ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

You have 0 saved results.
Mark results and click the "Add To Watchlist" link in order to add them to this list.
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (426)
  • Female  (357)
  • Mutation  (187)
  • *Biological Evolution
  • *Ecosystem
  • American Association for the Advancement of Science (AAAS)  (929)
  • American Meteorological Society
  • MDPI Publishing
  • 1985-1989  (929)
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (929)
  • American Meteorological Society
  • MDPI Publishing
  • Springer  (29)
  • Wiley-Blackwell  (1)
Years
Year
  • 1
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barinaga, M -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):448-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814475" target="_blank"〉PubMed〈/a〉
    Keywords: Breast Neoplasms/*therapy ; Female ; Humans ; *Psychotherapy, Group ; Survival Analysis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-30
    Description: Hibernating arctic ground squirrels, Spermophilus parryii, were able to adopt and spontaneously arouse from core body temperatures as low as -2.9 degrees C without freezing. Abdominal body temperatures of ground squirrels hibernating in outdoor burrows were recorded with temperature-sensitive radiotransmitter implants. Body temperatures and soil temperatures at hibernaculum depth reached average minima during February of -1.9 degrees and -6 degrees C, respectively. Laboratory-housed ground squirrels hibernating in ambient temperatures of -4.3 degrees C maintained above 0 degree C thoracic temperatures but decreased colonic temperatures to as low as -1.3 degrees C. Plasma sampled from animals with below 0 degree C body temperatures had normal solute concentrations and showed no evidence of containing antifreeze molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barnes, B M -- HD 23383/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1593-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Arctic Biology, University of Alaska Fairbanks, Fairbanks 99775-0180.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740905" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antifreeze Proteins ; Arctic Regions ; Arousal ; *Body Temperature ; Body Temperature Regulation ; Female ; *Freezing ; Glycoproteins/analysis ; *Hibernation ; Male ; Sciuridae/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: Although most animals reproduce sexually, a number of all-female groups exist. Triploid hybrid salamanders appear to maintain themselves by using a male's sperm to activate their eggs, after which the sperm nucleus is eliminated (gynogenesis). The incidence of sperm nuclear incorporation in eggs of these salamanders depends on temperature. Triploid offspring derived gynogenetically are more frequent at lower temperature, whereas tetraploid offspring derived sexually are far more frequent at higher temperatures. Temperature-dependent variability in sperm nuclear incorporation helps explain the variability in reproductive modes reported for hybrid salamanders.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bogart, J P -- Elinson, R P -- Licht, L E -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1032-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Zoology, College of Biological Science, University of Guelph, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587986" target="_blank"〉PubMed〈/a〉
    Keywords: Ambystoma/genetics/*physiology ; Animals ; Crosses, Genetic ; Female ; Karyotyping ; Larva ; Male ; *Polyploidy ; Sperm-Ovum Interactions ; Spermatozoa/*physiology ; Temperature
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: This article reviews some of the significant contributions of fetal research and fetal tissue research over the past 20 years. The benefits of fetal research include the development of vaccines, advances in prenatal diagnosis, detection of malformations, assessment of safe and effective medications, and the development of in utero surgical therapies. Fetal tissue research benefits vaccine development, assessment of risk factors and toxicity levels in drug production, development of cell lines, and provides a source of fetal cells for ongoing transplantation trials. Together, fetal research and fetal tissue research offer tremendous potential for the treatment of the fetus, neonate, and adult.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hansen, J T -- Sladek, J R Jr -- P01-NS24032/NS/NINDS NIH HHS/ -- P01-NS25778/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):775-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology and Anatomy, University of Rochester School of Medicine and Dentistry, NY 14642.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683082" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Line ; Congenital Abnormalities/diagnosis ; Female ; *Fetal Diseases ; *Fetal Research ; *Fetus/cytology/surgery ; Genetic Diseases, Inborn ; Humans ; Nontherapeutic Human Experimentation ; Pregnancy ; Prenatal Diagnosis ; *Research ; *Risk Assessment ; Therapeutic Human Experimentation ; Vaccines
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 1989-04-28
    Description: Transcriptional activation of the human interleukin-2 (IL-2) gene, like induction of the IL-2 receptor alpha (IL-2R alpha) gene and the type 1 human immunodeficiency virus (HIV-1), is shown to be modulated by a kappa B-like enhancer element. Mutation of a kappa B core sequence identified in the IL-2 promoter (-206 to -195) partially inhibits both mitogen- and HTLV-I Tax-mediated activation of this transcription unit and blocks the specific binding of two inducible cellular factors. These kappa B-specific proteins (80 to 90 and 50 to 55 kilodaltons) similarly interact with the functional kappa B enhancer present in the IL-2R alpha promoter. These data suggest that these kappa B-specific proteins have a role in the coordinate regulation of this growth factor-growth factor receptor gene system that controls T cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoyos, B -- Ballard, D W -- Bohnlein, E -- Siekevitz, M -- Greene, W C -- A127053-01/PHS HHS/ -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):457-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Medical Center, Department of Microbiology, New York, NY 10029.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497518" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/metabolism ; DNA-Binding Proteins/*metabolism ; *Enhancer Elements, Genetic ; *Gene Expression Regulation ; Genes, Viral ; HIV-1/genetics ; HTLV-I Antigens/pharmacology ; Humans ; Immunoglobulin kappa-Chains/*genetics ; Interleukin-2/*genetics ; Molecular Weight ; Mutation ; Phytohemagglutinins/pharmacology ; Plasmids ; Promoter Regions, Genetic ; RNA, Messenger/biosynthesis ; T-Lymphocytes/metabolism ; Tetradecanoylphorbol Acetate/pharmacology ; Trans-Activators ; Transcription Factors/pharmacology ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    Publication Date: 1989-03-31
    Description: To survive, primates must detect danger in time to activate appropriate defensive behaviors. In this study, the defensive behaviors of infant rhesus monkeys exposed to humans were characterized. It was observed that the direction of the human's gaze is a potent cue for the infant. Infants separated from their mothers were active and emitted frequent distress vocalizations. When a human entered the room but did not look at the infant, it became silent and froze in one position. If the human stared at the infant, it responded with aggressive barking. Alterations of the opiate system affected the frequency of the infant's distress calls without affecting barking and freezing, whereas benzodiazepine administration selectively reduced barking and freezing. This suggests that opiate and benzodiazepine systems regulate specific defensive behaviors in primates and that these systems work together to mediate behavioral responses important for survival.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kalin, N H -- Shelton, S E -- DK-35641/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1718-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, University of Wisconsin, Madison.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2564702" target="_blank"〉PubMed〈/a〉
    Keywords: Aggression/physiology ; Animals ; Behavior, Animal/drug effects/*physiology ; Benzodiazepines/physiology ; Diazepam/pharmacology ; Endorphins/antagonists & inhibitors/physiology ; *Fear ; Female ; Macaca/*physiology ; Macaca mulatta/*physiology ; Male ; Morphine/pharmacology ; Motion ; Motor Activity/drug effects/physiology ; Naloxone/pharmacology ; Neurotransmitter Agents/*physiology ; Vision, Ocular ; Vocalization, Animal/drug effects/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    Publication Date: 1989-02-17
