ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Molecular Sequence Data  (316)
  • American Association for the Advancement of Science (AAAS)  (316)
  • American Chemical Society
  • Nature Publishing Group
  • 2015-2019  (64)
  • 1985-1989  (252)
  • 1930-1934
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (316)
  • American Chemical Society
  • Nature Publishing Group
  • Nature Publishing Group (NPG)  (51)
Years
Year
  • 1
    Publication Date: 1988-04-22
    Description: In the parasitic wasp, Nasonia vitripennis, males are haploid and usually develop from unfertilized eggs, whereas females are diploid and develop from fertilized eggs. Some individuals in this species carry a genetic element, termed psr (paternal sex ratio), which is transmitted through sperm and causes condensation and subsequent loss of paternal chromosomes in fertilized eggs, thus converting diploid females into haploid males. In this report the psr trait was shown to be caused by a supernumerary chromosome. This B chromosome contains at least three repetitive DNA sequences that do not cross-hybridize to each other or to the host genome. The psr chromosome apparently produces a trans-acting product responsible for condensation of the paternal chromosomes, but is itself insensitive to the effect. Because the psr chromosome enhances its transmission by eliminating the rest of the genome, it can be considered the most "selfish" genetic element yet described.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nur, U -- Werren, J H -- Eickbush, D G -- Burke, W D -- Eickbush, T H -- GM31867/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Apr 22;240(4851):512-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, University of Rochester, NY 14627.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3358129" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Chromosomes/*physiology ; Cloning, Molecular ; DNA, Satellite ; Diploidy ; Haploidy ; Hymenoptera/*genetics ; Molecular Sequence Data ; Repetitive Sequences, Nucleic Acid ; Sex Determination Analysis ; *Sex Ratio ; Wasps/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    Publication Date: 1988-07-15
    Description: Odorant-binding protein (OBP) is found in nasal epithelium, and it selectively binds odorants. Three complementary DNAs encoding rat odorant-binding protein have now been cloned and sequenced. One clone contains an open reading frame predicted to encode an 18,091-dalton protein. RNA blot analysis confirms the localization of OBP messenger RNA in the nasal epithelium. This OBP has 33 percent amino acid identity to alpha 2-microglobulin, a secreted plasma protein. Other members of an alpha 2-microglobulin superfamily bind and transport hydrophobic ligands. Thus, OBP probably binds and carries odorants within the nasal epithelium to putative olfactory receptors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pevsner, J -- Reed, R R -- Feinstein, P G -- Snyder, S H -- DA-00074/DA/NIDA NIH HHS/ -- GM-07626/GM/NIGMS NIH HHS/ -- P01 CA16519-13/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 15;241(4863):336-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388043" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Carrier Proteins/*genetics ; Cloning, Molecular ; Ligands ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Nasal Mucosa/*physiology ; Rats ; *Receptors, Odorant ; Smell/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-06-17
    Description: The alpha helix, first proposed by Pauling and co-workers, is a hallmark of protein structure, and much effort has been directed toward understanding which sequences can form helices. The helix hypothesis, introduced here, provides a tentative answer to this question. The hypothesis states that a necessary condition for helix formation is the presence of residues flanking the helix termini whose side chains can form hydrogen bonds with the initial four-helix greater than N-H groups and final four-helix greater than C-O groups; these eight groups would otherwise lack intrahelical partners. This simple hypothesis implies the existence of a stereochemical code in which certain sequences have the hydrogen-bonding capacity to function as helix boundaries and thereby enable the helix to form autonomously. The three-dimensional structure of a protein is a consequence of the genetic code, but the rules relating sequence to structure are still unknown. The ensuing analysis supports the idea that a stereochemical code for the alpha helix resides in its boundary residues.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Presta, L G -- Rose, G D -- AG 06084/AG/NIA NIH HHS/ -- GM 29458/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Jun 17;240(4859):1632-41.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Chemistry, Hershey Medical Center, Pennsylvania State University, Hershey 17033.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2837824" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Carboxypeptidases ; Carboxypeptidases A ; Cytochrome c Group ; Flavodoxin ; Humans ; Hydrogen Bonding ; Models, Chemical ; Molecular Sequence Data ; Muramidase ; Myoglobin ; Pancreatic Polypeptide ; Parvalbumins ; Plastocyanin ; *Protein Conformation ; Ribonucleases ; Scorpion Venoms ; Tetrahydrofolate Dehydrogenase ; Triose-Phosphate Isomerase ; Trypsin Inhibitors ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-08-19
    Description: The question of how the primary amino acid sequence of a protein determines its three-dimensional structure is still unanswered. One approach to this problem involves the de novo design of model peptides and proteins that should adopt desired three-dimensional structures. A systematic approach was aimed at the design of a four-helix bundle protein. The gene encoding the designed protein was synthesized and the protein was expressed in Escherichia coli and purified to homogeneity. The protein was shown to be monomeric, highly helical, and very stable to denaturation by guanidine hydrochloride (GuHCl). Thus a globular protein has been designed that is capable of adopting a stable, folded structure in aqueous solution.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Regan, L -- DeGrado, W F -- New York, N.Y. -- Science. 1988 Aug 19;241(4868):976-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉E. I. du Pont de Nemours & Company, Central Research & Development Department, Wilmington, DE 19898.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3043666" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Chemical Phenomena ; Chemistry ; Chromatography, Gel ; Escherichia coli/genetics ; Molecular Sequence Data ; Plasmids ; *Protein Conformation ; *Proteins/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    Publication Date: 1988-02-26
    Description: The inheritance of particular alleles of major histocompatibility complex class II genes increases the risk for various human autoimmune diseases; however, only a small percentage of individuals having an allele associated with susceptibility develop disease. The identification of allelic variants more precisely correlated with disease susceptibility would greatly facilitate clinical screening and diagnosis. Oligonucleotide-primed gene amplification in vitro was used to determine the nucleotide sequence of a class II variant found almost exclusively in patients with the autoimmune skin disease pemphigus vulgaris. In addition to clinical implications, the disease-restricted distribution of this variant should provide insight into the molecular mechanisms underlying associations between diseases and HLA-class II genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sinha, A A -- Brautbar, C -- Szafer, F -- Friedmann, A -- Tzfoni, E -- Todd, J A -- Steinman, L -- McDevitt, H O -- New York, N.Y. -- Science. 1988 Feb 26;239(4843):1026-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical Microbiology, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2894075" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Autoimmune Diseases/*genetics/immunology ; Base Sequence ; DNA/genetics ; Gene Amplification ; Genetic Variation ; HLA-D Antigens/*genetics ; HLA-DQ Antigens/*genetics/immunology ; HLA-DR Antigens/immunology ; Humans ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Pemphigus/*genetics/immunology ; Polymorphism, Restriction Fragment Length
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    Publication Date: 1988-07-01
    Description: A method of combinatorial cassette mutagenesis was designed to readily determine the informational content of individual residues in protein sequences. The technique consists of simultaneously randomizing two or three positions by oligonucleotide cassette mutagenesis, selecting for functional protein, and then sequencing to determine the spectrum of allowable substitutions at each position. Repeated application of this method to the dimer interface of the DNA-binding domain of lambda repressor reveals that the number and type of substitutions allowed at each position are extremely variable. At some positions only one or two residues are functionally acceptable; at other positions a wide range of residues and residue types are tolerated. The number of substitutions allowed at each position roughly correlates with the solvent accessibility of the wild-type side chain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reidhaar-Olson, J F -- Sauer, R T -- AI-15706/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1988 Jul 1;241(4861):53-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Massachusetts Institute of Technology, Cambridge 02139.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3388019" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Binding Sites ; Codon ; DNA/genetics/metabolism ; *DNA-Binding Proteins ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Plasmids ; Protein Conformation ; Repressor Proteins/*genetics ; Structure-Activity Relationship ; Transcription Factors/*genetics ; Viral Proteins ; Viral Regulatory and Accessory Proteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 1988-08-05
    Description: The human pS2 gene is specifically expressed under estrogen transcriptional control in a subclass of estrogen receptor-containing human breast cancer cells. The pS2 gene encodes an 84-amino acid protein that is secreted after signal peptide cleavage. The distribution of pS2 protein in normal human tissues was studied with antibodies to pS2; pS2 was specifically expressed and secreted by mucosa cells of the normal stomach antrum and body of both female and male individuals. Moreover, no estrogen receptor could be detected in these cells, indicating that pS2 gene expression is estrogen-independent in the stomach. The function of the pS2 protein in the gastrointestinal tract is unknown. However, the pS2 protein is similar in sequence to a porcine pancreatic protein that has been shown to inhibit gastrointestinal motility and gastric secretion.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rio, M C -- Bellocq, J P -- Daniel, J Y -- Tomasetto, C -- Lathe, R -- Chenard, M P -- Batzenschlager, A -- Chambon, P -- New York, N.Y. -- Science. 1988 Aug 5;241(4866):705-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉CNRS et U. 184 de l'INSERM, Institut de Chimie Biologique, Faculte de Medecine, Strasbourg, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3041593" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Antibodies, Monoclonal ; Breast Neoplasms/*metabolism ; Estrogens/pharmacology ; Exons ; Female ; Gastric Mucosa/*metabolism ; *Gene Expression Regulation ; Histocytochemistry ; Humans ; Immunoenzyme Techniques ; Male ; Molecular Sequence Data ; Neoplasm Proteins/*biosynthesis/genetics/secretion ; *Proteins ; RNA, Messenger/metabolism ; Receptors, Estrogen/metabolism ; Sequence Homology, Nucleic Acid ; Tissue Distribution ; Tumor Cells, Cultured ; Tumor Suppressor Proteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-11-18
    Description: A rat kidney messenger RNA that induces a slowly activating, voltage-dependent potassium current on its expression in Xenopus oocytes was identified by combining molecular cloning with an electrophysiological assay. The cloned complementary DNA encodes a novel membrane protein that consists of 130 amino acids with a single putative transmembrane domain. This protein differs from the known ion channel proteins but is involved in the induction of selective permeation of potassium ions by membrane depolarization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takumi, T -- Ohkubo, H -- Nakanishi, S -- New York, N.Y. -- Science. 1988 Nov 18;242(4881):1042-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Immunology, Kyoto University Faculty of Medicine, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3194754" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cloning, Molecular ; DNA/genetics ; Electric Conductivity ; Membrane Potentials ; Membrane Proteins/*genetics ; Molecular Sequence Data ; Molecular Weight ; Potassium Channels/*physiology ; Rats ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    Publication Date: 1988-09-09
    Description: Most T lymphocytes express an antigen-specific receptor composed of two subunits, alpha and beta, each of which can exhibit structural variability. A complex selection process operates on T cells during development in the thymus such that cells expressing only particular alpha beta-receptors migrate to the periphery. The alpha-chain repertoire was dissected at different stages of the selection process by using the polymerase chain reaction (PCR) technique to amplify only those transcripts of a particular variable region gene (V58). Sequences from these V58 cDNAs reveal the predominant expression of four joining (J) segments by T cells in the adult thymus, suggesting that molecular or cellular processes select particular V alpha J alpha combinations during development. T cells expressing one of these V58J alpha chains appear to have been negatively selected at a later stage, since these transcripts were present in the spleen at approximately one-tenth the level in the thymus. Results also indicate that residues present at the V alpha J alpha junction may be important in an early selection process.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roth, M E -- Lacy, M J -- McNeil, L K -- Kranz, D M -- AI24635/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1354-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Illinois, Urbana 61801.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2970673" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Genes ; *Major Histocompatibility Complex ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Receptors, Antigen, T-Cell/*genetics ; Receptors, Antigen, T-Cell, alpha-beta ; Recombination, Genetic ; Spleen/physiology ; T-Lymphocytes/*physiology ; Thymus Gland/physiology ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    Publication Date: 1988-05-20
    Description: Class II major histocompatibility (MHC) molecules have an immunoregulatory role. These cell-surface glycoproteins present fragments of protein antigens (or peptides) to thymus-derived lymphocytes (T cells). Nucleotide sequence polymorphism in the genes that encode the class II MHC products determines the specificity of the immune response and is correlated with the development of autoimmune diseases. This study identifies certain class II polymorphic amino acid residues that are strongly associated with susceptibility to insulin-dependent diabetes mellitus, rheumatoid arthritis, and pemphigus vulgaris. These findings implicate particular class II MHC isotypes in susceptibility to each disease and suggest new prophylactic and therapeutic strategies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Todd, J A -- Acha-Orbea, H -- Bell, J I -- Chao, N -- Fronek, Z -- Jacob, C O -- McDermott, M -- Sinha, A A -- Timmerman, L -- Steinman, L -- New York, N.Y. -- Science. 1988 May 20;240(4855):1003-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical Microbiology, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3368786" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Arthritis, Rheumatoid/immunology ; Autoantibodies/*genetics ; Autoimmune Diseases/*genetics ; Diabetes Mellitus, Type 1/immunology ; HLA-D Antigens/*genetics ; Humans ; Major Histocompatibility Complex ; Molecular Sequence Data ; Pemphigus/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    Publication Date: 1988-09-09
    Description: Transcription of protein-encoding genes by human RNA polymerase II requires multiple ancillary proteins (transcription factors). Interactions between these proteins and the promoter DNA of a viral class II gene (the major late transcription unit of adenovirus) were investigated by enzymatic and chemical footprinting. The experiments indicated that the assembly of functionally active RNA polymerase II-containing transcription preinitiation complexes requires a complete set of transcription factors, and that both specific protein-DNA and protein-protein interactions are involved. This allows individual steps along the transcription reaction pathway to be tested directly, thus providing a basis for understanding basic transcription initiation mechanisms as well as the regulatory processes that act on them.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Van Dyke, M W -- Roeder, R G -- Sawadogo, M -- CA 42567/CA/NCI NIH HHS/ -- GM 38212/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1335-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Biochemistry and Molecular Biology, Rockefeller University, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3413495" target="_blank"〉PubMed〈/a〉
    Keywords: Adenoviruses, Human/genetics ; Base Sequence ; DNA-Binding Proteins/physiology ; Deoxyribonucleases/metabolism ; Macromolecular Substances ; Molecular Sequence Data ; Nuclear Proteins/physiology ; *Promoter Regions, Genetic ; RNA Polymerase II/*metabolism ; *Regulatory Sequences, Nucleic Acid ; Transcription Factors/*physiology ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    Publication Date: 1988-09-23
