ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Rats  (225)
  • American Association for the Advancement of Science (AAAS)  (225)
  • Periodicals Archive Online (PAO)
  • 2000-2004
  • 1990-1994  (152)
  • 1985-1989  (73)
  • 1965-1969
  • 1994  (75)
  • 1992  (77)
  • 1989  (73)
  • 1983
Collection
Keywords
Publisher
  • American Association for the Advancement of Science (AAAS)  (225)
  • Periodicals Archive Online (PAO)
  • Springer  (2)
Years
  • 2000-2004
  • 1990-1994  (152)
  • 1985-1989  (73)
  • 1965-1969
  • 1980-1984  (150)
Year
  • 1
    facet.materialart.
    Unknown
    Specific recognition of cruciform DNA by nuclear protein HMG1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-24
    Description: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Expression of functional nerve growth factor receptors after gene transfer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Indole-2-carboxylic acid: a competitive antagonist of potentiation by glycine at the NMDA receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-24
    Description: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    Effects of glucocorticoids and norepinephrine on the excitability in the hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Fibroblasts transformed with v-src show enhanced formation of an inositol tetrakisphosphate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Golf: an olfactory neuron specific-G protein involved in odorant signal transduction (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Keywords: Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    Increased expression of DNA cointroduced with nuclear protein in adult rat liver (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    Corticosteroid modulation of hippocampal potentials: increased effect with aging (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    Potassium channels in cardiac cells activated by arachidonic acid and phospholipids (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 11
    facet.materialart.
    Unknown
    The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 12
    facet.materialart.
    Unknown
    Secretion of activin by interstitial cells in the testis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Keywords: Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 13
    facet.materialart.
    Unknown
    Atrial natriuretic peptide inhibits a cation channel in renal inner medullary collecting duct cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Keywords: Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 14
    facet.materialart.
    Unknown
    Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 15
    facet.materialart.
    Unknown
    Specific block of calcium channel expression by a fragment of dihydropyridine receptor cDNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-02-03
    Description: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Keywords: 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 16
    facet.materialart.
    Unknown
    Pavlovian conditioning of rat mucosal mast cells to secrete rat mast cell protease II (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 17
    facet.materialart.
    Unknown
    Relation of the amyloid beta protein precursor to heparan sulfate proteoglycans (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 18
    facet.materialart.
    Unknown
    Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Keywords: 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 19
    facet.materialart.
    Unknown
    A pertussis toxin-sensitive G protein in hippocampal long-term potentiation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-26
    Description: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 20
    facet.materialart.
    Unknown
    Quisqualate activates a rapidly inactivating high conductance ionic channel in hippocampal neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 21
    facet.materialart.
    Unknown
    Beta-adrenergic inhibition of cardiac sodium channels by dual G-protein pathways (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Keywords: 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 22
    facet.materialart.
    Unknown
    Brain region and gene specificity of neuropeptide gene expression in cultured astrocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-28
    Description: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 23
    facet.materialart.
    Unknown
    Inescapable versus escapable shock modulates long-term potentiation in the rat hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-14
    Description: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 24
    facet.materialart.
    Unknown
    Transneuronal transfer of herpes virus from peripheral nerves to cortex and brainstem (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-06
    Description: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 25
    facet.materialart.
    Unknown
    High probability opening of NMDA receptor channels by L-glutamate (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-01-24
    Description: Synaptic plasticity can be triggered by calcium flux into neurons through synaptically activated N-methyl-D-aspartate (NMDA) receptor channels. The amplitude and time course of the resulting intracellular calcium transient depend on the number of open NMDA receptor channels and the kinetics of their activation. Short applications of L-glutamate to outside-out patches from hippocampal neurons in the presence and absence of MK-801 revealed that about 30 percent of L-glutamate-bound channels are open at the peak of the current. This high probability of opening suggests that very few channels are required to guarantee a large, localized postsynaptic calcium transient.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jahr, C E -- NS21419/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 Jan 24;255(5043):470-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Vollum Institute L474, Oregon Health Sciences University, Portland 97201.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1346477" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Cells, Cultured ; Dizocilpine Maleate/pharmacology ; Glutamates/*physiology ; Glutamic Acid ; Hippocampus/physiology ; In Vitro Techniques ; *Ion Channel Gating ; Rats ; Receptors, N-Methyl-D-Aspartate/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 26
    facet.materialart.