    Description: Mouse 3T3 cell lines capable of constitutively synthesizing an RNA complementary to the messenger RNA encoding TIMP, tissue inhibitor of metalloproteinases, were constructed by transfection with appropriate plasmid constructs. Many of the lines were down-modulated for TIMP messenger RNA levels and secreted less TIMP into the culture medium. In comparison to noninvasive, nontumorigenic controls, these cells not only were invasive in a human amnion invasion assay, but also were tumorigenic and metastatic in athymic mice. These results indicate that TIMP suppresses oncogenicity, at least in immortal murine 3T3 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Khokha, R -- Waterhouse, P -- Yagel, S -- Lala, P K -- Overall, C M -- Norton, G -- Denhardt, D T -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):947-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Western Ontario, London, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2465572" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Cells, Cultured ; Enzyme Inhibitors/*genetics/metabolism ; Female ; Metalloendopeptidases/antagonists & inhibitors ; Mice ; Mice, Nude ; Neoplasm Metastasis ; Pituitary Neoplasms/genetics/pathology ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors/genetics ; Tissue Inhibitor of Metalloproteinases ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    Publication Date: 1989-08-25
    Description: Mice fed a chemically defined diet devoid of pyrroloquinoline quinone (PQQ) grew poorly, failed to reproduce, and became osteolathyritic. Moreover, severely affected mice had friable skin, skin collagen that was readily extractable into neutral salt solutions, and decreased lysyl oxidase. The identification of functional defects in connective tissue and the growth retardation associated with PQQ deprivation suggest that PQQ plays a fundamental role as a growth factor or vitamin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Killgore, J -- Smidt, C -- Duich, L -- Romero-Chapman, N -- Tinker, D -- Reiser, K -- Melko, M -- Hyde, D -- Rucker, R B -- AM-35747/AM/NIADDK NIH HHS/ -- HL-15965/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):850-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Nutrition, School of Agricultural and Environmental Sciences, University of California, Davis 95616.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549636" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Coenzymes/*physiology ; Collagen/metabolism ; Female ; Growth Substances/physiology ; Mice ; Nutritional Physiological Phenomena ; PQQ Cofactor ; Quinolones/deficiency/*physiology ; Skin/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koshland, D E Jr -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):981.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587989" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Legal ; Female ; Humans ; National Institutes of Health (U.S.)/*organization & administration ; Politics ; Pregnancy ; United States ; United States Dept. of Health and Human Services
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    Publication Date: 1989-04-07
    Description: Protein engineering and x-ray crystallography have been used to study the role of a surface loop that is present in pancreatic phospholipases but is absent in snake venom phospholipases. Removal of residues 62 to 66 from porcine pancreatic phospholipase A2 does not change the binding constant for micelles significantly, but it improves catalytic activity up to 16 times on micellar (zwitterionic) lecithin substrates. In contrast, the decrease in activity on negatively charged substrates is greater than fourfold. A crystallographic study of the mutant enzyme shows that the region of the deletion has a well-defined structure that differs from the structure of the wild-type enzyme. No structural changes in the active site of the enzyme were detected.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kuipers, O P -- Thunnissen, M M -- de Geus, P -- Dijkstra, B W -- Drenth, J -- Verheij, H M -- de Haas, G H -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):82-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704992" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Crystallography ; Enzyme Activation ; Kinetics ; Molecular Sequence Data ; Mutation ; Pancreas/enzymology ; Phospholipases/*metabolism ; Phospholipases A/genetics/*metabolism/physiology ; Phospholipases A2 ; *Protein Conformation ; Snake Venoms/analysis ; Structure-Activity Relationship ; Swine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: DNA mismatch correction is a strand-specific process involving recognition of noncomplementary Watson-Crick nucleotide pairs and participation of widely separated DNA sites. The Escherichia coli methyl-directed reaction has been reconstituted in a purified system consisting of MutH, MutL, and MutS proteins, DNA helicase II, single-strand DNA binding protein, DNA polymerase III holoenzyme, exonuclease I, DNA ligase, along with ATP (adenosine triphosphate), and the four deoxynucleoside triphosphates. This set of proteins can process seven of the eight base-base mismatches in a strand-specific reaction that is directed by the state of methylation of a single d(GATC) sequence located 1 kilobase from the mispair.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lahue, R S -- Au, K G -- Modrich, P -- F32 GM12684/GM/NIGMS NIH HHS/ -- GM23719/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):160-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2665076" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; *DNA Repair ; DNA, Bacterial/biosynthesis/*genetics ; Escherichia coli/*genetics ; Methylation ; Mutation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    Publication Date: 1989-08-18
    Description: CD4 is a cell surface glycoprotein that is thought to interact with nonpolymorphic determinants of class II major histocompatibility (MHC) molecules. CD4 is also the receptor for the human immunodeficiency virus (HIV), binding with high affinity to the HIV-1 envelope glycoprotein, gp120. Homolog-scanning mutagenesis was used to identify CD4 regions that are important in class II MHC binding and to determine whether the gp120 and class II MHC binding sites of CD4 are related. Class II MHC binding was abolished by mutations in each of the first three immunoglobulin-like domains of CD4. The gp120 binding could be abolished without affecting class II MHC binding and vice versa, although at least one mutation examined reduced both functions significantly. These findings indicate that, while there may be overlap between the gp120 and class II MHC binding sites of CD4, these sites are distinct and can be separated. Thus it should be possible to design CD4 analogs that can block HIV infectivity but intrinsically lack the ability to affect the normal immune response by binding to class II MHC molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lamarre, D -- Ashkenazi, A -- Fleury, S -- Smith, D H -- Sekaly, R P -- Capon, D J -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):743-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549633" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, Surface ; Binding Sites ; DNA, Recombinant ; HIV/*metabolism ; HIV Envelope Protein gp120 ; HLA-DP Antigens/immunology ; Histocompatibility Antigens Class II/*immunology ; Humans ; Hybridomas ; Mice ; Molecular Sequence Data ; Mutation ; Receptors, HIV ; Receptors, Virus/genetics/immunology/*metabolism ; Retroviridae Proteins/immunology/*metabolism ; Rosette Formation ; Structure-Activity Relationship ; T-Lymphocytes/immunology/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    Publication Date: 1989-06-09
    Description: Respondents in the 1988 General Social Survey (GSS) were asked to scan their acquaintance networks to identify all those who had been a victim of a homicide or had acquired immunodeficiency syndrome (AIDS). Estimates of the sex, race, age, and regional breakdowns for homicides in the last year and for people with AIDS were compared with official statistics. The GSS estimates for the distribution of homicide victims replicate the official statistics quite well. The GSS estimates for AIDS cases suggest that the data provided to the Centers for Disease Control may underestimate by a substantial margin the prevalence of AIDS in the white population of higher socioeconomic status, overstate the relative prevalence of the disease in the minority populations, underestimate the prevalence of the disease in the Midwest, and overstate it for the East.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Laumann, E O -- Gagnon, J H -- Michaels, S -- Michael, R T -- Coleman, J S -- N0I-HD-8-2907/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1186-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Sociology, University of Chicago, IL 60637.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543079" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*epidemiology ; Centers for Disease Control and Prevention (U.S.) ; Demography ; Female ; Humans ; Male ; Population Surveillance ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    Publication Date: 1989-05-26