    Description: Antibodies directed against a conserved intracellular segment of the sodium channel alpha subunit slow the inactivation of sodium channels in rat muscle cells. Of four site-directed antibodies tested, only antibodies against the short intracellular segment between homologous transmembrane domains III and IV slowed inactivation, and their effects were blocked by the corresponding peptide antigen. No effects on the voltage dependence of sodium channel activation or of steady-state inactivation were observed, but the rate of onset of the antibody effect and the extent of slowing of inactivation were voltage-dependent. Antibody binding was more rapid at negative potentials, at which sodium channels are not inactivated; antibody-induced slowing of inactivation was greater during depolarizations to more positive membrane potentials. The peptide segment recognized by this antibody appears to participate directly in rapid sodium channel inactivation during large depolarizations and to undergo a conformational change that reduces its accessibility to antibodies as the channel inactivates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Vassilev, P M -- Scheuer, T -- Catterall, W A -- NS 15751/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 23;241(4873):1658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Washington, School of Medicine, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2458625" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies ; Cytoplasm/analysis ; In Vitro Techniques ; Ion Channels/*metabolism ; Membrane Potentials ; Molecular Sequence Data ; Peptides/*metabolism ; Rats ; Sodium/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-03-25
    Description: The production of therapeutic human monoclonal antibodies by hybridoma technology has proved difficult, and this has prompted the "humanizing" of mouse monoclonal antibodies by recombinant DNA techniques. It was shown previously that the binding site for a small hapten could be grafted from the heavy-chain variable domain of a mouse antibody to that of a human myeloma protein by transplanting the hypervariable loops. It is now shown that a large binding site for a protein antigen (lysozyme) can also be transplanted from mouse to human heavy chain. The success of such constructions may be facilitated by an induced-fit mechanism.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Verhoeyen, M -- Milstein, C -- Winter, G -- New York, N.Y. -- Science. 1988 Mar 25;239(4847):1534-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Medical Research Council Laboratory of Molecular Biology, Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2451287" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Antibodies, Monoclonal/genetics/immunology ; Base Sequence ; Binding Sites, Antibody ; Binding, Competitive ; Cloning, Molecular ; DNA, Recombinant ; Epitopes/immunology ; Humans ; Immunoglobulin G/genetics/immunology ; Immunoglobulin Variable Region/genetics ; Mice ; Molecular Sequence Data ; Muramidase/*immunology ; Plasmids ; Recombinant Proteins ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    Publication Date: 1988-12-23
    Description: The ras p21 GTPase-activating protein (GAP) was purified from human placental tissue. Internal amino acid sequence was obtained from this 120,000-dalton protein and, by means of this sequence, two types of complementary DNA clones were isolated and characterized. One type encoded GAP with a predicted molecular mass of 116,000 daltons and 96% identity with bovine GAP. The messenger RNA of this GAP was detected in human lung, brain, liver, leukocytes, and placenta. The second type appeared to be generated by a differential splicing mechanism and encoded a novel form of GAP with a predicted molecular mass of 100,400 daltons. This protein lacks the hydrophobic amino terminus characteristic of the larger species, but retains GAP activity. The messenger RNA of this type was abundantly expressed in placenta and in several human cell lines, but not in adult tissues.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Trahey, M -- Wong, G -- Halenbeck, R -- Rubinfeld, B -- Martin, G A -- Ladner, M -- Long, C M -- Crosier, W J -- Watt, K -- Koths, K -- New York, N.Y. -- Science. 1988 Dec 23;242(4886):1697-700.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Cetus Corp., Emeryville, CA 94608.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201259" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Brain Chemistry ; *Cloning, Molecular ; DNA/*genetics/isolation & purification ; Female ; GTPase-Activating Proteins ; Gene Expression Regulation ; Humans ; Leukocytes/analysis ; Liver/analysis ; Lung/analysis ; Molecular Sequence Data ; Molecular Weight ; Nucleic Acid Hybridization ; Oligonucleotide Probes ; Placenta/*analysis ; Pregnancy ; Proteins/*genetics/isolation & purification ; RNA, Messenger/analysis/genetics ; Sequence Homology, Nucleic Acid ; ras GTPase-Activating Proteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    Publication Date: 1988-04-15
    Description: A new type of agonist-binding subunit of rat neuronal nicotinic acetylcholine receptors (nAChRs) was identified. Rat genomic DNA and complementary DNA encoding this subunit (alpha 2) were cloned and analyzed. Complementary DNA expression studies in Xenopus oocytes revealed that the injection of messenger RNAs (mRNAs) for alpha 2 and beta 2 (a neuronal nAChR subunit) led to the generation of a functional nAChR. In contrast to the other known neuronal nAChRs, the receptor produced by the injection of alpha 2 and beta 2 mRNAs was resistant to the alpha-neurotoxin Bgt3.1. In situ hybridization histochemistry showed that alpha 2 mRNA was expressed in a small number of regions, in contrast to the wide distribution of the other known agonist-binding subunits (alpha 3 and alpha 4) mRNAs. These results demonstrate that the alpha 2 subunit differs from other known agonist-binding alpha-subunits of nAChRs in its distribution in the brain and in its pharmacology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wada, K -- Ballivet, M -- Boulter, J -- Connolly, J -- Wada, E -- Deneris, E S -- Swanson, L W -- Heinemann, S -- Patrick, J -- New York, N.Y. -- Science. 1988 Apr 15;240(4850):330-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Salk Institute for Biological Studies, San Diego, CA 92138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2832952" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Brain/*metabolism ; DNA Restriction Enzymes ; Female ; *Genes ; Molecular Sequence Data ; Neurons/metabolism ; Nucleotide Mapping ; Oocytes/metabolism ; Rats ; Receptors, Nicotinic/*genetics/metabolism ; Transcription, Genetic ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    Publication Date: 1988-04-29
    Description: Zeins, the storage proteins of maize, are totally lacking in the essential amino acids lysine and tryptophan. Lysine codons and lysine- and tryptophan-encoding oligonucleotides were introduced at several positions into a 19-kilodalton zein complementary DNA by oligonucleotide-mediated mutagenesis. A 450-base pair open reading frame from a simian virus 40 (SV40) coat protein was also engineered into the zein coding region. Messenger RNAs for the modified zeins were synthesized in vitro with an SP6 RNA polymerase system and injected into Xenopus laevis oocytes. The modifications did not affect the translation, signal peptide cleavage, or stability of the zeins. The ability of the modified zeins to assemble into structures similar to maize protein bodies was assayed by two criteria: assembly into membrane-bound vesicles resistant to exogenously added protease, and ability to self-aggregate into dense structures. All of the modified zeins were membrane-bound; only the one containing a 17-kilodalton SV40 protein fragment was unable to aggregate. These findings suggest that it may be possible to create high-lysine corn by genetic engineering.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wallace, J C -- Galili, G -- Kawata, E E -- Cuellar, R E -- Shotwell, M A -- Larkins, B A -- New York, N.Y. -- Science. 1988 Apr 29;240(4852):662-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47907.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2834822" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cell Membrane/metabolism ; DNA/genetics ; DNA, Recombinant ; Female ; Genetic Engineering ; *Lysine/genetics ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Oocytes/*metabolism ; Peptide Hydrolases/metabolism ; RNA, Messenger/genetics ; Simian virus 40/genetics ; Xenopus laevis ; Zea mays ; Zein/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1988-08-05
    Description: Although the proteinase inhibitor alpha-2-antiplasmin (alpha 2AP) is known to control the activity of plasmin through rapid formation of stable complexes, it also efficiently inactivates chymotrypsin. These interactions are shown to occur at adjacent, overlapping sites so that plasmin attacks the inhibitor at an Arg364-Met365 peptide bond, while chymotrypsin interacts at a Met365-Ser366 sequence one residue downstream. Thus, a naturally occurring plasma serine proteinase inhibitor can have multiple specificities through interactions at adjacent sites. It also illustrates the potential flexibility of the reactive site loop in this class of inhibitors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Potempa, J -- Shieh, B H -- Travis, J -- New York, N.Y. -- Science. 1988 Aug 5;241(4866):699-700.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Molecular Biology, Jagiellonian University, Cracow, Poland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2456616" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Binding Sites ; Carboxypeptidase B ; Carboxypeptidases/metabolism ; Carboxypeptidases A ; Chromatography, Gel ; Chromatography, High Pressure Liquid ; Chymotrypsin/antagonists & inhibitors/metabolism ; Electrophoresis, Polyacrylamide Gel ; Humans ; Molecular Sequence Data ; Peptide Fragments/metabolism ; Protease Inhibitors ; alpha-2-Antiplasmin/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: Human and murine mononuclear phagocytes express a high-affinity receptor for immunoglobulin G that plays a central role in macrophage antibody-dependent cellular cytotoxicity and clearance of immune complexes. The receptor (FcRI) may also be involved in CD4-independent infection of human macrophages by human immunodeficiency virus. This report describes the isolation of cDNA clones encoding the human FcRI by a ligand-mediated selection technique. Expression of the cDNAs in COS cells gave rise to immunoglobulin G binding of the expected affinity and subtype specificity. RNA blot analysis revealed expression of a 1.7-kilobase transcript in macrophages and in cells of the promonocytic cell line U937 induced with interferon-gamma. The extracellular region of FcRI consists of three immunoglobulin-like domains, two of which share homology with low-affinity receptor domains.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Allen, J M -- Seed, B -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):378-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911749" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Blotting, Northern ; Cercopithecus aethiops ; Cloning, Molecular ; DNA/genetics ; Gene Expression Regulation ; Humans ; Molecular Sequence Data ; Molecular Weight ; Polymorphism, Genetic ; Receptors, Fc/*genetics ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    Publication Date: 1989-12-22
    Description: Certain inflammatory stimuli render cultured human vascular endothelial cells hyperadhesive for neutrophils. This state is transient and reversible, in part because activated endothelial cells secrete a leukocyte adhesion inhibitor (LAI). LAI was identified as endothelial interleukin-8 (IL-8), the predominant species of which is an extended amino-terminal IL-8 variant. At nanomolar concentrations, purified endothelial IL-8 and recombinant human IL-8 inhibit neutrophil adhesion to cytokine-activated endothelial monolayers and protect these monolayers from neutrophil-mediated damage. These findings suggest that endothelial-derived IL-8 may function to attenuate inflammatory events at the interface between vessel wall and blood.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gimbrone, M A Jr -- Obin, M S -- Brock, A F -- Luis, E A -- Hass, P E -- Hebert, C A -- Yip, Y K -- Leung, D W -- Lowe, D G -- Kohr, W J -- P01-HL-36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1601-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688092" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Biological Factors/pharmacology ; Cell Adhesion/drug effects ; Cells, Cultured ; Chemotactic Factors/*isolation & purification/pharmacology ; Culture Media/analysis ; Cytokines ; Endothelium, Vascular/cytology/drug effects/*physiology ; Humans ; Interleukin-1/*pharmacology ; Interleukin-8 ; Interleukins/*isolation & purification/pharmacology ; Molecular Sequence Data ; Neutrophils/cytology/drug effects/*physiology ; Recombinant Proteins/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-01
    Description: Oligonucleotide recognition offers a powerful chemical approach for the sequence-specific binding of double-helical DNA. In the pyrimidine-Hoogsteen model, a binding size of greater than 15 homopurine base pairs affords greater than 30 discrete sequence-specific hydrogen bonds to duplex DNA. Because pyrimidine oligonucleotides limit triple helix formation to homopurine tracts, it is desirable to determine whether oligonucleotides can be used to bind all four base pairs of DNA. A general solution would allow targeting of oligonucleotides (or their analogs) to any given sequence in the human genome. A study of 20 base triplets reveals that the triple helix can be extended from homopurine to mixed sequences. Guanine contained within a pyrimidine oligonucleotide specifically recognizes thymine.adenine base pairs in duplex DNA. Such specificity allows binding at mixed sites in DNA from simian virus 40 and human immunodeficiency virus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Griffin, L C -- Dervan, P B -- GM-35724/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):967-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549639" target="_blank"〉PubMed〈/a〉
    Keywords: *Adenine ; Base Sequence ; DNA/*genetics ; DNA, Viral/genetics ; *Guanine ; HIV/genetics ; Hydrogen Bonding ; Models, Structural ; Molecular Sequence Data ; *Nucleic Acid Conformation ; Oligodeoxyribonucleotides ; Simian virus 40/genetics ; *Thymine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    Publication Date: 1989-12-08
    Description: A novel bacteriophage lambda vector system was used to express in Escherichia coli a combinatorial library of Fab fragments of the mouse antibody repertoire. The system allows rapid and easy identification of monoclonal Fab fragments in a form suitable for genetic manipulation. It was possible to generate, in 2 weeks, large numbers of monoclonal Fab fragments against a transition state analog hapten. The methods described may supersede present-day hybridoma technology and facilitate the production of catalytic and other antibodies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huse, W D -- Sastry, L -- Iverson, S A -- Kang, A S -- Alting-Mees, M -- Burton, D R -- Benkovic, S J -- Lerner, R A -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531466" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal/*biosynthesis/genetics ; Antibody Specificity ; Antigen-Antibody Reactions ; Bacteriophage lambda/*genetics ; Base Sequence ; Cloning, Molecular/methods ; Escherichia coli/genetics ; Gene Amplification ; Gene Library ; *Genetic Vectors ; Hemocyanin/analogs & derivatives/immunology ; Immunoglobulin Fab Fragments/biosynthesis ; Immunoglobulin Fragments/*biosynthesis/genetics ; Mice ; Molecular Sequence Data ; Organophosphorus Compounds/immunology ; Recombinant Proteins/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-03
    Description: Monoclonal antibodies have been induced that are capable of catalyzing specific hydrolysis of the Gly-Phe bond of peptide substrates at neutral pH with a metal complex cofactor. The antibodies were produced by immunizing with a Co(III) triethylenetetramine (trien)-peptide hapten. These antibodies as a group are capable of binding trien complexes of not only Co(III) but also of numerous other metals. Six peptides were examined as possible substrates with the antibodies and various metal complexes. Two of these peptides were cleaved by several of the antibodies. One antibody was studied in detail, and cleavage was observed for the substrates with the trien complexes of Zn(II), Ga(III), Fe(III), In(III), Cu(II), Ni(II), Lu(III), Mg(II), or Mn(II) as cofactors. A turnover number of 6 x 10(-4) per second was observed for these substrates. These results demonstrate the feasibility of the use of cofactor-assisted catalysis in an antibody binding site to accomplish difficult chemical transformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Iverson, B L -- Lerner, R A -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1184-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922606" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; *Antibodies, Monoclonal ; Antigens/immunology ; Binding Sites, Antibody ; Catalysis ; Chemical Phenomena ; Chemistry ; Cobalt/immunology/metabolism ; Glycine/metabolism ; Haptens/immunology ; Hydrogen-Ion Concentration ; Hydrolysis ; Immunization ; Metals/metabolism ; Mice ; Molecular Sequence Data ; Molecular Structure ; Oligopeptides/*metabolism ; Phenylalanine/metabolism ; Trientine/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    Publication Date: 1989-12-08