    Unknown
    Syntaxin: a synaptic protein implicated in docking of synaptic vesicles at presynaptic active zones (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-07-10
    Description: Synaptic vesicles store neurotransmitters that are released during calcium-regulated exocytosis. The specificity of neurotransmitter release requires the localization of both synaptic vesicles and calcium channels to the presynaptic active zone. Two 35-kilodalton proteins (p35 or syntaxins) were identified that interact with the synaptic vesicle protein p65 (synaptotagmin). The p35 proteins are expressed only in the nervous system, are 84 percent identical, include carboxyl-terminal membrane anchors, and are concentrated on the plasma membrane at synaptic sites. An antibody to p35 immunoprecipitated solubilized N-type calcium channels. The p35 proteins may function in docking synaptic vesicles near calcium channels at presynaptic active zones.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bennett, M K -- Calakos, N -- Scheller, R H -- 2T32G07365/PHS HHS/ -- New York, N.Y. -- Science. 1992 Jul 10;257(5067):255-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular and Cellular Physiology, Stanford University Medical Center, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1321498" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; *Antigens, Surface ; *Calcium-Binding Proteins ; Electrophoresis, Polyacrylamide Gel ; Immunoblotting ; Membrane Glycoproteins/physiology ; Molecular Sequence Data ; Nerve Tissue Proteins/isolation & purification/*physiology ; Oligonucleotide Probes ; Rats ; Sequence Homology, Nucleic Acid ; Synaptic Transmission/physiology ; Synaptic Vesicles/*physiology ; Synaptotagmin I ; Synaptotagmins ; Syntaxin 1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 27
    facet.materialart.
    Unknown
    Requirement for the adenovirus type 9 E4 region in production of mammary tumors (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-09-07
    Description: Oncogenic viruses demonstrating a strict tropism for the mammary gland provide special opportunities to study the susceptibility of this tissue to neoplasia. In rats, human adenovirus type 9 (Ad9) elicits mammary fibroadenomas that are similar to common breast tumors in women, as well as phyllodes-like tumors and mammary sarcomas. By constructing recombinant adenoviruses between Ad9 and Ad26 (a related nontumorigenic virus), it was shown that the Ad9 E4 region was absolutely required to produce these mammary tumors. This indicates that an adenovirus gene located outside the classic transforming region (E1) can significantly influence the in vivo oncogenicity of an adenovirus. Consistent with a direct role in mammary gland oncogenesis, the Ad9 E4 region also exhibited transforming properties in vitro. Therefore, the Ad9 E4 region is a viral oncogene specifically involved in mammary gland tumorigenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Javier, R -- Raska, K Jr -- Shenk, T -- CA 21196/CA/NCI NIH HHS/ -- CA 41086/CA/NCI NIH HHS/ -- T32 CA09528/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1992 Aug 28;257(5074):1267-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology, Princeton University, NJ 08544.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1519063" target="_blank"〉PubMed〈/a〉
    Keywords: Adenoviridae/genetics/*pathogenicity ; Amino Acid Sequence ; Animals ; Cell Transformation, Neoplastic/*genetics ; Chromosome Mapping ; Female ; Mammary Neoplasms, Experimental/*genetics/*microbiology ; Molecular Sequence Data ; Open Reading Frames/genetics ; Rats ; Rats, Inbred WF ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 28
    facet.materialart.
    Unknown
    Exaggerated carcinogenicity of chemicals (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-06-19
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Abelson, P H -- New York, N.Y. -- Science. 1992 Jun 19;256(5064):1609.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1609271" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Butadienes/*toxicity ; *Carcinogenicity Tests ; Haplorhini ; Humans ; Mice ; Neoplasms/*chemically induced ; Rats ; Risk
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 29
    facet.materialart.