    Description: Spondyloepiphyseal dysplasias (SED) are a heterogeneous group of inherited disorders characterized by disproportionate short stature and pleiotropic involvement of the skeletal and ocular systems. Evidence has suggested that SED may result from structural defects in type II collagen. To confirm the validity of this hypothesis, the structure of the "candidate" type II collagen gene (COL2A1) has been directly examined in a relatively large SED family. Coarse scanning of the gene by Southern blot hybridization identified an abnormal restriction pattern in one of the affected members of the kindred. Analysis of selected genomic fragments, amplified by the polymerase chain reaction, precisely localized the molecular defect and demonstrated that all affected family members carried the same heterozygous single-exon deletion. As a consequence of the mutation, nearly 90 percent of the assembled type II collagen homotrimers are expected to contain one or more procollagen subunits harboring an interstitial deletion of 36 amino acids in the triple helical domain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, B -- Vissing, H -- Ramirez, F -- Rogers, D -- Rimoin, D -- AR-38648/AR/NIAMS NIH HHS/ -- HD-22657/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 May 26;244(4907):978-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, State University of New York Health Science Center, Brooklyn 11203.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543071" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Child, Preschool ; Chromosome Deletion ; Collagen/*genetics ; DNA Restriction Enzymes ; DNA-Directed DNA Polymerase ; Exons ; Female ; Gene Amplification ; Humans ; Macromolecular Substances ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Osteochondrodysplasias/*genetics ; Pedigree ; Procollagen/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    Publication Date: 1989-01-27
    Description: Embryonal carcinoma (EC) cell lines are models for early cells in mouse embryogenesis. A 300-base pair fragment of the heavy chain enhancer was inactive in F9 EC cells, unlike in other nonlymphoid cells where it has significant activity. Alterations of the octamer motif increased enhancer activity. Nuclear extracts from F9 cells contained an octamer binding protein (NF-A3) that was unique to EC cells; the amount of NF-A3 decreased upon differentiation. It is proposed that NF-A3 represses specific regulatory sequences that contain the octamer motif. Thus, the same DNA sequence mediates either negative or positive transcriptional effects, depending on the cell type.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lenardo, M J -- Staudt, L -- Robbins, P -- Kuang, A -- Mulligan, R C -- Baltimore, D -- CA 01074/CA/NCI NIH HHS/ -- HD0063/HD/NICHD NIH HHS/ -- HL37569/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):544-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536195" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bucladesine/pharmacology ; Cell Differentiation ; DNA/metabolism ; Embryonal Carcinoma Stem Cells ; *Enhancer Elements, Genetic ; Immunoglobulin Heavy Chains/*genetics ; Macromolecular Substances ; Mice ; Mutation ; Neoplastic Stem Cells/*metabolism ; RNA, Messenger/biosynthesis ; Regulatory Sequences, Nucleic Acid ; Repressor Proteins/genetics ; Transcription, Genetic ; Transfection ; Tretinoin/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-31
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lewin, R -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1666-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928802" target="_blank"〉PubMed〈/a〉
    Keywords: Africa ; Animals ; *Biological Evolution ; Europe ; *Fossils ; Hominidae/*anatomy & histology ; Humans ; *Paleontology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-30
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lewin, R -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1544.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740901" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Biological Evolution ; Brain/*anatomy & histology ; Ecology ; Genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    Publication Date: 1989-08-04
    Description: Complementary DNA clones, encoding the LH-hCG (luteinizing hormone-human choriogonadotropic hormone) receptor were isolated by screening a lambda gt11 library with monoclonal antibodies. The primary structure of the protein was deduced from the DNA sequence analysis; the protein contains 696 amino acids with a putative signal peptide of 27 amino acids. Hydropathy analysis suggests the existence of seven transmembrane domains that show homology with the corresponding regions of other G protein-coupled receptors. Three other types of clones corresponding to shorter proteins were observed, in which the putative transmembrane domain was absent. These probably arose through alternative splicing. RNA blot analysis showed similar patterns in testis and ovary with a major RNA of 4700 nucleotides and several minor species. The messenger RNA was expressed in COS-7 cells, yielding a protein that bound hCG with the same affinity as the testicular receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loosfelt, H -- Misrahi, M -- Atger, M -- Salesse, R -- Vu Hai-Luu Thi, M T -- Jolivet, A -- Guiochon-Mantel, A -- Sar, S -- Jallal, B -- Garnier, J -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):525-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut National de la Sante et de la Recherche Medicale Unite 135, Hopital de Bicetre, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502844" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Membrane/*metabolism ; *Cloning, Molecular ; DNA/*genetics ; Female ; GTP-Binding Proteins/metabolism ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Ovary/analysis ; Protein Sorting Signals/genetics ; RNA, Messenger/analysis/genetics ; Receptors, LH/*genetics/metabolism ; Sequence Homology, Nucleic Acid ; Swine ; Testis/analysis ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-16
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1254, 1256.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734608" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*prevention & control ; Animals ; HIV Antibodies/*biosynthesis ; HIV-1/*immunology ; Humans ; Mutation ; Pan troglodytes ; Vaccines, Inactivated/immunology ; Viral Vaccines/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-09
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1140-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2567057" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Atrial Natriuretic Factor/*physiology ; Cyclic AMP/physiology ; Cyclic GMP/physiology ; Female ; Guanylate Cyclase/metabolism ; Male ; Receptors, Atrial Natriuretic Factor ; Receptors, Cell Surface/*physiology ; Sea Urchins ; Second Messenger Systems ; Sperm-Ovum Interactions
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-12
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 May 12;244(4905):654-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2566202" target="_blank"〉PubMed〈/a〉
    Keywords: Breast Neoplasms/*genetics/pathology ; Female ; *Gene Amplification ; Gene Expression Regulation ; Humans ; Lymph Nodes/pathology ; *Neoplasm Recurrence, Local ; Ovarian Neoplasms/*genetics ; Prognosis ; Proto-Oncogene Proteins/*genetics ; *Proto-Oncogenes ; Receptor, ErbB-2
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    Publication Date: 1989-12-08
    Description: The fragile X syndrome is the most common cause of familial mental retardation. Genetic counseling and gene isolation are hampered by a lack of DNA markers close to the disease locus. Two somatic cell hybrids that each contain a human X chromosome with a breakpoint close to the fragile X locus have been characterized. A new DNA marker (DXS296) lies between the chromosome breakpoints and is the closest marker to the fragile X locus yet reported. The Hunter syndrome gene, which causes iduronate sulfatase deficiency, is located at the X chromosome breakpoint that is distal to this new marker, thus localizing the Hunter gene distal to the fragile X locus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Suthers, G K -- Callen, D F -- Hyland, V J -- Kozman, H M -- Baker, E -- Eyre, H -- Harper, P S -- Roberts, S H -- Hors-Cayla, M C -- Davies, K E -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1298-300.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Histopathology, Adelaide Children's Hospital, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573953" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chromosome Mapping ; Female ; Fragile X Syndrome/*genetics ; Genetic Counseling ; *Genetic Linkage ; *Genetic Markers ; Genomic Library ; Humans ; Hybrid Cells ; Likelihood Functions ; Mice ; Mucopolysaccharidosis II/genetics ; Mutation ; Nucleic Acid Hybridization ; Polymorphism, Restriction Fragment Length ; Sex Chromosome Aberrations/*genetics ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    Publication Date: 1989-03-31
    Description: The tpa-1 gene mediates the action of tumor-promoting phorbol esters in the nematode Caenorhabditis elegans. A genomic fragment that constitutes a portion of the tpa-1 gene was cloned by Tc1 transposon tagging and was used as a probe to screen a nematode complementary DNA library. One of the isolated complementary DNA clones had a nucleotide sequence that predicts a polypeptide of 526 amino acids. The predicted amino acid sequence revealed that the predicted tpa-1 protein sequence is highly similar to protein kinase C molecules from various animals, including man.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tabuse, Y -- Nishiwaki, K -- Miwa, J -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1713-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Fundamental Research Laboratories, NEC Corporation, Kawasaki, Kanagawa, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2538925" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Caenorhabditis/*drug effects/genetics ; Cloning, Molecular ; Codon ; DNA/genetics ; DNA Restriction Enzymes ; Drug Resistance/genetics ; Genetic Markers ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Phenotype ; Phorbol Esters/*pharmacology ; Protein Kinase C/*genetics ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    Publication Date: 1989-10-27