    Description: Vascular permeability factor (VPF) is a 40-kilodalton disulfide-linked dimeric glycoprotein that is active in increasing blood vessel permeability, endothelial cell growth, and angiogenesis. These properties suggest that the expression of VPF by tumor cells could contribute to the increased neovascularization and vessel permeability that are associated with tumor vasculature. The cDNA sequence of VPF from human U937 cells was shown to code for a 189-amino acid polypeptide that is similar in structure to the B chain of platelet-derived growth factor (PDGF-B) and other PDGF-B-related proteins. The overall identity with PDGF-B is 18%. However, all eight of the cysteines in PDGF-B were found to be conserved in human VPF, an indication that the folding of the two proteins is probably similar. Clusters of basic amino acids in the COOH-terminal halves of human VPF and PDGF-B are also prevalent. Thus, VPF appears to be related to the PDGF/v-sis family of proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Keck, P J -- Hauser, S D -- Krivi, G -- Sanzo, K -- Warren, T -- Feder, J -- Connolly, D T -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1309-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture and Biochemistry, Monsanto Company, St. Louis, MO 63167.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479987" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Capillary Permeability/physiology ; Cell Division/physiology ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; *Growth Substances ; Guinea Pigs ; Humans ; Lymphokines/*physiology ; Molecular Sequence Data ; Neovascularization, Pathologic/physiopathology ; Oncogene Proteins v-sis ; Platelet-Derived Growth Factor/physiology ; Retroviridae Proteins, Oncogenic/physiology ; Sequence Homology, Nucleic Acid ; Transforming Growth Factors ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Klausner, R D -- Harford, J B -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):870-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683086" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; *Gene Expression Regulation ; *Models, Genetic ; Molecular Sequence Data ; Nucleic Acid Conformation ; *Protein Biosynthesis ; RNA, Messenger/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    Publication Date: 1989-01-27
    Description: During sporulation in Bacillus subtilis, expression of developmental genes spoIVCB and cotD is induced in the mother cell compartment of the sporangium at morphological stages IV and V, respectively. A 27-kilodalton RNA polymerase sigma factor called sigma K (or sigma 27) has been found that causes weak transcription of spoIVCB and strong transcription of cotD. A 14-kD protein was also discovered that changes the specificity of sigma K-containing RNA polymerase, greatly stimulating spoIVCB transcription and markedly repressing cotD transcription. Both sigma K and the 14-kD protein are products of genes known to be required for expression of specific genes in the mother cell. Thus, sigma K directs gene expression in the mother cell and it is proposed that inactivation or sequestering of the 14-kD protein switches the temporal pattern of gene expression during the transition from stages IV to V of development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kroos, L -- Kunkel, B -- Losick, R -- GM18568/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):526-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cellular and Developmental Biology, Harvard University, Cambridge, Massachusetts 02138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492118" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Bacillus subtilis/*genetics/physiology ; Cloning, Molecular ; DNA-Directed RNA Polymerases/*genetics/isolation & purification ; Electrophoresis, Polyacrylamide Gel ; Gene Expression Regulation ; Molecular Sequence Data ; Promoter Regions, Genetic ; Sigma Factor/*genetics/isolation & purification ; Spores, Bacterial/genetics ; Transcription Factors/*genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    Publication Date: 1989-08-25
    Description: The messenger RNAs specifying certain proteins involved in the inflammatory response and certain oncoproteins contain a conserved UA-rich sequence in the 3' untranslated region. This sequence, which is composed of several interspersed repeats of the octanucleotide UUAUUUAU, has been shown to destabilize mRNA in some eukaryotes. However, this effect is not seen when mRNAs are transferred to Xenopus oocytes, which made it possible to separate stability from translational regulation. For interferon, granulocyte-macrophage colony-stimulating factor, and c-fos RNAs, the UA-rich sequence was observed to preclude mRNA translation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kruys, V -- Marinx, O -- Shaw, G -- Deschamps, J -- Huez, G -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):852-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departement de Biologie Moleculaire, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672333" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Colony-Stimulating Factors/*genetics ; Granulocyte-Macrophage Colony-Stimulating Factor ; Growth Substances/*genetics ; Interferon Type I/*genetics ; Molecular Sequence Data ; *Protein Biosynthesis ; *Proto-Oncogenes ; RNA, Messenger/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    Publication Date: 1989-04-07
    Description: Protein engineering and x-ray crystallography have been used to study the role of a surface loop that is present in pancreatic phospholipases but is absent in snake venom phospholipases. Removal of residues 62 to 66 from porcine pancreatic phospholipase A2 does not change the binding constant for micelles significantly, but it improves catalytic activity up to 16 times on micellar (zwitterionic) lecithin substrates. In contrast, the decrease in activity on negatively charged substrates is greater than fourfold. A crystallographic study of the mutant enzyme shows that the region of the deletion has a well-defined structure that differs from the structure of the wild-type enzyme. No structural changes in the active site of the enzyme were detected.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kuipers, O P -- Thunnissen, M M -- de Geus, P -- Dijkstra, B W -- Drenth, J -- Verheij, H M -- de Haas, G H -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):82-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704992" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Crystallography ; Enzyme Activation ; Kinetics ; Molecular Sequence Data ; Mutation ; Pancreas/enzymology ; Phospholipases/*metabolism ; Phospholipases A/genetics/*metabolism/physiology ; Phospholipases A2 ; *Protein Conformation ; Snake Venoms/analysis ; Structure-Activity Relationship ; Swine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    Publication Date: 1989-06-30
    Description: Complementary DNA's that encode an adenylyl cyclase were isolated from a bovine brain library. Most of the deduced amino acid sequence of 1134 residues is divisible into two alternating sets of hydrophobic and hydrophilic domains. Each of the two large hydrophobic domains appears to contain six transmembrane spans. Each of the two large hydrophilic domains contains a sequence that is homologous to a single cytoplasmic domain of several guanylyl cyclases; these sequences may represent nucleotide binding sites. An unexpected topographical resemblance between adenylyl cyclase and various plasma membrane channels and transporters was observed. This structural complexity suggests possible, unappreciated functions for this important enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Krupinski, J -- Coussen, F -- Bakalyar, H A -- Tang, W J -- Feinstein, P G -- Orth, K -- Slaughter, C -- Reed, R R -- Gilman, A G -- CA16519/CA/NCI NIH HHS/ -- GM12230/GM/NIGMS NIH HHS/ -- GM34497/GM/NIGMS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1558-64.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas 75235.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2472670" target="_blank"〉PubMed〈/a〉
    Keywords: *Adenylyl Cyclases/genetics/isolation & purification ; Amino Acid Sequence ; Animals ; Base Sequence ; Brain/enzymology ; *Carrier Proteins ; Cattle ; Cell Line ; Cloning, Molecular ; DNA/genetics ; Electrophoresis, Polyacrylamide Gel ; *Ion Channels ; Membrane Proteins ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Protein Conformation ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    Publication Date: 1989-08-18
    Description: CD4 is a cell surface glycoprotein that is thought to interact with nonpolymorphic determinants of class II major histocompatibility (MHC) molecules. CD4 is also the receptor for the human immunodeficiency virus (HIV), binding with high affinity to the HIV-1 envelope glycoprotein, gp120. Homolog-scanning mutagenesis was used to identify CD4 regions that are important in class II MHC binding and to determine whether the gp120 and class II MHC binding sites of CD4 are related. Class II MHC binding was abolished by mutations in each of the first three immunoglobulin-like domains of CD4. The gp120 binding could be abolished without affecting class II MHC binding and vice versa, although at least one mutation examined reduced both functions significantly. These findings indicate that, while there may be overlap between the gp120 and class II MHC binding sites of CD4, these sites are distinct and can be separated. Thus it should be possible to design CD4 analogs that can block HIV infectivity but intrinsically lack the ability to affect the normal immune response by binding to class II MHC molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lamarre, D -- Ashkenazi, A -- Fleury, S -- Smith, D H -- Sekaly, R P -- Capon, D J -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):743-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549633" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, Surface ; Binding Sites ; DNA, Recombinant ; HIV/*metabolism ; HIV Envelope Protein gp120 ; HLA-DP Antigens/immunology ; Histocompatibility Antigens Class II/*immunology ; Humans ; Hybridomas ; Mice ; Molecular Sequence Data ; Mutation ; Receptors, HIV ; Receptors, Virus/genetics/immunology/*metabolism ; Retroviridae Proteins/immunology/*metabolism ; Rosette Formation ; Structure-Activity Relationship ; T-Lymphocytes/immunology/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    Publication Date: 1989-02-24
    Description: Branched RNA-linked multicopy single-stranded DNA (msDNA) originally detected in myxobacteria has now been found in a clinical isolate of Escherichia coli. Although lacking homology in the primary structure, the E. coli msDNA is similar in secondary structure to the myxobacterial msDNA's, including the 2',5'-phosphodiester linkage between RNA and DNA. A chromosomal DNA fragment responsible for the production of msDNA was cloned in an E. coli K12 strain; its DNA sequence revealed an open reading frame (ORF) of 586 amino acid residues. The ORF shows sequence similarity with retroviral reverse transcriptases and ribonuclease H. Disruption of the ORF blocked msDNA production, indicating that this gene is essential for msDNA synthesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lampson, B C -- Sun, J -- Hsu, M Y -- Vallejo-Ramirez, J -- Inouye, S -- Inouye, M -- F32 GM11970-01A1/GM/NIGMS NIH HHS/ -- GM26843/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1033-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway 08854.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2466332" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA Probes ; DNA Restriction Enzymes ; DNA, Bacterial/genetics ; DNA, Single-Stranded/analysis/biosynthesis/*genetics ; Endoribonucleases/genetics ; Escherichia coli/enzymology/*genetics ; Genes, Bacterial ; HIV/enzymology/genetics ; Human T-lymphotropic virus 1/enzymology/genetics ; Molecular Sequence Data ; Myxococcales/genetics ; Nucleic Acid Hybridization ; RNA, Bacterial/analysis/biosynthesis/*genetics ; RNA-Directed DNA Polymerase/*genetics ; Retroviridae/*enzymology/genetics ; Ribonuclease H ; Sequence Homology, Nucleic Acid ; Transformation, Bacterial
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    Publication Date: 1989-12-22
    Description: CD16 is a low-affinity immunoglobulin G (IgG) Fc receptor that is expressed on natural killer (NK) cells, granulocytes, activated macrophages, and some T lymphocytes. Two similar genes, CD16-I and CD16-II, encode membrane glycoproteins that are anchored by phosphatidylinositol (PI)-glycan and transmembrane polypeptides, respectively. The primary structural requirements for PI-linkage were examined by constructing a series of hybrid cDNA molecules. Although both cDNA's have an identical COOH-terminal hydrophobic segment, CD16-I has Ser203 whereas CD16-II has Phe203. Conversion of Phe to Ser in CD16-II permits expression of a PI-glycan-anchored glycoprotein, whereas conversion of Ser to Phe in CD16-I prevents PI-glycan linkage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lanier, L L -- Cwirla, S -- Yu, G -- Testi, R -- Phillips, J H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Becton Dickinson Monoclonal Center, Inc., Mountain View, CA 94043.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531919" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/*genetics ; Antigens, Differentiation/*genetics/metabolism ; Base Sequence ; Cell Line ; Cell Membrane/immunology ; Codon/genetics ; *Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; *Phenylalanine ; Receptors, Fc/*genetics/metabolism ; Receptors, IgG ; *Serine ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    Publication Date: 1989-12-01
    Description: Human immunodeficiency virus (HIV) isolates with reduced sensitivity to zidovudine (3'-azido-3'-deoxythymidine, AZT) from individuals with acquired immunodeficiency syndrome (AIDS) or AIDS-related complex were studied to determine the genetic basis of their resistance. Most were sequential isolates obtained at the initiation of and during therapy. Comparative nucleotide sequence analysis of the reverse transcriptase (RT) coding region from five pairs of sensitive and resistant isolates identified three predicted amino acid substitutions common to all the resistant strains (Asp67----Asn, Lys70----Arg, Thr215----Phe or Tyr) plus a fourth in three isolates (Lys219----Gln). Partially resistant isolates had combinations of these four changes. An infectious molecular clone constructed with these four mutations in RT yielded highly resistant HIV after transfection of T cells. The reproducible nature of these mutations should make it possible to develop rapid assays to predict zidovudine resistance by performing polymerase chain reaction amplification of nucleic acid from peripheral blood lymphocytes, thereby circumventing current lengthy HIV isolation and sensitivity testing.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larder, B A -- Kemp, S D -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1155-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Sciences Department, Wellcome Research Laboratories, Beckenham, Kent, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479983" target="_blank"〉PubMed〈/a〉
    Keywords: AIDS-Related Complex/drug therapy/microbiology ; Acquired Immunodeficiency Syndrome/drug therapy/*microbiology ; Amino Acid Sequence ; Cloning, Molecular ; Drug Resistance/genetics ; Genes, Viral ; HIV-1/drug effects/*enzymology/genetics ; Humans ; Molecular Sequence Data ; *Mutation ; RNA-Directed DNA Polymerase/*genetics ; Zidovudine/pharmacology/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-21
    Description: Ribozymes are RNA molecules that catalyze biochemical reactions. Fe(II)-EDTA, a solvent-based reagent which cleaves both double- and single-stranded RNA, was used to investigate the structure of the Tetrahymena ribozyme. Regions of cleavage alternate with regions of substantial protection along the entire RNA molecule. In particular, most of the catalytic core shows greatly reduced cleavage. These data constitute experimental evidence that an RNA enzyme, like a protein enzyme, has an interior and an exterior. Determination of positions where the phosphodiester backbone of the RNA is on the inside or on the outside of the molecule provides major constraints for modeling the three-dimensional structure of the Tetrahymena ribozyme. This approach should be generally informative for structured RNA molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Latham, J A -- Cech, T R -- GM 11227-03/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):276-82.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309-0215.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501870" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoradiography ; Base Sequence ; Binding Sites ; Crystallography ; Edetic Acid ; Electrophoresis, Polyacrylamide Gel ; Ferrous Compounds ; Molecular Sequence Data ; Molecular Structure ; *Nucleic Acid Conformation ; *RNA Splicing ; RNA, Catalytic ; RNA, Fungal/analysis ; *RNA, Ribosomal/analysis/metabolism ; RNA, Transfer, Phe/analysis ; Tetrahymena/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    Publication Date: 1989-05-26
    Description: Spondyloepiphyseal dysplasias (SED) are a heterogeneous group of inherited disorders characterized by disproportionate short stature and pleiotropic involvement of the skeletal and ocular systems. Evidence has suggested that SED may result from structural defects in type II collagen. To confirm the validity of this hypothesis, the structure of the "candidate" type II collagen gene (COL2A1) has been directly examined in a relatively large SED family. Coarse scanning of the gene by Southern blot hybridization identified an abnormal restriction pattern in one of the affected members of the kindred. Analysis of selected genomic fragments, amplified by the polymerase chain reaction, precisely localized the molecular defect and demonstrated that all affected family members carried the same heterozygous single-exon deletion. As a consequence of the mutation, nearly 90 percent of the assembled type II collagen homotrimers are expected to contain one or more procollagen subunits harboring an interstitial deletion of 36 amino acids in the triple helical domain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, B -- Vissing, H -- Ramirez, F -- Rogers, D -- Rimoin, D -- AR-38648/AR/NIAMS NIH HHS/ -- HD-22657/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 May 26;244(4907):978-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, State University of New York Health Science Center, Brooklyn 11203.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543071" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Child, Preschool ; Chromosome Deletion ; Collagen/*genetics ; DNA Restriction Enzymes ; DNA-Directed DNA Polymerase ; Exons ; Female ; Gene Amplification ; Humans ; Macromolecular Substances ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Osteochondrodysplasias/*genetics ; Pedigree ; Procollagen/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    Publication Date: 1989-04-28