    Unknown
    Repression of the insulin-like growth factor II gene by the Wilms tumor suppressor WT1 (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-07-31
    Description: The Wilms tumor suppressor gene wt1 encodes a zinc finger DNA binding protein, WT1, that functions as a transcriptional repressor. The fetal mitogen insulin-like growth factor II (IGF-II) is overexpressed in Wilms tumors and may have autocrine effects in tumor progression. The major fetal IGF-II promoter was defined in transient transfection assays as a region spanning from nucleotides -295 to +135, relative to the transcription start site. WT1 bound to multiple sites in this region and functioned as a potent repressor of IGF-II transcription in vivo. Maximal repression was dependent on the presence of WT1 binding sites on each side of the transcriptional initiation site. These findings provide a molecular basis for overexpression of IGF-II in Wilms tumors and suggest that WT1 negatively regulates blastemal cell proliferation by limiting the production of a fetal growth factor in the developing vertebrate kidney.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Drummond, I A -- Madden, S L -- Rohwer-Nutter, P -- Bell, G I -- Sukhatme, V P -- Rauscher, F J 3rd -- CA 10817/CA/NCI NIH HHS/ -- CA 47983/CA/NCI NIH HHS/ -- CA 52009/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1992 Jul 31;257(5070):674-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of Chicago, IL 60637.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1323141" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Blotting, Northern ; DNA/chemistry/metabolism ; DNA-Binding Proteins/*metabolism ; Deoxyribonuclease I/metabolism ; *Gene Expression Regulation, Neoplastic ; Genes, Wilms Tumor/*physiology ; Humans ; Insulin-Like Growth Factor II/*genetics ; Kidney/embryology/metabolism ; Mice ; Molecular Sequence Data ; Promoter Regions, Genetic ; Rats ; Sequence Homology, Nucleic Acid ; Transfection ; WT1 Proteins ; Wilms Tumor/genetics/metabolism ; Zinc Fingers
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 30
    facet.materialart.
    Unknown
    Cholecystokinin antianalgesia: safety cues abolish morphine analgesia (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-08
    Description: Environmental stimuli that signal the occurrence of aversive or dangerous events activate endogenous opiate analgesia systems. Signals for safety (the nonoccurrence of aversive events) produce the opposite and inhibit environmentally produced analgesia. Stimuli that signal safety are now shown to abolish the analgesic effect of morphine, even when morphine is applied directly to spinal cord. Further, this antiopiate effect occurs because the environmental stimulus leads to release of the neuropeptide cholecystokinin in the spinal cord. This process may contribute to the regulation of pain and the development of opiate tolerance.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wiertelak, E P -- Maier, S F -- Watkins, L R -- 5T32MH14617-15/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1992 May 8;256(5058):830-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Colorado, Boulder 80309.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1589765" target="_blank"〉PubMed〈/a〉
    Keywords: *Analgesia ; Animals ; Benzodiazepinones/pharmacology ; Cholecystokinin/*pharmacology ; Injections, Spinal ; Morphine/administration & dosage/antagonists & inhibitors/*pharmacology ; Pain/physiopathology ; *Phenylurea Compounds ; Rats ; Receptors, Cholecystokinin/antagonists & inhibitors/*physiology ; Safety ; Spinal Cord/drug effects/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 31
    facet.materialart.
    Unknown
    Chondroitin sulfate as a regulator of neuronal patterning in the retina (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-02-07
    Description: Highly sulfated proteoglycans are correlated with axon boundaries in the developing central nervous system which suggests that these molecules affect neural pattern formation. In the developing mammalian retina, gradual regression of chondroitin sulfate may help control the onset of ganglion cell differentiation and initial direction of their axons. Changes induced by the removal of chondroitin sulfate from intact retinas in culture confirm the function of chondroitin sulfate in retinal histogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Brittis, P A -- Canning, D R -- Silver, J -- New York, N.Y. -- Science. 1992 Feb 7;255(5045):733-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurosciences, Case Western Reserve University, Cleveland, OH 44106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1738848" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Axons/physiology ; Cell Differentiation/drug effects ; Cells, Cultured ; Chondroitin Lyases/pharmacology ; Chondroitin Sulfate Proteoglycans/pharmacology ; Chondroitin Sulfates/analysis/*physiology ; Immunohistochemistry ; Rats ; Retina/chemistry/cytology/*embryology ; Retinal Ganglion Cells/chemistry/*cytology ; Tubulin/analysis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 32
    facet.materialart.