    Description: Allele loss is a hallmark of chromosome regions harboring recessive oncogenes. Lung cancer frequently demonstrates loss of heterozygosity on 17p. Recent evidence suggests that the p53 gene located on 17p13 has many features of such an antioncogene. The p53 gene was frequently mutated or inactivated in all types of human lung cancer. The genetic abnormalities of p53 include gross changes such as homozygous deletions and abnormally sized messenger RNAs along with a variety of point or small mutations, which map to the p53 open reading frame and change amino acid sequence in a region highly conserved between mouse and man. In addition, very low or absent expression of p53 messenger RNA in lung cancer cell lines compared to normal lung was seen. These findings, coupled with the previous demonstration of 17p allele loss in lung cancer, strongly implicate p53 as an anti-oncogene whose disruption is involved in the pathogenesis of human lung cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, T -- Nau, M M -- Chiba, I -- Birrer, M J -- Rosenberg, R K -- Vinocour, M -- Levitt, M -- Pass, H -- Gazdar, A F -- Minna, J D -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):491-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉National Cancer Institute-Navy Medical Oncology Branch, Bethesda, MD 20814.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554494" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Carcinoid Tumor/genetics ; Carcinoma, Non-Small-Cell Lung/genetics ; Carcinoma, Small Cell/genetics ; Chromosomes, Human, Pair 17 ; DNA, Neoplasm/genetics ; Gene Amplification ; Humans ; Lung Neoplasms/*genetics ; Mutation ; Oncogene Proteins/*genetics ; Phosphoproteins/*genetics ; RNA, Messenger/genetics ; RNA, Neoplasm/genetics ; Ribonucleases ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    Publication Date: 1989-01-06
    Description: The temperature dependences of the reduction potentials (E degrees') of wild-type human myoglobin (Mb) and three site-directed mutants have been measured by the use of thin-layer spectroelectrochemistry. Residue Val68, which is in van der Waals contact with the heme in Mb, has been replaced by Glu, Asp, and Asn. The changes in E degrees' and the standard entropy (delta S degrees') and enthalpy (delta H degrees') of reduction in the mutant proteins were determined relative to values for wild type; the change in E degrees' at 25 degrees C was about -200 millivolts for the Glu and Asp mutants, and about -80 millivolts for the Asn mutant. At pH 7.0, reduction of Fe(III) to Fe(II) in the Glu and Asp mutants is accompanied by uptake of a proton by the protein. These studies demonstrate that Mb can tolerate substitution of a buried hydrophobic group by potentially charged and polar residues and that such amino acid replacements can lead to substantial changes in the redox thermodynamics of the protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Varadarajan, R -- Zewert, T E -- Gray, H B -- Boxer, S G -- DK 19038/DK/NIDDK NIH HHS/ -- GM 27738/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):69-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563171" target="_blank"〉PubMed〈/a〉
    Keywords: Asparagine ; Aspartic Acid ; Glutamates ; Glutamic Acid ; Heme/metabolism ; Humans ; Mutation ; Myoglobin/*metabolism ; Oxidation-Reduction ; Protein Conformation ; Recombinant Proteins/*metabolism ; Thermodynamics ; Valine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    Publication Date: 1989-11-10
    Description: A substitution mutation has been introduced into the c-abl locus of murine embryonic stem cells by homologous recombination between exogenously added DNA and the endogenous gene, and these cells have been used to generate chimeric mice. It is shown that the c-abl mutation was transmitted to progeny by several male chimeras. This work demonstrates the feasibility of germ-line transmission of a mutation introduced into a nonselectable autosomal gene by homologous recombination.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schwartzberg, P L -- Goff, S P -- Robertson, E J -- P01 CA 23767/CA/NCI NIH HHS/ -- R01 HD 25208/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):799-803.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, Columbia University, College of Physicians & Surgeons, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554496" target="_blank"〉PubMed〈/a〉
    Keywords: Abelson murine leukemia virus/*genetics ; Animals ; Blotting, Southern ; Cell Line ; Chimera ; Cloning, Molecular ; *DNA, Recombinant ; Female ; Leukemia Virus, Murine/*genetics ; Male ; Mice ; Mice, Inbred C57BL ; *Mutation ; Oncogenes/*physiology ; Retroviridae Proteins, Oncogenic/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cell Line ; Chloramphenicol O-Acetyltransferase/genetics ; Chromosome Deletion ; *Enhancer Elements, Genetic ; *Genes, Viral ; Hepatitis B virus/*genetics ; Liver/*metabolism ; Molecular Sequence Data ; Mutation ; *Promoter Regions, Genetic ; Simplexvirus/enzymology/genetics ; Thymidine Kinase/genetics ; Transcription, Genetic ; Transfection ; Viral Structural Proteins/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-04
    Description: The effects of MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), a neurotoxin that produces the symptoms of Parkinson's disease, can be fully prevented in experimental animals by inhibiting monoamine oxidase B. On the basis of this observation, a double-blind, placebo-controlled study in patients with early Parkinson's disease was initiated to determine whether deprenyl (a selective monoamine oxidase B inhibitor) would delay the need for L-dopa therapy by slowing the progression of the disease. Fifty-four patients were randomly assigned to deprenyl (10 mg/day) or placebo treatment groups and followed until L-dopa therapy was indicated or until the patient had been in the study for 3 years. Analysis of Kaplan-Meier survival curves for each group showed that deprenyl delayed the need for L-dopa therapy; the average time until L-dopa was needed was 312.1 days for patients in the placebo group and 548.9 days for patients in the deprenyl group. Disease progression, as monitored by five different assessment scales, was slowed (by 40 to 83% per year) in the deprenyl group compared to placebo. Therefore, early deprenyl therapy delays the requirement for antiparkinsonian medication, possibly by slowing progression of the disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tetrud, J W -- Langston, J W -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):519-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉California Parkinson's Foundation, San Jose 95128.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502843" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine ; Aged ; Clinical Trials as Topic ; Double-Blind Method ; Female ; Humans ; Levodopa/therapeutic use ; Male ; Middle Aged ; Monoamine Oxidase Inhibitors/*therapeutic use ; Parkinson Disease/*drug therapy/physiopathology ; Parkinson Disease, Secondary/chemically induced ; Phenethylamines/*therapeutic use ; Pyridines/adverse effects/antagonists & inhibitors ; Random Allocation ; Selegiline/adverse effects/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-15
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marshall, E -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1185.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781278" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Bone and Bones/*analysis/anatomy & histology ; Female ; *Forensic Medicine ; *Fossils ; Humans ; Infant ; Male ; *Paleontology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Guyer, R L -- Koshland, D E Jr -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1543-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688087" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Induced ; Cystic Fibrosis/genetics ; DNA/*genetics ; DNA-Directed DNA Polymerase ; Female ; *Genetic Techniques ; Humans ; Microscopy, Electron, Scanning ; Mifepristone ; Nucleic Acid Amplification Techniques ; Pregnancy ; Research/*trends
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-30