    Description: Confirmed infection with HTLV-II (human T cell leukemia virus type II) has been described only in rare cases. The major limitation to serological diagnosis of HTLV-II has been the difficulty of distinguishing HTLV-II from HTLV-I (human T cell leukemia virus type I) infection, because of substantial cross-reactivity between the viruses. A sensitive modification of the polymerase chain reaction method was used to provide unambiguous molecular evidence that a significant proportion of intravenous drug abusers are infected with HTLV, and the majority of these individuals are infected with HTLV-II rather than HTLV-I. Of 23 individuals confirmed by polymerase chain reaction analysis to be infected with HTLV, 21 were identified to be infected with HTLV-II, and 2 were infected with HTLV-I. Molecular identification of an HTLV-II--infected population provides an opportunity to investigate the pathogenicity of HTLV-II in humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, H -- Swanson, P -- Shorty, V S -- Zack, J A -- Rosenblatt, J D -- Chen, I S -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):471-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Diagnostics Division, Abbott Laboratories, North Chicago, IL 60064.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2655084" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; DNA, Viral/analysis ; DNA-Directed DNA Polymerase ; Genes, Viral ; HTLV-I Antibodies/analysis ; HTLV-I Infections/diagnosis/epidemiology/etiology ; HTLV-II Antibodies/*analysis ; HTLV-II Infections/diagnosis/*epidemiology/etiology ; Human T-lymphotropic virus 1/genetics/immunology ; Human T-lymphotropic virus 2/genetics/immunology ; Humans ; Immunoblotting ; Immunoenzyme Techniques ; Louisiana ; Molecular Sequence Data ; Sequence Homology, Nucleic Acid ; Substance-Related Disorders/*complications
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    Publication Date: 1989-07-07
    Description: Basic fibroblast growth factor (bFGF) participates in many processes including early developmental events, angiogenesis, wound healing, and maintenance of neuronal cell viability. A 130-kilodalton protein was isolated on the basis of its ability to specifically bind to bFGF. A complementary DNA clone was isolated with an oligonucleotide probe corresponding to determined amino acid sequences of tryptic peptide fragments of the purified protein. The putative bFGF receptor encoded by this complementary DNA is a transmembrane protein that contains three extracellular immunoglobulin-like domains, an unusual acidic region, and an intracellular tyrosine kinase domain. These domains are arranged in a pattern that is different from that of any growth factor receptor described.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, P L -- Johnson, D E -- Cousens, L S -- Fried, V A -- Williams, L T -- CA 21765/CA/NCI NIH HHS/ -- R01 HL32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):57-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544996" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cells, Cultured ; Chick Embryo ; *Cloning, Molecular ; DNA/*genetics ; Fibroblast Growth Factors/*genetics ; Kinetics ; Mice ; Molecular Sequence Data ; Peptide Fragments/analysis ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Fibroblast Growth Factor ; Recombinant Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    Publication Date: 1989-08-11
    Description: The three-dimensional solution structure of a zinc finger nucleic acid binding motif has been determined by nuclear magnetic resonance (NMR) spectroscopy. Spectra of a synthetic peptide corresponding to a single zinc finger from the Xenopus protein Xfin yielded distance and dihedral angle constraints that were used to generate structures from distance geometry and restrained molecular dynamics calculations. The zinc finger is an independently folded domain with a compact globular structure in which the zinc atom is bound by two cysteine and two histidine ligands. The polypeptide backbone fold consists of a well-defined helix, starting as alpha and ending as 3(10) helix, packed against two beta strands that are arranged in a hairpin structure. A high density of basic and polar amino acid side chains on the exposed face of the helix are probably involved in DNA binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, M S -- Gippert, G P -- Soman, K V -- Case, D A -- Wright, P E -- GM 36643/GM/NIGMS NIH HHS/ -- GM38794/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):635-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2503871" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Cysteine/metabolism ; DNA/*metabolism ; DNA-Binding Proteins/*metabolism ; Histidine/metabolism ; Hydrogen Bonding ; Magnetic Resonance Spectroscopy ; Metalloproteins/*metabolism ; Molecular Sequence Data ; Molecular Structure ; Protein Conformation ; Solutions ; Thermodynamics ; Xenopus ; Zinc/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    Publication Date: 1989-12-08
    Description: Vascular endothelial growth factor (VEGF) was purified from media conditioned by bovine pituitary folliculostellate cells (FC). VEGF is a heparin-binding growth factor specific for vascular endothelial cells that is able to induce angiogenesis in vivo. Complementary DNA clones for bovine and human VEGF were isolated from cDNA libraries prepared from FC and HL60 leukemia cells, respectively. These cDNAs encode hydrophilic proteins with sequences related to those of the A and B chains of platelet-derived growth factor. DNA sequencing suggests the existence of several molecular species of VEGF. VEGFs are secreted proteins, in contrast to other endothelial cell mitogens such as acidic or basic fibroblast growth factors and platelet-derived endothelial cell growth factor. Human 293 cells transfected with an expression vector containing a bovine or human VEGF cDNA insert secrete an endothelial cell mitogen that behaves like native VEGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Leung, D W -- Cachianes, G -- Kuang, W J -- Goeddel, D V -- Ferrara, N -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1306-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Genetech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479986" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cattle ; Cell Division ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; Gene Library ; Humans ; Lymphokines/genetics/*physiology/secretion ; Molecular Sequence Data ; Neovascularization, Pathologic/*physiopathology ; Sequence Homology, Nucleic Acid ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    Publication Date: 1989-05-05
    Description: An approach based on the polymerase chain reaction has been devised to clone new members of the family of genes encoding guanosine triphosphate-binding protein (G protein)-coupled receptors. Degenerate primers corresponding to consensus sequences of the third and sixth transmembrane segments of available receptors were used to selectively amplify and clone members of this gene family from thyroid complementary DNA. Clones encoding three known receptors and four new putative receptors were obtained. Sequence comparisons established that the new genes belong to the G protein-coupled receptor family. Close structural similarity was observed between one of the putative receptors and the 5HT1a receptor. Two other molecules displayed common sequence characteristics, suggesting that they are members of a new subfamily of receptors with a very short nonglycosylated (extracellular) amino-terminal extension.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Libert, F -- Parmentier, M -- Lefort, A -- Dinsart, C -- Van Sande, J -- Maenhaut, C -- Simons, M J -- Dumont, J E -- Vassart, G -- New York, N.Y. -- Science. 1989 May 5;244(4904):569-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Campus Erasme, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541503" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; DNA/genetics ; DNA-Directed DNA Polymerase ; GTP-Binding Proteins/*metabolism ; *Gene Amplification ; Humans ; Molecular Sequence Data ; Receptors, Adrenergic, alpha/genetics ; Receptors, Adrenergic, beta/genetics ; Receptors, Muscarinic/genetics ; Receptors, Neurokinin-2 ; Receptors, Neurotransmitter/*genetics ; Receptors, Serotonin/genetics ; Sequence Homology, Nucleic Acid ; Thyroid Gland/analysis ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    Publication Date: 1989-11-24
    Description: Ciliary neurotrophic factor (CNTF) is one of a small number of proteins with neurotrophic activities distinct from nerve growth factor (NGF). CNTF has now been purified and cloned and the primary structure of CNTF from rabbit sciatic nerve has been determined. Biologically active CNTF has been transiently expressed from a rabbit complementary DNA clone. CNTF is a neural effector without significant sequence homologies to any previously reported protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lin, L F -- Mismer, D -- Lile, J D -- Armes, L G -- Butler, E T 3rd -- Vannice, J L -- Collins, F -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1023-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Protein Chemistry Group, Synergen, Inc., Boulder, CO 80301.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587985" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cell Line ; Ciliary Neurotrophic Factor ; Cloning, Molecular ; DNA/genetics ; Molecular Sequence Data ; Nerve Growth Factors/*genetics ; Nerve Tissue Proteins/biosynthesis/*genetics/isolation & purification ; Rabbits ; Recombinant Proteins/biosynthesis ; Sciatic Nerve/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    Publication Date: 1989-01-13
    Description: In the polymerase chain reaction (PCR), two specific oligonucleotide primers are used to amplify the sequences between them. However, this technique is not suitable for amplifying genes that encode molecules where the 5' portion of the sequences of interest is not known, such as the T cell receptor (TCR) or immunoglobulins. Because of this limitation, a novel technique, anchored polymerase chain reaction (A-PCR), was devised that requires sequence specificity only on the 3' end of the target fragment. It was used to analyze TCR delta chain mRNA's from human peripheral blood gamma delta T cells. Most of these cells had a V delta gene segment not previously described (V delta 3), and the delta chain junctional sequences formed a discrete subpopulation compared with those previously reported.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loh, E Y -- Elliott, J F -- Cwirla, S -- Lanier, L L -- Davis, M M -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):217-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departments of Medicine and Microbiology and Immunology, Stanford University School of Medicine, CA 94305-5402.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463672" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cell Line ; Gene Amplification ; *Genes ; Humans ; Macromolecular Substances ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; RNA-Directed DNA Polymerase ; Receptors, Antigen, T-Cell/*genetics ; T-Lymphocytes/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    Publication Date: 1989-07-28
    Description: A 47-kilodalton neutrophil cytosol factor (NCF-47k), required for activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase superoxide (O2-.) production, is absent in most patients with autosomal recessive chronic granulomatous disease (AR-CGD). NCF-47k cDNAs were cloned from an expression library. The largest clone predicted a 41.9-kD protein that contained an arginine and serine-rich COOH-terminal domain with potential protein kinase C phosphorylation sites. A 33-amino acid segment of NCF-47k shared 49% identity with ras p21 guanosine triphosphatase activating protein. Recombinant NCF-47k restored O2-. -producing activity to AR-CGD neutrophil cytosol in a cell-free assay. Production of active recombinant NCF-47k will enable functional regions of this molecule to be mapped.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lomax, K J -- Leto, T L -- Nunoi, H -- Gallin, J I -- Malech, H L -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):409-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Bacterial Diseases Section, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547247" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Blotting, Northern ; Cloning, Molecular ; DNA/*genetics ; Granulomatous Disease, Chronic/enzymology/*genetics ; Humans ; Immunoblotting ; Molecular Sequence Data ; NADH, NADPH Oxidoreductases/*metabolism ; NADPH Oxidase ; Neutrophils/*metabolism ; Phosphoproteins/*genetics/metabolism ; Phosphorylation ; Recombinant Proteins/genetics/metabolism ; Superoxides/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lomax, K J -- Leto, T L -- Nunoi, H -- Gallin, J I -- Malech, H L -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):987.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587992" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Cytosol/enzymology ; DNA/genetics ; Molecular Sequence Data ; Oxidoreductases/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    Publication Date: 1989-01-13
    Description: An important question in protein folding is whether the natural amino and carboxyl termini and the given order of secondary structure segments are critical to the stability and to the folding pathway of proteins. Here it is shown that two circularly permuted versions of the gene of a single-domain beta alpha barrel enzyme can be expressed in Escherichia coli. The variants are enzymically active and are practically indistinguishable from the original enzyme by several structural and spectroscopic criteria, despite the creation of new termini and the cleavage of a surface loop. This novel genetic approach should be useful for protein folding studies both in vitro and in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Luger, K -- Hommel, U -- Herold, M -- Hofsteenge, J -- Kirschner, K -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):206-10.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Abteilung Biophysikalische Chemie, Universitat Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2643160" target="_blank"〉PubMed〈/a〉
    Keywords: *Aldose-Ketose Isomerases ; Amino Acid Sequence ; Base Sequence ; Carbohydrate Epimerases/*genetics/metabolism ; Circular Dichroism ; *Cloning, Molecular ; Enzyme Stability ; Escherichia coli/*enzymology/genetics ; *Genes ; Genetic Variation ; Kinetics ; Molecular Sequence Data ; *Protein Conformation ; Spectrometry, Fluorescence ; Spectrophotometry, Ultraviolet
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    Publication Date: 1989-08-04
    Description: Complementary DNA clones, encoding the LH-hCG (luteinizing hormone-human choriogonadotropic hormone) receptor were isolated by screening a lambda gt11 library with monoclonal antibodies. The primary structure of the protein was deduced from the DNA sequence analysis; the protein contains 696 amino acids with a putative signal peptide of 27 amino acids. Hydropathy analysis suggests the existence of seven transmembrane domains that show homology with the corresponding regions of other G protein-coupled receptors. Three other types of clones corresponding to shorter proteins were observed, in which the putative transmembrane domain was absent. These probably arose through alternative splicing. RNA blot analysis showed similar patterns in testis and ovary with a major RNA of 4700 nucleotides and several minor species. The messenger RNA was expressed in COS-7 cells, yielding a protein that bound hCG with the same affinity as the testicular receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loosfelt, H -- Misrahi, M -- Atger, M -- Salesse, R -- Vu Hai-Luu Thi, M T -- Jolivet, A -- Guiochon-Mantel, A -- Sar, S -- Jallal, B -- Garnier, J -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):525-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut National de la Sante et de la Recherche Medicale Unite 135, Hopital de Bicetre, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502844" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Membrane/*metabolism ; *Cloning, Molecular ; DNA/*genetics ; Female ; GTP-Binding Proteins/metabolism ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Ovary/analysis ; Protein Sorting Signals/genetics ; RNA, Messenger/analysis/genetics ; Receptors, LH/*genetics/metabolism ; Sequence Homology, Nucleic Acid ; Swine ; Testis/analysis ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    Publication Date: 1989-08-18
    Description: Keratinocyte growth factor (KGF) is a human mitogen that is specific for epithelial cells. The complementary DNA sequence of KGF demonstrates that it is a member of the fibroblast growth factor family. The KGF transcript was present in stromal cells derived from epithelial tissues. By comparison with the expression of other epithelial cell mitogens, only KGF, among known human growth factors, has the properties of a stromal mediator of epithelial cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Finch, P W -- Rubin, J S -- Miki, T -- Ron, D -- Aaronson, S A -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):752-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475908" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Division ; Codon ; DNA/genetics/isolation & purification ; Epithelial Cells ; Epithelium/analysis/metabolism ; Fibroblast Growth Factor 10 ; Fibroblast Growth Factor 7 ; *Fibroblast Growth Factors/genetics ; Fibroblasts/metabolism ; Gene Expression Regulation ; Growth Substances/*genetics/physiology ; Humans ; Mesoderm/metabolism ; Mice ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oligonucleotide Probes ; RNA/analysis ; Sequence Homology, Nucleic Acid ; Skin/analysis ; Tissue Distribution ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    Publication Date: 1989-07-07
