesses catalytic activity. When the kinase-like domain was removed by deletion mutagenesis, the resulting ANP receptor retained guanylate cyclase activity, but this activity was independent of ANP and its stimulation by ATP was markedly reduced. A model for signal transduction is suggested in which binding of ANP to the extracellular domain of its receptor initiates a conformational change in the protein kinase-like domain, resulting in derepression of guanylate cyclase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chinkers, M -- Garbers, D L -- GM31362/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1392-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2571188" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Atrial Natriuretic Factor/*physiology ; Cyclic GMP/physiology ; DNA Mutational Analysis ; Guanylate Cyclase/metabolism ; Magnesium/physiology ; Protein Kinases/*physiology ; Rats ; Receptors, Atrial Natriuretic Factor ; Receptors, Cell Surface/*physiology/ultrastructure ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 40
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-12-22
    Beschreibung: Expression of high levels of the structural proteins of the human immunodeficiency virus type 1 (HIV-1) requires the presence of the protein encoded by the rev open reading frame (Rev) and its associated target sequence CAR (cis anti-repression sequence) which is present in the env region of viral RNA. Extensive mutagenesis demonstrated that CAR has a complex secondary structure consisting of a central stem and five stem/loops. Disruption of any of these structures severely impaired the Rev response, but many of the stem/loops contain material that was unnecessary for Rev regulation and must be retained in these structures to avoid disturbing adjacent structures critical for CAR function. Probably no more than two of the described structural components are involved in sequence-specific recognition by regulatory proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dayton, E T -- Powell, D M -- Dayton, A I -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1625-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Immunoregulation, National Institute of Allergy and Infectious Disease, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688093" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Cell Line ; Chromosome Deletion ; Gene Amplification ; Gene Products, rev/genetics/*metabolism ; *Genes, Viral ; HIV-1/*genetics ; Models, Structural ; Molecular Sequence Data ; Mutation ; Nucleic Acid Conformation ; Plasmids ; RNA, Viral/*genetics ; Software ; Trans-Activators/*metabolism ; Transfection ; Viral Envelope Proteins/genetics ; rev Gene Products, Human Immunodeficiency Virus
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 41
    Publikationsdatum: 1989-09-08
    Beschreibung: Since the classification of beta-adrenergic receptors (beta-ARs) into beta 1 and beta 2 subtypes, additional beta-ARs have been implicated in the control of various metabolic processes by catecholamines. A human gene has been isolated that encodes a third beta-AR, here referred to as the "beta 3-adrenergic receptor." Exposure of eukaryotic cells transfected with this gene to adrenaline or noradrenaline promotes the accumulation of adenosine 3',5'-monophosphate; only 2 of 11 classical beta-AR blockers efficiently inhibited this effect, whereas two others behaved as beta 3-AR agonists. The potency order of beta-AR agonists for the beta 3-AR correlates with their rank order for stimulating various metabolic processes in tissues where atypical adrenergic sites are thought to exist. In particular, novel beta-AR agonists having high thermogenic, antiobesity, and antidiabetic activities in animal models are among the most potent stimulators of the beta 3-AR.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Emorine, L J -- Marullo, S -- Briend-Sutren, M M -- Patey, G -- Tate, K -- Delavier-Klutchko, C -- Strosberg, A D -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1118-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉CNRS, Universite Paris VII, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2570461" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adrenergic beta-Agonists/pharmacology ; Adrenergic beta-Antagonists/pharmacology ; Amino Acid Sequence ; Animals ; Cell Line ; Cloning, Molecular ; Cricetinae ; Cyclic AMP/metabolism ; Humans ; Molecular Sequence Data ; Receptors, Adrenergic, beta/drug effects/genetics/*isolation & purification ; Sequence Homology, Nucleic Acid ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 42