    Description: Theories for the evolution of brain weight in mammals suggest that closely related species have diverged largely as a result of selection for differences in body weight, but that differences among more distantly related species have arisen due to greater net directional selection on brain weight. This pattern of changing selection causes brain weight to evolve more slowly than body weight among closely related species, such as those in the same genus, than among more distantly related species, such as those from different families or orders; a phenomenon known as the "taxon-level effect." Thus, brain weight differs more for a given difference in body weight as the species compared are more distantly related. An alternative explanation for the taxon-level effect is proposed. Distantly related species are more likely to inhabit different ecological conditions than are more closely related species. Where the taxon-level effect occurs, brain weight appears to have evolved in response to the demands of these different ecological conditions. As a consequence, brain weight differs more among distantly related species, for any given difference in body weight, than among closely related species. This effect, rather than a progressive pattern of changing selection pressures, may account for the taxon-level effect in mammals.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pagel, M D -- Harvey, P H -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1589-93.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Zoology, University of Oxford, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740904" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Artiodactyla/anatomy & histology ; *Biological Evolution ; *Body Weight ; Brain/*anatomy & histology ; Carnivora/anatomy & histology ; Chiroptera/anatomy & histology ; Ecology ; Mammals/*anatomy & histology/classification ; Models, Biological ; Organ Size ; Primates/anatomy & histology ; Regression Analysis ; Rodentia/anatomy & histology ; Selection, Genetic ; Species Specificity ; Statistics as Topic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):885-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2919279" target="_blank"〉PubMed〈/a〉
    Keywords: *Educational Measurement ; Female ; Humans ; *Jurisprudence ; Male ; *Prejudice ; *School Admission Criteria ; Sex Factors ; United States ; *Universities
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    Publication Date: 1989-12-22
    Description: The pituitary hormone thyrotropin, or thyroid-stimulating hormone (TSH), is the main physiological agent that regulates the thyroid gland. The thyrotropin receptor (TSHR) was cloned by selective amplification with the polymerase chain reaction of DNA segments presenting sequence similarity with genes for G protein-coupled receptors. Out of 11 new putative receptor clones obtained from genomic DNA, one had sequence characteristics different from all the others. Although this clone did not hybridize to thyroid transcripts, screening of a dog thyroid complementary DNA (cDNA) library at moderate stringency identified a cDNA encoding a 4.9-kilobase thyroid-specific transcript. The polypeptide encoded by this thyroid-specific transcript consisted of a 398-amino acid residue amino-terminal segment, constituting a putative extracellular domain, connected to a 346-residue carboxyl-terminal domain that contained seven putative transmembrane segments. Expression of the cDNA conferred TSH responsiveness to Xenopus oocytes and Y1 cells and a TSH binding phenotype to COS cells. The TSHR and the receptor for luteinizing hormone-choriogonadotropin constitute a subfamily of G protein-coupled receptors with distinct sequence characteristics.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parmentier, M -- Libert, F -- Maenhaut, C -- Lefort, A -- Gerard, C -- Perret, J -- Van Sande, J -- Dumont, J E -- Vassart, G -- R01-DK21732/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1620-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556796" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Blotting, Northern ; Cell Line ; *Cloning, Molecular ; Cyclic AMP ; Dogs ; Female ; *Genes ; Molecular Sequence Data ; Oocytes/drug effects/metabolism ; Organ Specificity ; Polymerase Chain Reaction/methods ; RNA, Messenger/genetics ; Receptors, Thyrotropin/*genetics ; Thyrotropin/pharmacology ; Transcription, Genetic ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    Publication Date: 1989-10-27
    Description: Immunization with chemically detoxified pertussis toxin can prevent severe whooping cough with an efficacy similar to that of the cellular pertussis vaccine, which normally gives unwanted side effects. To avoid the reversion to toxicity and the loss of immunogenicity that may follow chemical treatment of pertussis toxin, inactive toxins were constructed by genetic manipulation. A number of genetically engineered alleles of the pertussis toxin genes, constructed by replacing either one or two key amino acids within the enzymatically active S1 subunit, were introduced into the chromosome of strains of Bordetella pertussis, B. parapertussis, and B. bronchiseptica. These strains produce mutant pertussis toxin molecules that are nontoxic and immunogenic and that protect mice from the intracerebral challenge with virulent Bordetella pertussis. Such molecules are ideal for the development of new and safer vaccines against whooping cough.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pizza, M -- Covacci, A -- Bartoloni, A -- Perugini, M -- Nencioni, L -- De Magistris, M T -- Villa, L -- Nucci, D -- Manetti, R -- Bugnoli, M -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):497-500.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Sclavo Research Center, Siena, Italy.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683073" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Female ; Genetic Techniques ; Mice ; Mice, Inbred BALB C ; Mutation ; *Pertussis Toxin ; Pertussis Vaccine/*toxicity ; Rabbits ; Vaccines, Synthetic/toxicity ; Virulence Factors, Bordetella/genetics/immunology/*toxicity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    Publication Date: 1989-02-03
    Description: The nitrogen regulatory (NtrC) protein of enteric bacteria, which binds to sites that have the properties of transcriptional enhancers, is known to activate transcription by a form of RNA polymerase that contains the NtrA protein (sigma 54) as sigma factor (referred to as sigma 54-holoenzyme). In the presence of adenosine triphosphate, the NtrC protein catalyzes isomerization of closed recognition complexes between sigma 54-holoenzyme and the glnA promoter to open complexes in which DNA in the region of the transcription start site is locally denatured. NtrC is not required subsequently for maintenance of open complexes or initiation of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Popham, D L -- Szeto, D -- Keener, J -- Kustu, S -- GM38361/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):629-35.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, Berkley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563595" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/analogs & derivatives/metabolism/pharmacology ; *Bacterial Proteins ; Base Sequence ; Binding Sites ; DNA, Bacterial/metabolism ; DNA-Binding Proteins/*metabolism ; DNA-Directed RNA Polymerases/metabolism ; Deoxyribonuclease I ; *Enhancer Elements, Genetic ; Glutamate-Ammonia Ligase/genetics ; Heparin/pharmacology ; Molecular Sequence Data ; Mutation ; PII Nitrogen Regulatory Proteins ; Phosphorylation ; Promoter Regions, Genetic ; Salmonella typhimurium/*genetics ; Sigma Factor/metabolism ; *Trans-Activators ; Transcription Factors ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-01
    Description: Four correlates of fitness were measured in three stocks of the endangered Sonoran topminnow, Poeciliopsis occidentalis, from Arizona. Survival, growth, early fecundity, and developmental stability were greatest in laboratory-reared fish from the most heterozygous natural population studied. Conversely, all four traits were poorest in fish from a population with no electrophoretically detectable genetic variation. These results emphasize the need for genetic as well as demographic information for the development of comprehensive species recovery programs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Quattro, J M -- Vrijenhoek, R C -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):976-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Theoretical and Applied Genetics, Cook College, Rutgers University, New Brunswick, NJ 08903.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772650" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arizona ; *Biological Evolution ; Cyprinodontiformes/*genetics ; Female ; Fertility ; Genetic Variation ; Male ; Poecilia/anatomy & histology/*genetics ; Species Specificity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    Publication Date: 1989-06-16
    Description: Genetic engineering of livestock is expected to have a major effect on the agricultural industry. However, accurate assessment of the consequences of transgene expression is impossible without multigenerational studies. A systematic study of the beneficial and adverse consequences of long-term elevations in the plasma levels of bovine growth hormone (bGH) was conducted on two lines of transgenic pigs. Two successive generations of pigs expressing the bGH gene showed significant improvements in both daily weight gain and feed efficiency and exhibited changes in carcass composition that included a marked reduction in subcutaneous fat. However, long-term elevation of bGH was generally detrimental to health: the pigs had a high incidence of gastric ulcers, arthritis, cardiomegaly, dermatitis, and renal disease. The ability to produce pigs exhibiting only the beneficial, growth-promoting effects of growth hormone by a transgenic approach may require better control of transgene expression, a different genetic background, or a modified husbandry regimen.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pursel, V G -- Pinkert, C A -- Miller, K F -- Bolt, D J -- Campbell, R G -- Palmiter, R D -- Brinster, R L -- Hammer, R E -- HD-09172/HD/NICHD NIH HHS/ -- HD-19018/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1281-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉U.S. Department of Agriculture, Beltsville, MD 20705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499927" target="_blank"〉PubMed〈/a〉