    Description: Insulin receptor complementary DNA has been cloned from an insulin-resistant individual whose receptors have impaired tyrosine protein kinase activity. One of this individual's alleles has a mutation in which valine is substituted for Gly996, the third glycine in the conserved Gly-X-Gly-X-X-Gly motif in the putative binding site fo adenosine triphosphate. Expression of the mutant receptor by transfection into Chinese hamster ovary cells confirmed that the mutation impairs tyrosine kinase activity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Odawara, M -- Kadowaki, T -- Yamamoto, R -- Shibasaki, Y -- Tobe, K -- Accili, D -- Bevins, C -- Mikami, Y -- Matsuura, N -- Akanuma, Y -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):66-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544998" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Amino Acid Sequence ; Base Sequence ; Diabetes Mellitus, Type 2/*genetics ; *Genes ; Humans ; Insulin Resistance ; Molecular Sequence Data ; *Mutation ; Protein-Tyrosine Kinases/*genetics ; Receptor, Insulin/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    Publication Date: 1989-08-11
    Description: The products of the nuclear oncogenes fos and jun are known to form heterodimers that bind to DNA and modulate transcription. Both proteins contain a leucine zipper that is important for heterodimer formation. Peptides corresponding to these leucine zippers were synthesized. When mixed, these peptides preferentially form heterodimers over homodimers by at least 1000-fold. Both homodimers and the heterodimer are parallel alpha helices. The leucine zipper regions from Fos and Jun therefore correspond to autonomous helical dimerization sites that are likely to be short coiled coils, and these regions are sufficient to determine the specificity of interaction between Fos and Jun. The Fos leucine zipper forms a relatively unstable homodimer. Instability of homodimers provides a thermodynamic driving force for preferential heterodimer formation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Shea, E K -- Rutkowski, R -- Stafford, W F 3rd -- Kim, P S -- RR05711/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):646-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2503872" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Circular Dichroism ; *DNA-Binding Proteins ; Disulfides ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Peptide Fragments/chemical synthesis ; Protein Conformation ; *Proto-Oncogene Proteins ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; *Transcription Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    Publication Date: 1989-03-31
    Description: The tpa-1 gene mediates the action of tumor-promoting phorbol esters in the nematode Caenorhabditis elegans. A genomic fragment that constitutes a portion of the tpa-1 gene was cloned by Tc1 transposon tagging and was used as a probe to screen a nematode complementary DNA library. One of the isolated complementary DNA clones had a nucleotide sequence that predicts a polypeptide of 526 amino acids. The predicted amino acid sequence revealed that the predicted tpa-1 protein sequence is highly similar to protein kinase C molecules from various animals, including man.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tabuse, Y -- Nishiwaki, K -- Miwa, J -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1713-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Fundamental Research Laboratories, NEC Corporation, Kawasaki, Kanagawa, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2538925" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Caenorhabditis/*drug effects/genetics ; Cloning, Molecular ; Codon ; DNA/genetics ; DNA Restriction Enzymes ; Drug Resistance/genetics ; Genetic Markers ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Phenotype ; Phorbol Esters/*pharmacology ; Protein Kinase C/*genetics ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    Publication Date: 1989-09-01
    Description: The structure and function of transcription factors of higher plants was studied by isolating cDNA clones encoding a wheat sequence-specific DNA binding protein. A hexameric nucleotide motif, ACGTCA, is located upstream from the TATA box of several plant histone genes. It has been suggested that this motif is essential for efficient transcription of the wheat histone H3 gene. A wheat nuclear protein, HBP-1 (histone DNA binding protein-1), which specifically binds to the hexameric motif, has previously been identified as a putative transcription factor. A cDNA clone encoding HBP-1 has been isolated on the basis of specific binding of HBP-1 to the hexameric motif. The deduced amino acid sequence indicates that HBP-1 contains the leucine zipper motif, which represents a characteristic property of several eukaryotic transcription factors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tabata, T -- Takase, H -- Takayama, S -- Mikami, K -- Nakatsuka, A -- Kawata, T -- Nakayama, T -- Iwabuchi, M -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):965-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Botany, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772648" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA/genetics ; DNA-Binding Proteins/*genetics ; *Genes ; Genes, Regulator ; Histones/*genetics ; Information Systems ; *Leucine ; Methylation ; Molecular Sequence Data ; Nuclear Proteins/*genetics ; Nucleic Acid Hybridization ; Plants/*genetics ; *Transcription, Genetic ; Triticum/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    Publication Date: 1989-10-06
    Description: For the IIIB isolate of human immunodeficiency virus type-1 (HIV-1), the immunodominant determinant of the envelope protein gp160 for cytotoxic T lymphocytes (CTLs) of H-2d mice is in a region of high sequence variability among HIV-1 isolates. The general requirements for CTL recognition of peptide antigens and the relation of recognition requirements to the natural variation in sequence of the HIV were investigated. For this purpose, a CTL line specific for the homologous segment of the envelope from the MN isolate of HIV-1 and restricted by the same class I major histocompatibility (MHC) molecule (Dd) as the IIIB-specific CTLs was raised from mice immunized with MN-env-recombinant vaccinia virus. The IIIB-specific and MN-specific CTLs were completely non-cross-reactive. Reciprocal exchange of a single amino acid between the two peptide sequences, which differed in 6 of 15 residues, led to a complete reversal of the specificity of the peptides in sensitizing targets, such that the IIIB-specific CTLs lysed targets exposed to the singly substituted MN peptide and vice versa. These data indicate the importance of single residues in defining peptide epitopic specificity and have implications for both the effect of immune pressure on selection of viral mutants and the design of effective vaccines.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, H -- Merli, S -- Putney, S D -- Houghten, R -- Moss, B -- Germain, R N -- Berzofsky, J A -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):118-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Metabolism Branch, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2789433" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Genes, MHC Class I ; HIV Envelope Protein gp160 ; HIV-1/*immunology ; Mice ; Mice, Inbred BALB C ; Mice, Inbred C3H ; Mice, Inbred C57BL ; Molecular Sequence Data ; Retroviridae Proteins/*immunology ; T-Lymphocytes, Cytotoxic/*immunology ; Viral Envelope Proteins/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: The contribution of the anticodon to the discrimination between cognate and noncognate tRNAs by Escherichia coli Arg-tRNA synthetase has been investigated by in vitro synthesis and aminoacylation of elongator methionine tRNA (tRNA(mMet) mutants. Substitution of the Arg anticodon CCG for the Met anticodon CAU leads to a dramatic increase in Arg acceptance by tRNA(mMet). A nucleotide (A20) previously identified by others in the dihydrouridine loop of tRNA(Arg)s makes a smaller contribution to the conversion of tRNA(mMet) identity from Met to Arg. The combined anticodon and dihydrouridine loop mutations yield a tRNA(mMet) derivative that is aminoacylated with near-normal kinetics by the Arg-tRNA synthetase.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schulman, L H -- Pelka, H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1595-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology and Cancer, Albert Einstein College of Medicine, Bronx, NY 10461.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688091" target="_blank"〉PubMed〈/a〉
    Keywords: Anticodon/*genetics ; Arginine-tRNA Ligase/metabolism ; Base Sequence ; Escherichia coli/enzymology/genetics ; Kinetics ; Methionine-tRNA Ligase/metabolism ; Molecular Sequence Data ; Nucleic Acid Conformation ; RNA, Transfer/*genetics ; RNA, Transfer, Amino Acid-Specific/*genetics ; RNA, Transfer, Arg/*genetics ; Substrate Specificity ; T-Phages/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    Publication Date: 1989-03-03
    Description: Isolation of a clone encoding the mouse lymph node homing receptor reveals a deduced protein with an unusual protein mosaic architecture, containing a separate carbohydrate-binding (lectin) domain, an epidermal growth factor-like (EGF) domain, and an extracellular precisely duplicated repeat unit, which preserves the motif seen in the homologous repeat structure of complement regulatory proteins and other proteins. The receptor molecule is potentially highly glycosylated, and contains an apparent transmembrane region. Analysis of messenger RNA transcripts reveals a predominantly lymphoid distribution in direct relation to the cell surface expression of the MEL-14 determinant, and the cDNA clone is shown to confer the MEL-14 epitope in heterologous cells. The many novel features, including ubiquitination, embodied in this single receptor molecule form the basis for numerous approaches to the study of cell-cell interactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siegelman, M H -- van de Rijn, M -- Weissman, I L -- AI09022/AI/NIAID NIH HHS/ -- OIG43551/PHS HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1165-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646713" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Base Sequence ; Binding Sites ; Carbohydrate Metabolism ; Cell Membrane/metabolism ; DNA/*genetics ; Epidermal Growth Factor ; Glycosylation ; Lymph Nodes/*metabolism ; Membrane Glycoproteins/*genetics ; Mice ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; Receptors, Lymphocyte Homing ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-16
    Description: Artificial yeast introns that show cold-sensitive splicing have been constructed. These conditional introns can be inserted into a target gene as an "intron cassette" without disrupting the coding information, allowing expression of the gene to be cold sensitive. Insertion of these intron cassettes rendered the yeast URA3 gene cold sensitive in its expression. The advantage of this intron-mediated control system is that any gene can be converted to a controllable gene by simple insertion of an intron.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yoshimatsu, T -- Nagawa, F -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1346-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Biotechnology Research, Wakunaga Pharmaceutical Co., Ltd., Hiroshima, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544026" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Cold Temperature ; DNA Transposable Elements ; *Gene Expression Regulation ; *Genetic Engineering ; *Introns ; Molecular Sequence Data ; Saccharomyces cerevisiae/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cell Line ; Chloramphenicol O-Acetyltransferase/genetics ; Chromosome Deletion ; *Enhancer Elements, Genetic ; *Genes, Viral ; Hepatitis B virus/*genetics ; Liver/*metabolism ; Molecular Sequence Data ; Mutation ; *Promoter Regions, Genetic ; Simplexvirus/enzymology/genetics ; Thymidine Kinase/genetics ; Transcription, Genetic ; Transfection ; Viral Structural Proteins/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: Parasitic protozoans and helminths pose considerable medical as well as scientific challenges. Investigations of the complex and very different life cycles of these organisms, their adaptation to the obligate parasitic mode of life, and their ability to face the hostile host environment have resulted in many exciting discoveries. Invasion of host erythrocytes by plasmodial sporozoites and intact skin by schistosomal cercariae are outlined as examples of the elaborate mechanisms of parasitism. Isolation and characterization of single protective antigens or subunit vaccines from these two organisms are examined as models for vaccine development. Finally, developments in exploring gene regulation in protozoans and free and parasitic nematodes are briefly outlined.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mahmoud, A A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1015-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Case Western Reserve University School of Medicine, Cleveland, OH 44106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686024" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Eukaryota/genetics/pathogenicity/*physiology ; Gene Expression Regulation ; Helminthiasis/*immunology ; Helminths/genetics/pathogenicity/*physiology ; Humans ; Molecular Sequence Data ; Protozoan Infections/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    Publication Date: 1989-07-28
    Description: Two members of the hsp70 family, termed hsc70 and BiP, have been implicated in promoting protein folding and assembly processes in the cytoplasm and the lumen of the endoplasmic reticulum, respectively. Short hydrophilic (8 to 25 residues) synthetic peptides have now been tested as possible mimics of polypeptide chain substrates to help define an enzymatic basis for these activities. Both BiP and hsc70 have specific peptide binding sites. Peptide binding elicits hydrolysis of adenosine triphosphate, with the subsequent release of bound peptide.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Flynn, G C -- Chappell, T G -- Rothman, J E -- GM-25662/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):385-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Lewis Thomas Laboratory, Princeton University, NJ 08544.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2756425" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/metabolism ; Amino Acid Sequence ; Animals ; Carrier Proteins/*metabolism ; Cattle ; Endoplasmic Reticulum/metabolism ; Heat-Shock Proteins/*metabolism ; Hydrolysis ; Microsomes, Liver/metabolism ; *Molecular Chaperones ; Molecular Sequence Data ; Peptides/*metabolism ; Protein Binding ; Protein Conformation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-27
    Description: Recently, a hypothetical structure called a leucine zipper was proposed that defines a new class of DNA binding proteins. The common feature of these proteins is a region spanning approximately 30 amino acids that contains a periodic repeat of leucines every seven residues. A peptide corresponding to the leucine zipper region of the yeast transcriptional activator GCN4 was synthesized and characterized. This peptide associates in the micromolar concentration range to form a very stable dimer of alpha helices with a parallel orientation. Although some features of the leucine zipper model are supported by our experimental data, the peptide has the characteristics of a coiled coil.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Shea, E K -- Rutkowski, R -- Kim, P S -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):538-42.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Cambridge, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911757" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Chromatography, High Pressure Liquid ; Circular Dichroism ; DNA/metabolism ; *DNA-Binding Proteins ; Disulfides ; *Fungal Proteins ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Peptide Fragments ; Protein Conformation ; *Protein Kinases ; Repetitive Sequences, Nucleic Acid ; *Saccharomyces cerevisiae Proteins ; *Transcription Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-08
    Description: The predicted amino acid sequence of a newly identified gene of the insect baculovirus Autographa californica nuclear polyhedrosis virus was similar to several uridine 5'-diphosphate (UDP)-glucuronosyl transferases and at least one UDP-glucosyl transferase. Genetic and biochemical studies confirmed that this gene encodes an ecdysteroid UDP-glucosyl transferase (egt). This enzyme catalyzes the transfer of glucose from UDP-glucose to ecdysteroids, which are insect molting hormones. Expression of the egt gene allowed the virus to interfere with normal insect development so that molting was blocked in infected larvae of fall armyworm (Spodoptera frugiperda).〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Reilly, D R -- Miller, L K -- AI 23719/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1110-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Entomology, University of Georgia, Athens 30602.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2505387" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Ecdysone/*metabolism ; Genes, Viral ; Glucuronosyltransferase/*biosynthesis/isolation & purification ; Insect Viruses/*enzymology/genetics/physiology ; Lepidoptera/*growth & development ; Molecular Sequence Data ; Moths/*growth & development/microbiology ; Sequence Homology, Nucleic Acid ; *Viral Interference ; Viral Proteins/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    Publication Date: 1989-02-17