    Unknown
    Activity-dependent decrease in NMDA receptor responses during development of the visual cortex (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-11-06
    Description: Plasticity of the developing visual system has been regarded as the best model for changes of neuronal connections under the influence of the environment. N-methyl-D-aspartate (NMDA) receptors are crucial for experience-dependent synaptic modifications that occur in the developing visual cortex. NMDA-mediated excitatory postsynaptic currents (EPSCs) in layer IV neurons of the visual cortex lasted longer in young rats than in adult rats, and the duration of the EPSCs became progressively shorter, in parallel with the developmental reduction in synaptic plasticity. This decrease in NMDA receptor-mediated EPSC duration is delayed when the animals are reared in the dark, a condition that prolongs developmental plasticity, and is prevented by treatment with tetrodotoxin, a procedure that inhibits neural activity. Application of L-glutamate to outside-out patches excised from layer IV neurons of young, but not of adult, rats activated prolonged bursts of NMDA channel openings. A modification of the NMDA receptor gating properties may therefore account for the age-dependent decline of visual cortical plasticity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Carmignoto, G -- Vicini, S -- P01 NS 28130-01/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 Nov 6;258(5084):1007-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉FIDIA Georgetown Institute for the Neurosciences, Georgetown University School of Medicine, Washington, DC 20007.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1279803" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials ; Aging/physiology ; Animals ; Electric Conductivity ; Glutamates/pharmacology ; Glutamic Acid ; Ion Channel Gating/physiology ; Ion Channels/physiology ; Neuronal Plasticity/physiology ; Neurons/drug effects/physiology ; Rats ; Receptors, N-Methyl-D-Aspartate/*physiology ; Synapses/physiology ; Tetrodotoxin/pharmacology ; Visual Cortex/*growth & development/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 33
    facet.materialart.
    Unknown
    Interleukin-8 as a macrophage-derived mediator of angiogenesis (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-12-11
    Description: Angiogenic factors produced by monocytes-macrophages are involved in the pathogenesis of chronic inflammatory disorders characterized by persistent angiogenesis. The possibility was tested that interleukin-8 (IL-8), which is a cytokine that is chemotactic for lymphocytes and neutrophils, is also angiogenic. Human recombinant IL-8 was potently angiogenic when implanted in the rat cornea and induced proliferation and chemotaxis of human umbilical vein endothelial cells. Angiogenic activity present in the conditioned media of inflamed human rheumatoid synovial tissue macrophages or lipopolysaccharide-stimulated blood monocytes was equally blocked by antibodies to either IL-8 or tumor necrosis factor-alpha. An IL-8 antisense oligonucleotide specifically blocked the production of monocyte-induced angiogenic activity. These data suggest a function for macrophage-derived IL-8 in angiogenesis-dependent disorders such as rheumatoid arthritis, tumor growth, and wound repair.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koch, A E -- Polverini, P J -- Kunkel, S L -- Harlow, L A -- DiPietro, L A -- Elner, V M -- Elner, S G -- Strieter, R M -- AR30692/AR/NIAMS NIH HHS/ -- AR41492/AR/NIAMS NIH HHS/ -- HL39926/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1992 Dec 11;258(5089):1798-801.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Northwestern University Medical School, Chicago, IL 60611.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1281554" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arthritis, Rheumatoid/physiopathology ; Base Sequence ; Cell Division/drug effects ; Cells, Cultured ; Chemotaxis/*drug effects ; Cornea/*drug effects/physiology ; Dose-Response Relationship, Drug ; Endothelium, Vascular/drug effects/*physiology ; Fibroblast Growth Factor 2/pharmacology ; Humans ; Interleukin-8/genetics/*pharmacology ; Macrophages/*physiology ; Mice ; Molecular Sequence Data ; Monocytes/physiology ; *Neovascularization, Pathologic ; Oligonucleotides, Antisense/*pharmacology ; Rabbits ; Rats ; Recombinant Proteins/pharmacology ; Synovial Fluid/physiology ; Tumor Necrosis Factor-alpha/genetics ; Umbilical Veins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 34
    facet.materialart.
    Unknown
    Dendritic spines: convergence of theory and experiment (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-15
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koch, C -- Zador, A -- Brown, T H -- New York, N.Y. -- Science. 1992 May 15;256(5059):973-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Computation and Neural Systems Program, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1589781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/physiology/ultrastructure ; Calcium/metabolism ; Dendrites/physiology/*ultrastructure ; Electrophysiology ; Hippocampus/*ultrastructure ; Microscopy, Electron ; Rats ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 35
    facet.materialart.
    Unknown
    Flow-dependent cytosolic acidification of vascular endothelial cells (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-10-23
    Description: Hemodynamic shear stress affects endothelial cell structure and function, but little is known about the signal transduction mechanisms involved in these processes. The effect of laminar shear stress on cytosolic pH (pHi) was examined in rat aortic endothelial cells cultured in glass capillary tubes. Shear stress forces led to a rapid decrease in pHi (maximal effect 0.09 pH unit at 13.4 dynes per square centimeter). Removal of specific ions or addition of exchange inhibitors suggests that in vascular endothelial cells shear stress forces activate both an alkali extruder, sodium ion-independent chloride-bicarbonate ion exchange, and an acid extruder, sodium-hydrogen ion exchange; the net effect in physiologic buffer with the bicarbonate ion is a decrease in pHi.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ziegelstein, R C -- Cheng, L -- Capogrossi, M C -- New York, N.Y. -- Science. 1992 Oct 23;258(5082):656-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cardiovascular Science, National Institute on Aging, National Institutes of Health, Baltimore, MD 21224.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1329207" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bicarbonates/metabolism ; Carrier Proteins/physiology ; Cells, Cultured ; Chloride-Bicarbonate Antiporters ; Cytosol/*physiology ; Endothelium, Vascular/*physiology ; Hydrogen-Ion Concentration ; Membrane Proteins/physiology ; Rats ; Signal Transduction/physiology ; Sodium-Hydrogen Antiporter ; Stress, Mechanical
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 36
    facet.materialart.