    Keywords: Agriculture ; Animals ; Animals, Domestic/*genetics/growth & development ; *Animals, Genetically Modified ; Body Weight ; Female ; *Genetic Engineering ; Growth Hormone/genetics ; Growth Hormone-Releasing Hormone/genetics ; Insulin-Like Growth Factor I/genetics ; Mice ; Organ Size ; Swine/genetics/growth & development ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    Publication Date: 1989-01-27
    Description: Techniques of gene amplification, molecular cloning, and sequence analysis were used to test for the presence of sequences related to human T-lymphotropic virus type I (HTLV-I) in peripheral blood mononuclear cells of six patients with multiple sclerosis (MS) and 20 normal individuals. HTLV-I sequences were detected in all six MS patients and in one individual from the control group by DNA blot analysis and molecular cloning of amplified DNAs. The viral sequence in MS patients were associated with adherent cell populations consisting predominantly of monocytes and macrophages. Molecular cloning and nucleotide sequence analysis indicated that these amplified viral sequences were related to the HTLV-I proviral genome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- Sandberg-Wollheim, M -- Mettus, R V -- Ray, P E -- DeFreitas, E -- Koprowski, H -- CA-10815/CA/NCI NIH HHS/ -- NS-11036/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):529-33.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536193" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Adult ; Base Sequence ; Child ; *Cloning, Molecular ; DNA Restriction Enzymes ; DNA, Viral/*genetics ; Female ; *Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Leukocytes, Mononuclear/analysis/microbiology ; Macrophages/analysis/microbiology ; Male ; Molecular Sequence Data ; Multiple Sclerosis/*microbiology ; Nucleic Acid Hybridization ; Oligonucleotide Probes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Expression of the c-myc oncogene is deregulated in a variety of malignancies. Rearrangement and mutation of the c-myc locus is a characteristic feature of human Burkitt's lymphoma. Whether deregulation is solely a result of mutation of c-myc or whether it is influenced by the transformed B cell context has not been determined. A translocated and mutated allele of c-myc was stably transfected into fibroblasts. The rearranged allele was expressed indistinguishably from a normal c-myc gene: it had serum-regulated expression, was transcribed with normal promoter preference, and was strongly attenuated. Thus mutations by themselves are insufficient to deregulate c-myc transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richman, A -- Hayday, A -- 40364/PHS HHS/ -- GM 07499/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):494-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Burkitt Lymphoma/genetics ; Cell Line ; Fibroblasts/metabolism ; Gene Expression Regulation, Neoplastic ; Humans ; Mutation ; Oncogenes/*genetics ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-myc ; *Transfection ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    Publication Date: 1989-03-10
    Description: An analysis of the aminoacylation kinetics of unmodified yeast tRNAPhe mutants revealed that five single-stranded nucleotides are important for its recognition by yeast phenylalanyl-tRNA synthetase, provided they were positioned correctly in a properly folded tRNA structure. When four other tRNAs were changed to have these five nucleotides, they became near-normal substrates for the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sampson, J R -- DiRenzo, A B -- Behlen, L S -- Uhlenbeck, O C -- GM 37552/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1363-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646717" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acyl-tRNA Synthetases/*metabolism ; Base Sequence ; Escherichia coli/genetics ; Models, Molecular ; Molecular Sequence Data ; Mutation ; Nucleic Acid Conformation ; Phenylalanine-tRNA Ligase/*metabolism ; Plants/genetics ; RNA, Transfer, Amino Acid-Specific/*genetics ; RNA, Transfer, Phe/*genetics/metabolism ; Schizosaccharomyces/genetics ; Transcription, Genetic ; Triticum/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: Tumor suppressor genes are wild-type alleles of genes that play regulatory roles in cell proliferation, differentiation, and other cellular and systemic processes. It is their loss or inactivation that is oncogenic. The first evidence of tumor suppressor genes appeared in the early 1970s, but only within the past few years has a wealth of new information illuminated the central importance of these genes. Two or more different suppressor genes may be inactivated in the same tumors, and the same suppressors may be inactive in different tumor types (for example, lung, breast, and colon). The suppressor genes already identified are involved in cell cycle control, signal transduction, angiogenesis, and development, indicating that they contribute to a broad array of normal and tumor-related functions. It is proposed that tumor suppressor genes provide a vast untapped resource for anticancer therapy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sager, R -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1406-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Cancer Genetics, Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2574499" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; Cell Differentiation ; Cell Division ; Cell Transformation, Neoplastic/genetics ; Chromosome Aberrations ; Cloning, Molecular ; Eye Neoplasms/genetics ; Heterozygote ; Humans ; Hybrid Cells ; Kidney Neoplasms/genetics ; Mutation ; Neoplasms/*genetics ; Oncogene Proteins/genetics ; Phosphoproteins/genetics ; Polymorphism, Restriction Fragment Length ; Retinoblastoma/genetics ; Suppression, Genetic/*genetics ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53 ; Wilms Tumor/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    Publication Date: 1989-08-11
    Description: The endogenous c-mos product, pp39mos, is required for progesterone-induced meiotic maturation in Xenopus oocytes. Treatment of oocytes with progesterone induced a rapid increase in pp39mos that preceded both the activation of maturation promoting factor (MPF) and germinal vesicle breakdown (GVBD). Microinjection of synthetic mos RNA into oocytes activated MPF and induced GVBD in the absence of progesterone. Thus, the mos proto-oncogene product may qualify as a candidate "initiator" protein of MPF and is at least one of the "triggers" for G2 to M transition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagata, N -- Daar, I -- Oskarsson, M -- Showalter, S D -- Vande Woude, G F -- N01-CO-74101/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):643-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉BRI-Basic Research Program, National Cancer Institute, Frederick Cancer Research Facility, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2474853" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cycloheximide/pharmacology ; Female ; Growth Substances/physiology ; Kinetics ; Maturation-Promoting Factor ; Meiosis/drug effects ; Microinjections ; Oocytes/*physiology ; Progesterone/pharmacology ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*physiology ; Proto-Oncogene Proteins c-mos ; RNA/genetics ; Transcription, Genetic ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    Publication Date: 1989-02-24
    Description: In Drosophila, five "terminal" polarity genes must be active in females in order for them to produce embryos with normal anterior and posterior ends. Hypoactivity mutations in one such gene, torso, result in the loss of the most posterior domain of fushi tarazu expression and the terminal cuticular structures. In contrast, a torso hyperactivity mutation causes the loss of central fushi tarazu expression and central cuticular structures. Cytoplasmic leakage, transplantation, and temperature-shift experiments suggest that the latter effect is caused by abnormal persistence of the torso product in the central region of the embryo during early development. Thus, the amount and timing of torso activity is key to distinguishing the central and terminal regions of the embryo. Mutations in the tailless terminal gene act as dominant maternal suppressors of the hyperactive torso allele, indicating that the torso product acts through, or in concert with, the tailless product.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Strecker, T R -- Halsell, S R -- Fisher, W W -- Lipshitz, H D -- GM07616/GM/NIGMS NIH HHS/ -- HD23099/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1062-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922596" target="_blank"〉PubMed〈/a〉