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-08-11
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barinaga, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):590-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2669126" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; DNA/genetics ; Fertilization in Vitro ; Genetic Engineering/*methods ; History, 20th Century ; Male ; Mice ; Mice, Transgenic/*genetics ; Spermatozoa ; Transfection ; Zygote
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 43
    Publikationsdatum: 1989-03-03
    Beschreibung: Focal adhesion of leukocytes to the blood vessel lining is a key step in inflammation and certain vascular disease processes. Endothelial leukocyte adhesion molecule-1 (ELAM-1), a cell surface glycoprotein expressed by cytokine-activated endothelium, mediates the adhesion of blood neutrophils. A full-length complementary DNA (cDNA) for ELAM-1 has now been isolated by transient expression in COS cells. Cells transfected with the ELAM-1 clone express a surface structure recognized by two ELAM-1 specific monoclonal antibodies (H4/18 and H18/7) and support the adhesion of isolated human neutrophils and the promyelocytic cell line HL-60. Expression of ELAM-1 transcripts in cultured human endothelial cells is induced by cytokines, reaching a maximum at 2 to 4 hours and decaying by 24 hours; cell surface expression of ELAM-1 protein parallels that of the mRNA. The primary sequence of ELAM-1 predicts an amino-terminal lectin-like domain, an EGF domain, and six tandem repetitive motifs (about 60 amino acids each) related to those found in complement regulatory proteins. A similar domain structure is also found in the MEL-14 lymphocyte cell surface homing receptor, and in granule-membrane protein 140, a membrane glycoprotein of platelet and endothelial secretory granules that can be rapidly mobilized (less than 5 minutes) to the cell surface by thrombin and other stimuli. Thus, ELAM-1 may be a member of a nascent gene family of cell surface molecules involved in the regulation of inflammatory and immunological events at the interface of vessel wall and blood.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bevilacqua, M P -- Stengelin, S -- Gimbrone, M A Jr -- Seed, B -- P01 HL-36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1160-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466335" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Cell Adhesion ; DNA/genetics ; E-Selectin ; Endothelium, Vascular/metabolism ; Gene Expression Regulation ; Humans ; Immunoassay ; Interleukin-1/pharmacology ; *Membrane Glycoproteins ; Molecular Sequence Data ; Neutrophils/*physiology ; Nucleic Acid Hybridization ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Transcription, Genetic ; Transfection ; Tumor Cells, Cultured ; Tumor Necrosis Factor-alpha/pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 44
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1989-03-03
    Beschreibung: Decay accelerating factor (DAF) is anchored to the plasma membrane by a glycophospholipid (GPI) membrane anchor covalently attached to the COOH-terminus of the protein. A hydrophobic domain located at the COOH-terminus is required for anchor attachment; DAF molecules lacking this domain are secreted. Replacement of the COOH-terminal hydrophobic domain with a signal peptide that normally functions in membrane translocation, or with a random hydrophobic sequence, results in efficient and correct processing, producing GPI-anchored DAF on the cell surface. The structural requirements for GPI anchor attachment and for membrane translocation are therefore similar, presumably depending on overall hydrophobicity rather than specific sequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Caras, I W -- Weddell, G N -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1196-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466338" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Antigens, CD55 ; Blood Proteins ; *Carbohydrate Metabolism ; Cell Line ; Cell Membrane/*metabolism ; Complement Inactivator Proteins ; Ethanolamine ; Ethanolamines/metabolism ; Growth Hormone ; Humans ; Immunosorbent Techniques ; Membrane Proteins/genetics/*metabolism/secretion ; Mutation ; Phosphatidylinositol Diacylglycerol-Lyase ; Phosphatidylinositols/metabolism ; Phospholipids/*metabolism ; Phosphoric Diester Hydrolases/metabolism ; Protein Sorting Signals/*physiology ; Structure-Activity Relationship ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
Schließen ⊗
Diese Webseite nutzt Cookies und das Analyse-Tool Matomo. Weitere Informationen finden Sie hier...