    Unknown
    The time course of glutamate in the synaptic cleft (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-11-27
    Description: The peak concentration and rate of clearance of neurotransmitter from the synaptic cleft are important determinants of synaptic function, yet the neurotransmitter concentration time course is unknown at synapses in the brain. The time course of free glutamate in the cleft was estimated by kinetic analysis of the displacement of a rapidly dissociating competitive antagonist from N-methyl-D-aspartate (NMDA) receptors during synaptic transmission. Glutamate peaked at 1.1 millimolar and decayed with a time constant of 1.2 milliseconds at cultured hippocampal synapses. This time course implies that transmitter saturates postsynaptic NMDA receptors. However, glutamate dissociates much more rapidly from alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors. Thus, the time course of free glutamate predicts that dissociation contributes to the decay of the AMPA receptor-mediated postsynaptic current.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Clements, J D -- Lester, R A -- Tong, G -- Jahr, C E -- Westbrook, G L -- MH46613/MH/NIMH NIH HHS/ -- NS21419/NS/NINDS NIH HHS/ -- NS26494/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 Nov 27;258(5087):1498-501.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Vollum Institute, Oregon Health Sciences University, Portland 97201.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1359647" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Aminoadipic Acid/pharmacology ; Action Potentials/physiology ; Animals ; Cells, Cultured ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/cytology/physiology ; Models, Neurological ; Neurons/physiology ; Neurotransmitter Agents/*metabolism ; Piperazines/pharmacology ; Rats ; Receptors, N-Methyl-D-Aspartate/drug effects/physiology ; Synapses/drug effects/*metabolism ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 37
    facet.materialart.
    Unknown
    Antisense and antigene properties of peptide nucleic acids (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-11-27
    Description: Peptide nucleic acids (PNAs) are polyamide oligomers that can strand invade duplex DNA, causing displacement of one DNA strand and formation of a D-loop. Binding of either a T10 PNA or a mixed sequence 15-mer PNA to the transcribed strand of a G-free transcription cassette caused 90 to 100 percent site-specific termination of pol II transcription elongation. When a T10 PNA was bound on the nontranscribed strand, site-specific inhibition never exceeded 50 percent. Binding of PNAs to RNA resulted in site-specific termination of both reverse transcription and in vitro translation, precisely at the position of the PNA.RNA heteroduplex. Nuclear microinjection of cells constitutively expressing SV40 large T antigen (T Ag) with either a 15-mer or 20-mer PNA targeted to the T Ag messenger RNA suppressed T Ag expression. This effect was specific in that there was no reduction in beta-galactosidase expression from a coinjected expression vector and no inhibition of T Ag expression after microinjection of a 10-mer PNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hanvey, J C -- Peffer, N J -- Bisi, J E -- Thomson, S A -- Cadilla, R -- Josey, J A -- Ricca, D J -- Hassman, C F -- Bonham, M A -- Au, K G -- New York, N.Y. -- Science. 1992 Nov 27;258(5087):1481-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Glaxo Inc. Research Institute, Research Triangle Park, NC 27709.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1279811" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Polyomavirus Transforming/genetics ; Base Sequence ; DNA/*metabolism ; Deoxyribonuclease HindIII/antagonists & inhibitors ; Gene Expression/drug effects ; HeLa Cells ; Humans ; In Vitro Techniques ; Molecular Sequence Data ; Oligodeoxyribonucleotides/*metabolism/pharmacology ; Oligonucleotides, Antisense/*metabolism/pharmacology ; *Peptide Nucleic Acids ; Plasmids ; Protein Biosynthesis/drug effects ; RNA/metabolism ; Rabbits ; Rats ; Transcription, Genetic/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 38
    facet.materialart.