    Keywords: Abdomen ; Alleles ; Animals ; Cytoplasm/physiology ; Drosophila/anatomy & histology/embryology/*genetics ; Female ; Gene Expression Regulation ; Mutation ; Phenotype ; Suppression, Genetic ; Thorax
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, M -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):876-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814506" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cattle ; Female ; *Food Labeling ; *Growth Hormone ; *Milk ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: The proposal that the absorption maximum of the visual pigments is governed by interaction of the 11-cis-retinal chromophore with charged carboxylic acid side chains in the membrane-embedded regions of the proteins has been tested by mutating five Asp and Glu residues thought to be buried in rhodopsin. Changing Glu113 to Gln causes a dramatic shift in the absorption maximum from 500 nanometers to 380 nanometers, a decrease in the pKa (acidity constant) of the protonated Schiff base of the chromophore to about 6, and a greatly increased reactivity with hydroxylamine. Thus Glu113 appears to be the counterion to the protonated Schiff base. Wavelength modulation in visual pigments apparently is not governed by electrostatic interaction with carboxylate residues, other than the counterion.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zhukovsky, E A -- Oprian, D D -- 5T32 GM07596-11/GM/NIGMS NIH HHS/ -- EY07965/EY/NEI NIH HHS/ -- R01 EY007965/EY/NEI NIH HHS/ -- S07 RR07044/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):928-30.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Brandeis University, Waltham, MA 02254.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573154" target="_blank"〉PubMed〈/a〉
    Keywords: *Aspartic Acid ; Glutamates ; Glutamic Acid ; Hydrogen-Ion Concentration ; Hydroxylamine ; Hydroxylamines/pharmacology ; Models, Molecular ; Mutation ; Protein Conformation ; Retinal Pigments/*metabolism ; Retinaldehyde/*metabolism ; Retinoids/*metabolism ; Rhodopsin/genetics/*metabolism ; Schiff Bases ; Spectrophotometry
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fischer, R -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1536.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928786" target="_blank"〉PubMed〈/a〉
    Keywords: Body Composition ; *Energy Metabolism ; Female ; Humans ; Male ; *Sex Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 82
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-17
    Description: Changes in social behavior were a key aspect of human evolution, and yet it is notoriously difficult for paleobiologists to determine patterns of social evolution. By defining the limited number of distributional strategies available to members of each sex of any species and investigating the conditions under which they may occur and change, the social behavior of different hominid taxa may be reconstructed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foley, R A -- Lee, P C -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):901-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Cambridge, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2493158" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Behavior ; *Biological Evolution ; Female ; Haplorhini/genetics ; Hominidae/*genetics ; Humans ; Male ; Models, Genetic ; *Social Behavior
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 83
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Frisch, R E -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):432.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814472" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Animals ; Body Weight/*physiology ; Cricetinae ; Female ; Fertility/*physiology ; Humans ; Mesocricetus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 84
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 85
    Publication Date: 1989-10-27
    Description: Activation of protein kinase C is thought to require association of the kinase with the cell membrane. It has been assumed that cellular substrates for the kinase must likewise be associated with membranes, and previous studies with membrane-associated myristoylated proteins have supported this view. It is now shown that a mutation that prevents the normal amino-terminal myristoylation of a prominent cellular substrate of protein kinase C, and appears to prevent its membrane association, does not prevent the normal phosphorylation of this protein in intact cells in response to phorbol esters. Thus, membrane association may not be required in order for protein kinase C substrates to undergo phosphorylation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Graff, J M -- Gordon, J I -- Blackshear, P J -- 2T32-GM 07171/GM/NIGMS NIH HHS/ -- AI27179/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):503-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratories, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814478" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Chickens ; Enzyme Activation ; *Intracellular Signaling Peptides and Proteins ; Membrane Proteins/metabolism ; Mutation ; Myristic Acid ; Myristic Acids ; Phosphorylation ; Protein Kinase C/*metabolism ; Proteins/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 86
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 87
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):730-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2916120" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Induced/*psychology ; Behavioral Research ; Federal Government ; Female ; Humans ; *Pregnant Women
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 88
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 89
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-21
    Description: The majority of pheromones identified to date are insect pheromones, which are volatile in nature. Identification of nonvolatile pheromones have been relatively rare, especially in vertebrates. Male and female garter snakes use pheromones to mediate sexual behavior. The female sex attractiveness pheromone of the Canadian red-sided garter snake, Thamnophis sirtalis parietalis, consists of a novel series of nonvolatile saturated and monounsaturated long-chain methyl ketones, whereas the male sex recognition pheromone contains squalene. These compounds were isolated, identified, and partially synthesized, and field tests show them to be biologically active.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mason, R T -- Fales, H M -- Jones, T H -- Pannell, L K -- Chinn, J W -- Crews, D -- NICHHD 16687/HD/NICHD NIH HHS/ -- NIMH 00135/MH/NIMH NIH HHS/ -- NIMH 09310/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):290-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Chemistry, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749261" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chromatography, Ion Exchange ; Female ; Gas Chromatography-Mass Spectrometry ; Magnetic Resonance Spectroscopy ; Male ; Pheromones/*isolation & purification ; Sex Attractants/analysis/chemical synthesis/*isolation & purification ; *Sexual Behavior, Animal ; Snakes/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 90
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 91
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 92
    Publication Date: 1989-08-25
    Description: Cocaine abuse has reached epidemic proportions in the United States, and the search for an effective pharmacotherapy continues. Because primates self-administer most of the drugs abused by humans, they can be used to predict the abuse liability of new drugs and for preclinical evaluation of new pharmacotherapies for drug abuse treatment. Daily administration of buprenorphine (an opioid mixed agonist-antagonist) significantly suppressed cocaine self-administration by rhesus monkeys for 30 consecutive days. The effects of buprenorphine were dose-dependent. The suppression of cocaine self-administration by buprenorphine did not reflect a generalized suppression of behavior. These data suggest that buprenorphine would be a useful pharmacotherapy for treatment of cocaine abuse. Because buprenorphine is a safe and effective pharmacotherapy for heroin dependence, buprenorphine treatment may also attenuate dual abuse of cocaine and heroin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mello, N K -- Mendelson, J H -- Bree, M P -- Lukas, S E -- DA-00101/DA/NIDA NIH HHS/ -- DA-02519/DA/NIDA NIH HHS/ -- DA-04059/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):859-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Alcohol and Drug Abuse Research Center, Harvard Medical School, McLean Hospital, Belmont, MA 02178.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772637" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Buprenorphine/*pharmacology/therapeutic use ; Cocaine/*administration & dosage ; Dose-Response Relationship, Drug ; Female ; Macaca mulatta ; Male ; Self Administration ; Substance-Related Disorders/*drug therapy
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 93
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 94
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-26