    Description: The retinoblastoma (Rb) antioncogene encodes a nuclear phosphoprotein, p105-Rb, that forms protein complexes with the adenovirus E1A and SV40 large T oncoproteins. A novel, aberrant Rb protein detected in J82 bladder carcinoma cells was not able to form a complex with E1A and was less stable than p105-Rb. By means of a rapid method for the detection of mutations in Rb mRNA, this defective Rb protein was observed to result from a single point mutation within a splice acceptor sequence in J82 genomic DNA. This mutation eliminates a single exon and 35 amino acids from its encoded protein product.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Horowitz, J M -- Yandell, D W -- Park, S H -- Canning, S -- Whyte, P -- Buchkovich, K -- Harlow, E -- Weinberg, R A -- Dryja, T P -- CA 08131/CA/NCI NIH HHS/ -- CA 13106/CA/NCI NIH HHS/ -- CA 39826/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):937-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2521957" target="_blank"〉PubMed〈/a〉
    Keywords: Adenovirus Early Proteins ; Antigens, Polyomavirus Transforming ; Base Sequence ; DNA-Binding Proteins/metabolism ; Eye Neoplasms/*genetics ; Humans ; Molecular Sequence Data ; *Mutation ; Oncogene Proteins, Viral/metabolism ; *Oncogenes ; Phosphoproteins/*genetics/metabolism ; Retinoblastoma/*genetics ; Retinoblastoma Protein
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    Publication Date: 1989-12-22
    Description: The pituitary hormone thyrotropin, or thyroid-stimulating hormone (TSH), is the main physiological agent that regulates the thyroid gland. The thyrotropin receptor (TSHR) was cloned by selective amplification with the polymerase chain reaction of DNA segments presenting sequence similarity with genes for G protein-coupled receptors. Out of 11 new putative receptor clones obtained from genomic DNA, one had sequence characteristics different from all the others. Although this clone did not hybridize to thyroid transcripts, screening of a dog thyroid complementary DNA (cDNA) library at moderate stringency identified a cDNA encoding a 4.9-kilobase thyroid-specific transcript. The polypeptide encoded by this thyroid-specific transcript consisted of a 398-amino acid residue amino-terminal segment, constituting a putative extracellular domain, connected to a 346-residue carboxyl-terminal domain that contained seven putative transmembrane segments. Expression of the cDNA conferred TSH responsiveness to Xenopus oocytes and Y1 cells and a TSH binding phenotype to COS cells. The TSHR and the receptor for luteinizing hormone-choriogonadotropin constitute a subfamily of G protein-coupled receptors with distinct sequence characteristics.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parmentier, M -- Libert, F -- Maenhaut, C -- Lefort, A -- Gerard, C -- Perret, J -- Van Sande, J -- Dumont, J E -- Vassart, G -- R01-DK21732/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1620-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556796" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Blotting, Northern ; Cell Line ; *Cloning, Molecular ; Cyclic AMP ; Dogs ; Female ; *Genes ; Molecular Sequence Data ; Oocytes/drug effects/metabolism ; Organ Specificity ; Polymerase Chain Reaction/methods ; RNA, Messenger/genetics ; Receptors, Thyrotropin/*genetics ; Thyrotropin/pharmacology ; Transcription, Genetic ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    Publication Date: 1989-06-09
    Description: Vasoactive intestinal peptide (VIP) labeled with 125I, [Tyr10-125I]VIP, can be hydrolyzed by immunoglobulin G (IgG) purified from a human subject, as judged by trichloroacetic acid precipitation and reversed-phase high-performance liquid chromatography (HPLC). The hydrolytic activity was precipitated by antibody to human IgG, it was bound by immobilized protein G and showed a molecular mass close to 150 kilodaltons by gel filtration chromatography, properties similar to those of authentic IgG. The Fab fragment, prepared from IgG by papain treatment, retained the VIP hydrolytic activity of the IgG. Peptide fragments produced by treatment of VIP with the antibody fraction were purified by reversed-phase HPLC and identified by fast atom bombardment-mass spectrometry and peptide sequencing. The scissile bond in VIP deduced from these experiments was Gln16-Met17. The antibody concentration (73.4 fmol per milligram of IgG) and the Kd (0.4 nM) were computed from analysis of VIP binding under conditions that did not result in peptide hydrolysis. Analysis of the antibody-mediated VIP hydrolysis at varying concentrations of substrate suggested conformity with Michaelis-Menton kinetics (Km). The values for Km (37.9 X 10(-9) M) and the turnover number kcat (15.6 min-1) suggested relatively tight VIP binding and a moderate catalytic efficiency of the antibody.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Paul, S -- Volle, D J -- Beach, C M -- Johnson, D R -- Powell, M J -- Massey, R J -- HL 35506/HL/NHLBI NIH HHS/ -- HL 40348/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1158-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Nebraska Medical Center, Omaha 68105.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727702" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; *Autoantibodies ; Catalysis ; Chromatography, High Pressure Liquid ; Humans ; Hydrolysis ; Immunoglobulin Fab Fragments ; *Immunoglobulin G ; Kinetics ; Molecular Sequence Data ; Peptide Fragments/isolation & purification ; Vasoactive Intestinal Peptide/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-01
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Perlman, P S -- Butow, R A -- GM 35510/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1106-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Genetics, Ohio State University, Columbus 43210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479980" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; DNA/genetics ; *Introns/genetics ; Molecular Sequence Data ; Proteins/*genetics ; RNA/genetics ; *RNA Splicing/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    Publication Date: 1989-11-10
    Description: Genomic sequencing permits studies of in vivo DNA methylation and protein-DNA interactions, but its use has been limited because of the complexity of the mammalian genome. A newly developed genomic sequencing procedure in which a ligation mediated polymerase chain reaction (PCR) is used generates high quality, reproducible sequence ladders starting with only 1 microgram of uncloned mammalian DNA per reaction. Different sequence ladders can be created simultaneously by inclusion of multiple primers and visualized separately by rehybridization. Relatively little radioactivity is needed for hybridization and exposure times are short. Methylation patterns in genomic DNA are readily detectable; for example, 17 CpG dinucleotides in the 5' region of human X-linked PGK-1 (phosphoglycerate kinase 1) were found to be methylated on an inactive human X chromosome, but unmethylated on an active X chromosome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pfeifer, G P -- Steigerwald, S D -- Mueller, P R -- Wold, B -- Riggs, A D -- AG08196/AG/NIA NIH HHS/ -- GM355262BW/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):810-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Biology Section, Beckman Research Institute of the City of Hope, Duarte, CA 91010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814502" target="_blank"〉PubMed〈/a〉
    Keywords: 5-Methylcytosine ; Animals ; Autoradiography ; Base Sequence ; Cytosine ; DNA/*genetics/metabolism ; Exons ; HeLa Cells ; Humans ; Methylation ; Molecular Sequence Data ; *Nucleic Acid Amplification Techniques ; *Nucleic Acid Hybridization ; Phosphoglycerate Kinase/genetics ; Polymerase Chain Reaction/*methods ; Promoter Regions, Genetic ; X Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    Publication Date: 1989-02-03
    Description: The nitrogen regulatory (NtrC) protein of enteric bacteria, which binds to sites that have the properties of transcriptional enhancers, is known to activate transcription by a form of RNA polymerase that contains the NtrA protein (sigma 54) as sigma factor (referred to as sigma 54-holoenzyme). In the presence of adenosine triphosphate, the NtrC protein catalyzes isomerization of closed recognition complexes between sigma 54-holoenzyme and the glnA promoter to open complexes in which DNA in the region of the transcription start site is locally denatured. NtrC is not required subsequently for maintenance of open complexes or initiation of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Popham, D L -- Szeto, D -- Keener, J -- Kustu, S -- GM38361/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):629-35.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, University of California, Berkley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563595" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/analogs & derivatives/metabolism/pharmacology ; *Bacterial Proteins ; Base Sequence ; Binding Sites ; DNA, Bacterial/metabolism ; DNA-Binding Proteins/*metabolism ; DNA-Directed RNA Polymerases/metabolism ; Deoxyribonuclease I ; *Enhancer Elements, Genetic ; Glutamate-Ammonia Ligase/genetics ; Heparin/pharmacology ; Molecular Sequence Data ; Mutation ; PII Nitrogen Regulatory Proteins ; Phosphorylation ; Promoter Regions, Genetic ; Salmonella typhimurium/*genetics ; Sigma Factor/metabolism ; *Trans-Activators ; Transcription Factors ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    Publication Date: 1989-08-11
    Description: Cholesterol balance in mammalian cells is maintained in part by sterol-mediated repression of gene transcription for the low density lipoprotein receptor and enzymes in the cholesterol biosynthetic pathway. A promoter sequence termed the sterol regulatory element (SRE) is essential for this repression. With the use of an oligonucleotide containing the SRE to screen a human hepatoma complementary DNA expression library, a clone for a DNA binding protein was isolated that binds to the conserved SRE octanucleotide in both a sequence-specific and a single-strand--specific manner. This protein contains seven highly conserved zinc finger repeats that exhibit striking sequence similarity to retroviral nucleic acid binding proteins (NBPs). We have designated the protein "cellular NBP" (CNBP). CNBP is expressed in a wide variety of tissues, is up regulated by sterols, and exhibits binding specificity that correlates with in vivo function. These properties are consistent with a role in sterol-mediated control of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rajavashisth, T B -- Taylor, A K -- Andalibi, A -- Svenson, K L -- Lusis, A J -- HL30568/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):640-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2562787" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Binding Sites ; Carcinoma, Hepatocellular/metabolism ; Cholesterol/biosynthesis ; DNA/*metabolism ; DNA Probes ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation/*drug effects ; Humans ; Hydroxymethylglutaryl CoA Reductases/genetics ; Liver Neoplasms/metabolism ; Metalloproteins/genetics/*metabolism ; Molecular Sequence Data ; Promoter Regions, Genetic ; *RNA-Binding Proteins ; Receptors, LDL/genetics ; *Regulatory Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Sterols/*pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    Publication Date: 1989-01-27
    Description: Techniques of gene amplification, molecular cloning, and sequence analysis were used to test for the presence of sequences related to human T-lymphotropic virus type I (HTLV-I) in peripheral blood mononuclear cells of six patients with multiple sclerosis (MS) and 20 normal individuals. HTLV-I sequences were detected in all six MS patients and in one individual from the control group by DNA blot analysis and molecular cloning of amplified DNAs. The viral sequence in MS patients were associated with adherent cell populations consisting predominantly of monocytes and macrophages. Molecular cloning and nucleotide sequence analysis indicated that these amplified viral sequences were related to the HTLV-I proviral genome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- Sandberg-Wollheim, M -- Mettus, R V -- Ray, P E -- DeFreitas, E -- Koprowski, H -- CA-10815/CA/NCI NIH HHS/ -- NS-11036/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):529-33.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536193" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Adult ; Base Sequence ; Child ; *Cloning, Molecular ; DNA Restriction Enzymes ; DNA, Viral/*genetics ; Female ; *Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Leukocytes, Mononuclear/analysis/microbiology ; Macrophages/analysis/microbiology ; Male ; Molecular Sequence Data ; Multiple Sclerosis/*microbiology ; Nucleic Acid Hybridization ; Oligonucleotide Probes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    Publication Date: 1989-09-08
    Description: Overlapping complementary DNA clones were isolated from epithelial cell libraries with a genomic DNA segment containing a portion of the putative cystic fibrosis (CF) locus, which is on chromosome 7. Transcripts, approximately 6500 nucleotides in size, were detectable in the tissues affected in patients with CF. The predicted protein consists of two similar motifs, each with (i) a domain having properties consistent with membrane association and (ii) a domain believed to be involved in ATP (adenosine triphosphate) binding. A deletion of three base pairs that results in the omission of a phenylalanine residue at the center of the first predicted nucleotide-binding domain was detected in CF patients.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riordan, J R -- Rommens, J M -- Kerem, B -- Alon, N -- Rozmahel, R -- Grzelczak, Z -- Zielenski, J -- Lok, S -- Plavsic, N -- Chou, J L -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1066-73.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475911" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Biological Transport ; Cloning, Molecular/methods ; Cystic Fibrosis/*genetics/metabolism/pathology ; Cystic Fibrosis Transmembrane Conductance Regulator ; DNA/*isolation & purification ; *Genes ; *Genes, Recessive ; Humans ; Ion Channels/pathology ; Membrane Proteins/*genetics/isolation & purification ; Molecular Sequence Data ; Peptides/*genetics/isolation & purification ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    Publication Date: 1989-09-01
    Description: Phenotypic heterogeneity in the repetitive portion of a human malaria circumsporozoite (CS) protein, a major target of candidate vaccines, has been found. Over 14% of clinical cases of uncomplicated Plasmodium vivax malaria at two sites in western Thailand produced sporozoites immunologically distinct from previously characterized examples of the species. Monoclonal antibodies to the CS protein of other P. vivax isolates and to other species of human and simian malarias did not bind to these nonreactive sporozoites, nor did antibodies from monkeys immunized with a candidate vaccine made from the repeat portion of a New World CS protein. The section of the CS protein gene between the conserved regions I and II of a nonreactive isolate contained a nonapeptide repeat, Ala-Asn-Gly-Ala-Gly-Asn-Gln-Pro-Gly, identical at only three amino acid positions with published nonapeptide sequences. This heterogeneity implies that a P. vivax vaccine based on the CS protein repeat of one isolate will not be universally protective.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenberg, R -- Wirtz, R A -- Lanar, D E -- Sattabongkot, J -- Hall, T -- Waters, A P -- Prasittisuk, C -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):973-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Entomology, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672336" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, Surface/*genetics ; Base Sequence ; Gene Amplification ; *Genes ; Humans ; Malaria/parasitology ; Molecular Sequence Data ; Phenotype ; Plasmodium vivax/*genetics/growth & development ; *Protozoan Proteins ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    Publication Date: 1989-06-23
    Description: Adipsin is a serine protease that is secreted by adipocytes into the bloodstream; it is deficient in several animal models of obesity, representing a striking example of defective gene expression in this disorder. Recombinant mouse adipsin was purified and its biochemical and enzymatic properties were studied in order to elucidate the function of this protein. Activated adipsin has little or no proteolytic activity toward most substrates but has the same activity as human complement factor D, cleaving complement factor B when it is complexed with activated complement component C3. Like authentic factor D, adipsin can activate the alternative pathway of complement, resulting in red blood cell lysis. Decreased (58 to 80 percent) complement factor D activity, relative to lean controls, was observed as a common feature of several experimental models of obesity, including the ob/ob, db/db, and monosodium glutamate (MSG)-injected mouse and the fa/fa rat. These results suggest that adipsin and the alternative pathway of complement may play an unexpected but important role in the regulation of systemic energy balance in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosen, B S -- Cook, K S -- Yaglom, J -- Groves, D L -- Volanakis, J E -- Damm, D -- White, T -- Spiegelman, B M -- DK31403/DK/NIDDK NIH HHS/ -- DK34605/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1483-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734615" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/metabolism ; Amino Acid Sequence ; Animals ; Cell Line ; Complement Activating Enzymes/*metabolism ; Complement Factor D/*metabolism ; Complement Pathway, Alternative ; Cricetinae ; DNA/genetics ; Gene Expression Regulation ; Humans ; Immunoblotting ; Mice ; Molecular Sequence Data ; Obesity/genetics/*immunology/metabolism ; RNA, Messenger/metabolism ; Recombinant Proteins ; Serine Endopeptidases/genetics/isolation & purification/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    Publication Date: 1989-12-01
    Description: The crystal structure of Escherichia coli glutaminyl-tRNA synthetase (GlnRS) complexed with its cognate glutaminyl transfer RNA (tRNA(Gln] and adenosine triphosphate (ATP) has been derived from a 2.8 angstrom resolution electron density map and the known protein and tRNA sequences. The 63.4-kilodalton monomeric enzyme consists of four domains arranged to give an elongated molecule with an axial ratio greater than 3 to 1. Its interactions with the tRNA extend from the anticodon to the acceptor stem along the entire inside of the L of the tRNA. The complexed tRNA retains the overall conformation of the yeast phenylalanine tRNA (tRNA(Phe] with two major differences: the 3' acceptor strand of tRNA(Gln) makes a hairpin turn toward the inside of the L, with the disruption of the final base pair of the acceptor stem, and the anticodon loop adopts a conformation not seen in any of the previously determined tRNA structures. Specific recognition elements identified so far include (i) enzyme contacts with the 2-amino groups of guanine via the tRNA minor groove in the acceptor stem at G2 and G3; (ii) interactions between the enzyme and the anticodon nucleotides; and (iii) the ability of the nucleotides G73 and U1.A72 of the cognate tRNA to assume a conformation stabilized by the protein at a lower free energy cost than noncognate sequences. The central domain of this synthetase binds ATP, glutamine, and the acceptor end of the tRNA as well as making specific interactions with the acceptor stem.2+t is〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rould, M A -- Perona, J J -- Soll, D -- Steitz, T A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1135-42.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479982" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/*metabolism ; Amino Acyl-tRNA Synthetases/genetics/*metabolism ; Anticodon ; Base Composition ; Base Sequence ; Binding Sites ; Biological Evolution ; Chemistry, Physical ; Crystallization ; Escherichia coli/*enzymology/genetics ; Molecular Sequence Data ; Molecular Structure ; Nucleic Acid Conformation ; Physicochemical Phenomena ; RNA, Bacterial/*metabolism ; RNA, Fungal ; RNA, Transfer, Amino Acid-Specific/*metabolism ; RNA, Transfer, Gln/*metabolism ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    Publication Date: 1989-09-08
    Description: Complementary DNAs for the beta subunit of the dihydropyridine-sensitive calcium channel of rabbit skeletal muscle were isolated on the basis of peptide sequences derived from the purified protein. The deduced primary structure is without homology to other known protein sequences and is consistent with the beta subunit being a peripheral membrane protein associated with the cytoplasmic aspect of the sarcolemma. The protein contains sites that might be expected to be preferentially phosphorylated by protein kinase C and guanosine 3',5'-monophosphate-dependent protein kinase. A messenger RNA for this protein appears to be expressed in brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ruth, P -- Rohrkasten, A -- Biel, M -- Bosse, E -- Regulla, S -- Meyer, H E -- Flockerzi, V -- Hofmann, F -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1115-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Physiologische Chemie, Medizinische Fakultat, Homburg/Saar, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549640" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Calcium Channel Blockers/*metabolism/pharmacology ; Calcium Channels/drug effects/*metabolism ; Dihydropyridines/*metabolism/pharmacology ; Molecular Sequence Data ; Muscles/*analysis ; Phosphorylation ; Protein Conformation ; RNA, Messenger/isolation & purification ; Rabbits ; Receptors, Nicotinic/drug effects/*isolation & purification/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    Publication Date: 1989-03-10
    Description: An analysis of the aminoacylation kinetics of unmodified yeast tRNAPhe mutants revealed that five single-stranded nucleotides are important for its recognition by yeast phenylalanyl-tRNA synthetase, provided they were positioned correctly in a properly folded tRNA structure. When four other tRNAs were changed to have these five nucleotides, they became near-normal substrates for the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sampson, J R -- DiRenzo, A B -- Behlen, L S -- Uhlenbeck, O C -- GM 37552/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1363-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry and Biochemistry, University of Colorado, Boulder 80309.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646717" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acyl-tRNA Synthetases/*metabolism ; Base Sequence ; Escherichia coli/genetics ; Models, Molecular ; Molecular Sequence Data ; Mutation ; Nucleic Acid Conformation ; Phenylalanine-tRNA Ligase/*metabolism ; Plants/genetics ; RNA, Transfer, Amino Acid-Specific/*genetics ; RNA, Transfer, Phe/*genetics/metabolism ; Schizosaccharomyces/genetics ; Transcription, Genetic ; Triticum/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    Publication Date: 1989-05-19
    Description: Chemical probing methods have been used to "footprint" 16S ribosomal RNA (rRNA) at each step during the in vitro assembly of twenty 30S subunit ribosomal proteins. These experiments yield information about the location of each protein relative to the structure of 16S rRNA and provide the basis for derivation of a detailed model for the three-dimensional folding of 16S rRNA. Several lines of evidence suggest that protein-dependent conformational changes in 16S rRNA play an important part in the cooperativity of ribosome assembly and in fine-tuning of the conformation and dynamics of 16S rRNA in the 30S subunit.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stern, S -- Powers, T -- Changchien, L M -- Noller, H F -- GM-17129/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):783-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Thimann Laboratories, University of California, Santa Cruz 95064.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658053" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Escherichia coli ; Models, Molecular ; Molecular Sequence Data ; Molecular Structure ; Nucleic Acid Conformation ; RNA, Ribosomal/*metabolism ; RNA, Ribosomal, 16S/*metabolism ; Ribosomal Proteins/*metabolism ; Ribosomes/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    Publication Date: 1989-09-29
    Description: Synapsins are neuronal phosphoproteins that coat synaptic vesicles, bind to the cytoskeleton, and are believed to function in the regulation of neurotransmitter release. Molecular cloning reveals that the synapsins comprise a family of four homologous proteins whose messenger RNA's are generated by differential splicing of transcripts from two genes. Each synapsin is a mosaic composed of homologous amino-terminal domains common to all synapsins and different combinations of distinct carboxyl-terminal domains. Immunocytochemical studies demonstrate that all four synapsins are widely distributed in nerve terminals, but that their relative amounts vary among different kinds of synapses. The structural diversity and differential distribution of the four synapsins suggest common and different roles of each in the integration of distinct signal transduction pathways that modulate neurotransmitter release in various types of neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sudhof, T C -- Czernik, A J -- Kao, H T -- Takei, K -- Johnston, P A -- Horiuchi, A -- Kanazir, S D -- Wagner, M A -- Perin, M S -- De Camilli, P -- AA 06944/AA/NIAAA NIH HHS/ -- MH 39327/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1474-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Dallas, TX.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Molecular Sequence Data ; Nerve Tissue Proteins/*genetics ; Neuropeptides/*genetics ; Phosphoproteins/*genetics ; Sequence Homology, Nucleic Acid ; Structure-Activity Relationship ; Synapsins ; Synaptic Vesicles/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    Publication Date: 1989-09-22
    Description: Sera from patients with autoimmune diseases often contain antibodies that bind ribonucleoproteins (RNPs). Sera from 30 such patients were found to immunoprecipitate ribonuclease P (RNase P), an RNP enzyme required to process the 5' termini of transfer RNA transcripts in nuclei and mitochondria of eukaryotic cells. All 30 sera also immunoprecipitated the nucleolar Th RNP, indicating that the two RNPs are structurally related. Nucleotide sequence analysis of the Th RNP revealed it was identical to the RNA component of the mitochondrial RNA processing enzyme known as RNase MRP. Antibodies that immunoprecipitated the Th RNP selectively depleted murine and human cell extracts of RNase MRP activity, indicating that the Th and RNase MRP RNPs are identical. Since RNase P and RNase MRP are not associated with each other during biochemical purification, we suggest that these two RNA processing enzymes share a common autoantigenic polypeptide.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gold, H A -- Topper, J N -- Clayton, D A -- Craft, J -- AI 26853/AI/NIAID NIH HHS/ -- GM 33088-19/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1377-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Yale University School of Medicine, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476849" target="_blank"〉PubMed〈/a〉
    Keywords: *Autoantigens ; Base Sequence ; Cell Nucleus/enzymology ; *Endoribonucleases/analysis/immunology ; Humans ; Mitochondria/enzymology ; Molecular Sequence Data ; RNA/analysis ; *RNA Processing, Post-Transcriptional ; Ribonuclease P ; *Ribonucleoproteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: Analysis of crosslinked complexes of M1 RNA, the catalytic RNA subunit of ribonuclease P from Escherichia coli, and transfer RNA precursor substrates has led to the identification of regions in the enzyme and in the substrate that are in close physical proximity to each other. The nucleotide in M1 RNA, residue C92, which participates in a crosslink with the substrate was deleted and the resulting mutant M1 RNA was shown to cleave substrates lacking the 3' terminal CCAUCA sequence at sites several nucleotides away from the normal site of cleavage. The presence or absence of the 3' terminal CCAUCA sequence in transfer RNA precursor substrates markedly affects the way in which these substrates interact with the catalytic RNA in the enzyme-substrate complex. The contacts between wild-type M1 RNA and its substrate are in a region that resembles part of the transfer RNA "E" (exit) site in 23S ribosomal RNA. These data demonstrate that in RNA's with very different cellular functions, there are domains with similar structural and functional properties and that there is a nucleotide in M1 RNA that affects the site of cleavage by the enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Guerrier-Takada, C -- Lumelsky, N -- Altman, S -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1578-84.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Yale University, New Haven, CT 06520.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480641" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Endoribonucleases/genetics/*metabolism ; Escherichia coli/enzymology/*genetics ; *Escherichia coli Proteins ; Kinetics ; Molecular Sequence Data ; Nucleic Acid Conformation ; RNA Precursors/genetics ; RNA, Bacterial/*genetics/metabolism ; RNA, Transfer/genetics ; Ribonuclease P ; Substrate Specificity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 82
    Publication Date: 1989-05-05
    Description: Interleukin-2 (IL-2) binds to two distinct receptor molecules, the IL-2 receptor alpha (IL-2R alpha, p55) chain and the newly identified IL-2 receptor beta (IL-2R beta, p70-75) chain. The cDNA encoding the human IL-2R beta chain has now been isolated. The overall primary structure of the IL-2R beta chain shows no apparent homology to other known receptors. Unlike the IL-2R alpha chain, the IL-2R beta chain has a large cytoplasmic region in which a functional domain (or domains) mediating an intracellular signal transduction pathway (or pathways) may be embodied. The cDNA-encoded beta chain binds and internalizes IL-2 when expressed on T lymphoid cells but not fibroblast cells. Furthermore, the cDNA gives rise to the generation of high-affinity IL-2 receptor when co-expressed with the IL-2R alpha chain cDNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hatakeyama, M -- Tsudo, M -- Minamoto, S -- Kono, T -- Doi, T -- Miyata, T -- Miyasaka, M -- Taniguchi, T -- New York, N.Y. -- Science. 1989 May 5;244(4904):551-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785715" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; Cross-Linking Reagents ; DNA/*genetics/isolation & purification ; Fibroblasts/metabolism ; Gene Expression Regulation ; Humans ; Interleukin-2/metabolism ; Leukemia ; Molecular Sequence Data ; Nucleic Acid Hybridization ; RNA, Messenger/genetics ; Receptors, Interleukin-2/*genetics/metabolism ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Signal Transduction ; Succinimides ; T-Lymphocytes/metabolism ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 83
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 84
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 85
    Publication Date: 1989-08-18
    Description: Two distinct CD3-associated T cell receptors (TCR alpha beta and TCR gamma delta) are expressed in a mutually exclusive fashion on separate subsets of T lymphocytes. While the specificity of the TCR alpha beta repertoire for major histocompatibility complex (MHC) antigens is well established, the diversity of expressed gamma delta receptors and the ligands they recognize are less well understood. An alloreactive CD3+CD4-CD8- T cell line specific for murine class II MHC (Ia) antigens encoded in the I-E subregion of the H-2 gene complex was identified, and the primary structure of its gamma delta receptor heterodimer was characterized. In contrast to a TCR alpha beta-expressing alloreactive T cell line selected for similar specificity, the TCR gamma delta line displayed broad cross-reactivity for multiple distinct I-E-encoded allogeneic Ia molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matis, L A -- Fry, A M -- Cron, R Q -- Cotterman, M M -- Dick, R F -- Bluestone, J A -- 5-T32AI07090-10/AI/NIAID NIH HHS/ -- CA-14599-15/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):746-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biochemistry and Biophysics, Food and Drug Administration, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2528206" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Antigens, CD3 ; Antigens, Differentiation, T-Lymphocyte/analysis/immunology ; Base Sequence ; Cell Line ; Cloning, Molecular ; Cytotoxicity, Immunologic ; H-2 Antigens/genetics/immunology ; Histocompatibility Antigens Class II/genetics/*immunology ; Hybridomas/immunology ; Immunosorbent Techniques ; Macromolecular Substances ; Mice ; Mice, Nude ; Molecular Sequence Data ; Receptors, Antigen, T-Cell/analysis/genetics/*immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 86
    Publication Date: 1989-02-10
    Description: A genomic sequence and cloned complementary DNA has been identified for a novel receptor-like gene of the PDGF receptor/CSF1 receptor subfamily (platelet-derived growth factor receptor/colony-stimulating factor type 1 receptor). The gene recognized a 6.4-kilobase transcript that was coexpressed in normal human tissues with the 5.3-kilobase PDGF receptor messenger RNA. Introduction of complementary DNA of the novel gene into COS-1 cells led to expression of proteins that were specifically detected with antiserum directed against a predicted peptide. When the new gene was transfected into COS-1 cells, a characteristic pattern of binding of the PDGF isoforms was observed, which was different from the pattern observed with the known PDGF receptor. Tyrosine phosphorylation of the receptor in response to the PDGF isoforms was also different from the known receptor. The new PDGF receptor gene was localized to chromosome 4q11-4q12. The existence of genes encoding two PDGF receptors that interact in a distinct manner with three different PDGF isoforms likely confers considerable regulatory flexibility in the functional responses to PDGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matsui, T -- Heidaran, M -- Miki, T -- Popescu, N -- La Rochelle, W -- Kraus, M -- Pierce, J -- Aaronson, S -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):800-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536956" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Cells, Cultured ; *Chromosomes, Human, Pair 4 ; Cloning, Molecular ; DNA/genetics ; Gene Expression Regulation ; *Genes ; Humans ; Molecular Sequence Data ; Multigene Family ; Platelet-Derived Growth Factor/*physiology ; Protein-Tyrosine Kinases/genetics ; RNA, Messenger/genetics ; Receptors, Cell Surface/*genetics ; Receptors, Platelet-Derived Growth Factor ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 87
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 88
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-28