    Description: To function effectively, individuals must voluntarily postpone immediate gratification and persist in goal-directed behavior for the sake of later outcomes. The present research program analyzed the nature of this type of future-oriented self-control and the psychological processes that underlie it. Enduring individual differences in self-control were found as early as the preschool years. Those 4-year-old children who delayed gratification longer in certain laboratory situations developed into more cognitively and socially competent adolescents, achieving higher scholastic performance and coping better with frustration and stress. Experiments in the same research program also identified specific cognitive and attentional processes that allow effective self-regulation early in the course of development. The experimental results, in turn, specified the particular types of preschool delay situations diagnostic for predicting aspects of cognitive and social competence later in life.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mischel, W -- Shoda, Y -- Rodriguez, M I -- New York, N.Y. -- Science. 1989 May 26;244(4907):933-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, Columbia University, New York 10027〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658056" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptation, Psychological ; Attention ; Child ; *Child Development ; Child, Preschool ; *Cognition ; Female ; *Frustration ; Humans ; *Individuality ; Male ; Reward ; Social Adjustment
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 95
    Publication Date: 1989-11-17
    Description: The zona pellucida surrounding mouse oocytes is an extracellular matrix composed of three sulfated glycoproteins, ZP1, ZP2, and ZP3. It has been demonstrated that a monoclonal antibody to ZP3 injected into female mice inhibits fertilization by binding to the zona pellucida and blocking sperm penetration. A complementary DNA encoding ZP3 was randomly cleaved and 200- to 1000-base pair fragments were cloned into the expression vector lambda gt11. This epitope library was screened with the aforementioned contraceptive antibody, and the positive clones were used to map the seven-amino acid epitope recognized by the antibody. Female mice were immunized with a synthetic peptide containing this B cell epitope coupled to a carrier protein to provide helper T cell epitopes. The resultant circulating antibodies to ZP3 bound to the zona pellucida of immunized animals and produced long-lasting contraception. The lack of ovarian histopathology or cellular cytotoxicity among the immunized animals may be because of the absence of zona pellucida T cell epitopes in this vaccine.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millar, S E -- Chamow, S M -- Baur, A W -- Oliver, C -- Robey, F -- Dean, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):935-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479101" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens/immunology ; Base Sequence ; Cloning, Molecular ; *Contraception ; *Contraception, Immunologic ; DNA/genetics ; *Egg Proteins ; Epitopes/analysis ; Female ; Glycoproteins/genetics/*immunology ; Male ; *Membrane Glycoproteins ; Mice ; Molecular Sequence Data ; Ovum/*physiology ; Protein Conformation ; RNA, Messenger/genetics ; *Receptors, Cell Surface ; *Vaccination ; Zona Pellucida/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 96
    Publication Date: 1989-06-23
    Description: The multiprotein-DNA complexes that participate in bacteriophage lambda site-specific recombination were used to study the combined effect of protein-induced bending and protein-mediated looping of DNA. The protein integrase (Int) is a monomer with two autonomous DNA binding domains of different sequence specificity. Stimulation of Int binding and cleavage at the low affinity core-type DNA sites required interactions with the high affinity arm-type sites and depended on simultaneous binding of the sequence-specific DNA bending protein IHF (integration host factor). The bivalent DNA binding protein is positioned at high affinity sites and directed, by a DNA bending protein, to interactions with distant lower affinity sites. Assembly of this complex is independent of protein-protein interactions.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1892171/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1892171/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Moitoso de Vargas, L -- Kim, S -- Landy, A -- AI-13544/AI/NIAID NIH HHS/ -- GM-33928/GM/NIGMS NIH HHS/ -- R01 GM033928/GM/NIGMS NIH HHS/ -- R01 GM062723/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1457-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology and Medicine, Brown University, Providence, RI 02912.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544029" target="_blank"〉PubMed〈/a〉
    Keywords: Bacterial Proteins/metabolism/*pharmacology ; Bacteriophage lambda/enzymology/*genetics ; Binding Sites ; DNA Nucleotidyltransferases/*metabolism ; DNA Restriction Enzymes ; DNA Transposable Elements ; DNA, Bacterial/genetics/*metabolism ; DNA, Viral/genetics/*metabolism ; DNA-Binding Proteins/metabolism ; Integrases ; Integration Host Factors ; Mutation ; Nucleic Acid Conformation/*drug effects ; Recombination, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 97
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 98
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-06
    Description: Elasmobranch fishes, the coelacanth, estivating lungfish, amphibians, and mammals synthesize urea by the ornithine-urea cycle; by comparison, urea synthetic activity is generally insignificant in teleostean fishes. It is reported here that isolated liver cells of two teleost toadfishes, Opsanus beta and Opsansus tau, synthesize urea by the ornithine-urea cycle at substantial rates. Because toadfish excrete ammonia, do not use urea as an osmolyte, and have substantial levels of urease in their digestive systems, urea may serve as a transient nitrogen store, forming the basis of a nitrogen conservation shuttle system between liver and gut as in ruminants and hibernators. Toadfish synthesize urea using enzymes and subcellular distributions similar to those of elasmobranchs: glutamine-dependent carbamoyl phosphate synthethase (CPS III) and mitochondrial arginase. In contrast, mammals have CPS I (ammonia-dependent) and cytosolic arginase. Data on CPS and arginases in other fishes, including lungfishes and the coelacanth, support the hypothesis that the ornithine-urea cycle, a monophyletic trait in the vertebrates, underwent two key changes before the evolution of the extant lungfishes: a switch from CPS III to CPS I and replacement of mitochondrial arginase by a cytosolic equivalent.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mommsen, T P -- Walsh, P J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):72-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology and Living Resources, Rosenstiel School of Marine and Atmospheric Sciences, University of Miami, FL 33149.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563172" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arginase/metabolism ; *Biological Evolution ; Carbamoyl-Phosphate Synthase (Ammonia)/metabolism ; Carbamoyl-Phosphate Synthase (Glutamine-Hydrolyzing)/metabolism ; Fishes/*metabolism ; Glutamate-Ammonia Ligase/metabolism ; Liver/metabolism ; Species Specificity ; Urea/*biosynthesis ; Vertebrates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 99
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 100
    Publication Date: 1989-05-12
    Description: Methotrexate coupled to maleylated bovine serum albumin was taken up efficiently through the "scavenger" receptors present on macrophages and led to selective killing of intracellular Leishmania mexicana amazonensis amastigotes in cultured hamster peritoneal macrophages. The drug conjugate was nearly 100 times as effective as free methotrexate in eliminating the intracellular parasites. Furthermore, in a model of experimental cutaneous leishmaniasis in hamsters, the drug conjugate brought about more than 90% reduction in the size of footpad lesions within 11 days. In contrast, the free drug at a similar concentration did not significantly affect lesion size. These studies demonstrate the potential of receptor-mediated drug delivery in the therapy of macrophage-associated diseases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mukhopadhyay, A -- Chaudhuri, G -- Arora, S K -- Sehgal, S -- Basu, S K -- New York, N.Y. -- Science. 1989 May 12;244(4905):705-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Microbial Technology, Chandigarh, India.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2717947" target="_blank"〉PubMed〈/a〉
    Keywords: Albumins/*administration & dosage/metabolism ; Animals ; Cells, Cultured ; Cricetinae ; Female ; Kinetics ; Leishmania mexicana/*drug effects ; Leishmaniasis/*drug therapy ; Macrophages/metabolism/*parasitology ; Male ; *Membrane Proteins ; Mesocricetus ; Methotrexate/*administration & dosage/pharmacology/therapeutic use ; *Receptors, Immunologic/metabolism ; *Receptors, Lipoprotein ; Receptors, Scavenger ; Scavenger Receptors, Class B ; Serum Albumin, Bovine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...