    Description: The cloning of genes encoding mammalian DNA binding transcription factors for RNA polymerase II has provided the opportunity to analyze the structure and function of these proteins. This review summarizes recent studies that define structural domains for DNA binding and transcriptional activation functions in sequence-specific transcription factors. The mechanisms by which these factors may activate transcriptional initiation and by which they may be regulated to achieve differential gene expression are also discussed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mitchell, P J -- Tjian, R -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):371-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2667136" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Binding Sites ; Cloning, Molecular ; DNA-Binding Proteins/*genetics/metabolism ; Gene Expression Regulation ; Molecular Sequence Data ; Protein Processing, Post-Translational ; RNA Polymerase II/*genetics/metabolism ; Repetitive Sequences, Nucleic Acid ; Transcription Factors/*genetics/metabolism ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 89
    Publication Date: 1989-11-17
    Description: The zona pellucida surrounding mouse oocytes is an extracellular matrix composed of three sulfated glycoproteins, ZP1, ZP2, and ZP3. It has been demonstrated that a monoclonal antibody to ZP3 injected into female mice inhibits fertilization by binding to the zona pellucida and blocking sperm penetration. A complementary DNA encoding ZP3 was randomly cleaved and 200- to 1000-base pair fragments were cloned into the expression vector lambda gt11. This epitope library was screened with the aforementioned contraceptive antibody, and the positive clones were used to map the seven-amino acid epitope recognized by the antibody. Female mice were immunized with a synthetic peptide containing this B cell epitope coupled to a carrier protein to provide helper T cell epitopes. The resultant circulating antibodies to ZP3 bound to the zona pellucida of immunized animals and produced long-lasting contraception. The lack of ovarian histopathology or cellular cytotoxicity among the immunized animals may be because of the absence of zona pellucida T cell epitopes in this vaccine.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millar, S E -- Chamow, S M -- Baur, A W -- Oliver, C -- Robey, F -- Dean, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):935-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479101" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens/immunology ; Base Sequence ; Cloning, Molecular ; *Contraception ; *Contraception, Immunologic ; DNA/genetics ; *Egg Proteins ; Epitopes/analysis ; Female ; Glycoproteins/genetics/*immunology ; Male ; *Membrane Glycoproteins ; Mice ; Molecular Sequence Data ; Ovum/*physiology ; Protein Conformation ; RNA, Messenger/genetics ; *Receptors, Cell Surface ; *Vaccination ; Zona Pellucida/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 90
    Publication Date: 1989-12-01
    Description: The structure of a complex between a peptide inhibitor with the sequence N-acetyl-Thr-Ile-Nle-psi[CH2-NH]-Nle-Gln-Arg.amide (Nle, norleucine) with chemically synthesized HIV-1 (human immunodeficiency virus 1) protease was determined at 2.3 A resolution (R factor of 0.176). Despite the symmetric nature of the unliganded enzyme, the asymmetric inhibitor lies in a single orientation and makes extensive interactions at the interface between the two subunits of the homodimeric protein. Compared with the unliganded enzyme, the protein molecule underwent substantial changes, particularly in an extended region corresponding to the "flaps" (residues 35 to 57 in each chain), where backbone movements as large as 7 A are observed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, M -- Schneider, J -- Sathyanarayana, B K -- Toth, M V -- Marshall, G R -- Clawson, L -- Selk, L -- Kent, S B -- Wlodawer, A -- A-127302/PHS HHS/ -- N01-C0-74101/PHS HHS/ -- SM-24483/SM/CMHS SAMHSA HHS/ -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1149-52.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉NCI-Frederick Cancer Research Facility, BRI-Basic Research Program, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686029" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Binding Sites ; Chemistry, Physical ; Crystallization ; Endopeptidases/*metabolism ; Gene Products, gag/metabolism ; HIV Protease ; HIV-1/*enzymology ; Hydrogen Bonding ; Molecular Sequence Data ; Molecular Structure ; Oligopeptides/*metabolism ; Physicochemical Phenomena ; Protease Inhibitors/*metabolism ; Protein Conformation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 91
    Publication Date: 1989-08-11
    Description: Cadherins are a family of Ca2+-dependent intercellular adhesion molecules. Complementary DNAs encoding mouse neural cadherin (N-cadherin) were cloned, and the cell binding specificity of this molecule was examined. Mouse N-cadherin shows 92 percent similarity in amino acid sequence to the chicken homolog, while it shows 49 percent and 43 percent similarity to epithelial cadherin and to placental cadherin of the same species, respectively. In cell binding assays, mouse N-cadherin did not cross-react with other mouse cadherins, but it did cross-react with chicken N-cadherin. The results indicate that each cadherin type confers distinct adhesive specificities on different cells, and also that the specificity of N-cadherin is conserved between mammalian and avian cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miyatani, S -- Shimamura, K -- Hatta, M -- Nagafuchi, A -- Nose, A -- Matsunaga, M -- Hatta, K -- Takeichi, M -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):631-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Faculty of Science, Kyoto University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2762814" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Antigens, Surface/genetics/*physiology ; Base Sequence ; Brain Chemistry ; *Cell Adhesion ; Cell Adhesion Molecules ; Chickens ; Cloning, Molecular ; DNA/genetics ; Embryo, Mammalian ; Embryo, Nonmammalian ; L Cells (Cell Line) ; Mice ; Molecular Sequence Data ; Nerve Tissue/*analysis ; Nucleic Acid Hybridization ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 92
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 93
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: In vivo protein-DNA interactions at the developmentally regulated enhancer of the mouse muscle creatine kinase (MCK) gene were examined by a newly developed polymerase chain reaction (PCR) footprinting procedure. This ligation mediated, single-sided PCR technique permits the exponential amplification of an entire sequence ladder. Several footprints were detected in terminally differentiated muscle cells where the MCK gene is actively transcribed. None were observed in myogenic cells prior to differentiation or in nonmuscle cells. Two footprints appear to correspond to sites that can bind the myogenic regulator MyoD1 in vitro, whereas two others represent muscle specific use of apparently general factors. Because MyoD1 is synthesized by undifferentiated myoblasts, these data imply that additional regulatory mechanisms must restrict the interaction between this protein and its target site prior to differentiation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mueller, P R -- Wold, B -- GM35526/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):780-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814500" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Cell Line ; Creatine Kinase/*genetics ; DNA/*analysis/metabolism ; DNA-Binding Proteins/genetics/metabolism ; *Enhancer Elements, Genetic ; *Gene Amplification ; Gene Expression ; Genes, Regulator ; Mice ; Molecular Sequence Data ; Muscles/*enzymology ; *Polymerase Chain Reaction ; Protein Binding ; Protein Processing, Post-Translational ; Templates, Genetic ; Transcription Factor AP-2 ; Transcription Factors/genetics/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 94
    Publication Date: 1989-08-25
    Description: Blue cone monochromacy is a rare X-linked disorder of color vision characterized by the absence of both red and green cone sensitivities. In 12 of 12 families carrying this trait, alterations are observed in the red and green visual pigment gene cluster. The alterations fall into two classes. One class arose from the wild type by a two-step pathway consisting of unequal homologous recombination and point mutation. The second class arose by nonhomologous deletion of genomic DNA adjacent to the red and green pigment gene cluster. These deletions define a 579-base pair region that is located 4 kilobases upstream of the red pigment gene and 43 kilobases upstream of the nearest green pigment gene; this 579-base pair region is essential for the activity of both pigment genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nathans, J -- Davenport, C M -- Maumenee, I H -- Lewis, R A -- Hejtmancik, J F -- Litt, M -- Lovrien, E -- Weleber, R -- Bachynski, B -- Zwas, F -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):831-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology and Genetics, Wilmer Ophthalmologic Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2788922" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Adult ; Base Sequence ; Child ; Child, Preschool ; Chromosome Deletion ; Color Vision Defects/*genetics ; DNA/analysis ; Female ; Humans ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Retinal Pigments/genetics ; Thalassemia/genetics ; X Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 95
    Publication Date: 1989-12-22
    Description: T cell clones obtained from a human volunteer immunized with Plasmodium falciparum sporozoites specifically recognized the native circumsporozoite (CS) antigen expressed on P. falciparum sporozoites, as well as bacteria- and yeast-derived recombinant falciparum CS proteins. The response of these CD4+ CD8- cells was species-specific, since the clones did not proliferate or secrete gamma interferon when challenged with sporozoites or recombinant CS proteins of other human, simian, or rodent malarias. The epitope recognized by the sporozoite-specific human T cell clones mapped to the 5' repeat region of the CS protein and was contained in the NANPNVDPNANP sequence.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nardin, E H -- Herrington, D A -- Davis, J -- Levine, M -- Stuber, D -- Takacs, B -- Caspers, P -- Barr, P -- Altszuler, R -- Clavijo, P -- AI25085/AI/NIAID NIH HHS/ -- AI62533/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1603-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical and Molecular Parasitology, New York University, NY 10010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, CD4/*immunology ; Antigens, Protozoan/*immunology ; Cells, Cultured ; Clone Cells ; Epitopes/*analysis ; Humans ; Interferon-gamma/biosynthesis ; Lymphocyte Activation ; Malaria/*immunology ; Molecular Sequence Data ; Plasmodium falciparum/*immunology ; *Protozoan Proteins ; Recombinant Proteins/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 96
    Publication Date: 1989-08-04
    Description: The crystal structure of glycogen phosphorylase a complexed with its substrates, orthophosphate and maltopentaose, has been determined and refined at a resolution of 2.8 angstroms. With oligosaccaride bound at the glycogen storage site, the phosphate ion binds at the catalytic site and causes the regulatory and catalytic domains to separate with the loss of stabilizing interactions between them. Homotropic cooperativity between the active sites of the allosteric dimer results from rearrangements in isologous contacts between symmetry-related helices in the subunit interface. The conformational changes in the core of the interface are correlated with those observed on covalent activation by phosphorylation at Ser14 (phosphorylase b----a).〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goldsmith, E J -- Sprang, S R -- Hamlin, R -- Xuong, N H -- Fletterick, R J -- DK31507-05/DK/NIDDK NIH HHS/ -- GM00085-05/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):528-32.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas 75235.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2756432" target="_blank"〉PubMed〈/a〉
    Keywords: Allosteric Site ; Amino Acid Sequence ; Binding Sites ; Catalysis ; Crystallization ; Crystallography ; Enzyme Activation ; Glucosephosphates/metabolism ; Glycogen/metabolism ; Macromolecular Substances ; Molecular Sequence Data ; Molecular Structure ; Oligosaccharides ; Phosphates/metabolism ; Phosphorylase a/*metabolism ; Phosphorylases/*metabolism ; Protein Conformation ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 97
    Publication Date: 1989-11-03
    Description: Transcription of the yeast CYC1 promoter fused to a sequence lacking guanosine residues provided a rapid, sensitive assay of initiation by RNA polymerase II in yeast extracts. Initiation was enhanced by yeast and mammalian activator proteins. The adenoviral major late promoter fused to the G-minus sequence was transcribed in yeast extracts with an efficiency comparable to that observed in HeLa extracts, showing that promoters as well as transcription factors are functionally interchangeable across species. Initiation occurred at different sites, approximately 30 and 63 to 69 base pairs downstream of the TATA element of the adenoviral promoter in HeLa and yeast extracts, respectively, distances characteristic of initiation in the two systems in vivo. A component of the transcription system and not the promoter sequence determines the distance to the initiation site.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lue, N F -- Flanagan, P M -- Sugimoto, K -- Kornberg, R D -- GM36659/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):661-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Beckman Laboratories, Fairchild Center, Stanford School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510298" target="_blank"〉PubMed〈/a〉
    Keywords: Adenoviruses, Human/*genetics ; Base Sequence ; GTP-Binding Proteins/genetics ; *Genes, Fungal ; HeLa Cells/metabolism ; Humans ; Molecular Sequence Data ; Oligonucleotide Probes ; *Promoter Regions, Genetic ; RNA Polymerase II/*metabolism ; Saccharomyces cerevisiae/enzymology/*genetics ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 98
    Publication Date: 1989-06-23
    Description: In prokaryotes and eukaryotes mobile genetic elements frequently disrupt the highly conservative structures of chromosomes, which are responsible for storage of genetic information. The factors determining the site for integration of such elements are still unknown. Transfer RNA (tRNA) genes are associated in a highly significant manner with different putative mobile genetic elements in the cellular slime mold Dictyostelium discoideum. These results suggest that tRNA genes in D. discoideum, and probably tRNA genes generally in lower eukaryotes, may function as genomic landmarks for the integration of different transposable elements in a strictly position-specific manner.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marschalek, R -- Brechner, T -- Amon-Bohm, E -- Dingermann, T -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1493-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Biochemie der Medizinischen Fakultat, Universitat Erlangen-Nurnberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2567533" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Chromosome Mapping ; Dictyostelium/*genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Oligonucleotide Probes ; Polymorphism, Restriction Fragment Length ; RNA, Transfer/*genetics ; RNA, Transfer, Glu/genetics ; RNA, Transfer, Lys/genetics ; RNA, Transfer, Val/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 99
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hiesel, R -- Wissinger, B -- Schuster, W -- Brennicke, A -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1632-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Genbiologische Forschung, Berlin, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480644" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA, Mitochondrial/genetics ; Electron Transport Complex IV/*genetics ; *Genes, Plant ; Humans ; Mitochondria/*enzymology ; Molecular Sequence Data ; Plants/enzymology/*genetics ; RNA/*genetics ; RNA Processing, Post-Transcriptional ; RNA, Messenger/genetics ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 100
    Publication Date: 1989-01-27
    Description: Differential gene expression in the mother cell chamber of sporulating cells of Bacillus subtilis is determined in part by an RNA polymerase sigma factor called sigma K (or sigma 27). The sigma K factor was assigned as the product of the sporulation gene spoIVCB on the basis of the partial aminoterminal amino acid sequence of the purified protein. The spoIVCB gene is now shown to be a truncated gene capable of specifying only the amino terminal half of sigma K. The carboxyl terminal half is specified by another sporulation gene, spoIIIC, to which spoIVCB becomes joined inframe at an intermediate stage of sporulation by site-specific recombination within a 5-base pair repeated sequence. Juxtaposition of spoIVCB and spoIIIC need not be reversible in that the mother cell and its chromosome are discarded at the end of the developmental cycle. The rearrangement of chromosomal DNA could account for the presence of sigma K selectively in the mother cell and may be a precedent for the generation of cell type-specific regulatory proteins in other developmental systems where cells undergo terminal differentiation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stragier, P -- Kunkel, B -- Kroos, L -- Losick, R -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):507-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cellular and Developmental Biology, Harvard University, Cambridge, MA 02138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536191" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Bacillus subtilis/*genetics/physiology ; Base Sequence ; Cloning, Molecular ; DNA Probes ; DNA Restriction Enzymes ; DNA, Bacterial/genetics ; DNA-Directed RNA Polymerases/metabolism ; *Gene Expression Regulation ; *Gene Rearrangement ; *Genes, Bacterial ; Molecular Sequence Data ; Molecular Weight ; Mutation ; Nucleic Acid Hybridization ; Sigma Factor/genetics ; Spores, Bacterial ; Transcription Factors/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...