    Unknown
    In vitro transcription enhancement by purified derivatives of the glucocorticoid receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-21
    Description: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 39
    facet.materialart.
    Unknown
    Pathological changes induced in cerebrocortical neurons by phencyclidine and related drugs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 40
    facet.materialart.
    Unknown
    Factors that predict individual vulnerability to amphetamine self-administration (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 41
    facet.materialart.
    Unknown
    Inhibitors of angiotensin-converting enzyme prevent myointimal proliferation after vascular injury (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 42
    facet.materialart.
    Unknown
    Glial cell diversification in the rat optic nerve (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 43
    facet.materialart.
    Unknown
    A genetic polymorphism in the renin gene of Dahl rats cosegregates with blood pressure (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 44
    facet.materialart.
    Unknown
    elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 45
    facet.materialart.
    Unknown
    Autoimmune target in Heymann nephritis is a glycoprotein with homology to the LDL receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 46
    facet.materialart.
    Unknown
    Treatment with tin prevents the development of hypertension in spontaneously hypertensive rats (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-20
    Description: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 47
    facet.materialart.
    Unknown
    Tonic activation of NMDA receptors by ambient glutamate enhances excitability of neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 48
    facet.materialart.
    Unknown
    High-level recombinant gene expression in rabbit endothelial cells transduced by retroviral vectors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-13
    Description: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 49
    facet.materialart.
    Unknown
    Reversal of diabetes insipidus in Brattleboro rats: intrahypothalamic injection of vasopressin mRNA (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-02-21
    Description: Messenger RNAs occur within the axons of magnocellular hypothalamic neurons known to secrete oxytocin and vasopressin. In Brattleboro rats, which have a genetic mutation that renders them incapable of vasopressin expression and secretion and thus causes diabetes insipidus, injection into the hypothalamus of purified mRNAs from normal rat hypothalami or of synthetic copies of the vasopressin mRNA leads to selective uptake, retrograde transport, and expression of vasopressin exclusively in the magnocellular neurons. Temporary reversal of their diabetes insipidus (for up to 5 days) can be observed within hours of the injection. Intra-axonal mRNAs may represent an additional category of chemical signals for neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jirikowski, G F -- Sanna, P P -- Maciejewski-Lenoir, D -- Bloom, F E -- MH 47680/MH/NIMH NIH HHS/ -- NS 22347-03/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 Feb 21;255(5047):996-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neuropharmacology, Scripps Research Institute, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1546298" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arginine Vasopressin/*genetics/metabolism ; Diabetes Insipidus/*therapy ; Hypothalamus ; RNA, Messenger/administration & dosage ; Rats ; Rats, Brattleboro ; Water-Electrolyte Balance
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 50
    facet.materialart.
    Unknown
    Nitric oxide and arginine-evoked insulin secretion (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-11-20
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Vincent, S R -- New York, N.Y. -- Science. 1992 Nov 20;258(5086):1376-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1455235" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arginine/*pharmacology ; Insulin/*secretion ; Islets of Langerhans/secretion ; Nitric Oxide/*metabolism ; Rats ; Secretory Rate/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 51
    facet.materialart.
    Unknown
    MacroH2A, a core histone containing a large nonhistone region (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-09-04
    Description: A histone, macroH2A, nearly three times the size of conventional H2A histone, was found in rat liver nucleosomes. Its N-terminal third is 64 percent identical to a full-length mouse H2A. However, it also contains a large nonhistone region. This region has a segment that resembles a leucine zipper, a structure known to be involved in dimerization of some transcription factors. Nucleosomes containing macroH2A may have novel functions, possibly involving interactions with other nuclear proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pehrson, J R -- Fried, V A -- CA 06927/CA/NCI NIH HHS/ -- GM 24019/GM/NIGMS NIH HHS/ -- RR 05539/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1992 Sep 4;257(5075):1398-400.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Fox Chase Cancer Center, Institute for Cancer Research, Philadelphia, PA 19111.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1529340" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; DNA/chemistry ; Histones/*chemistry/genetics ; Leucine Zippers ; Liver/*ultrastructure ; Macromolecular Substances ; Mice ; Molecular Sequence Data ; Nucleosomes/*chemistry ; Polymerase Chain Reaction ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 52
    facet.materialart.
    Unknown
    Synaptotagmin: a calcium sensor on the synaptic vesicle surface (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-15
    Description: Neurons release neurotransmitters by calcium-dependent exocytosis of synaptic vesicles. However, the molecular steps transducing the calcium signal into membrane fusion are still an enigma. It is reported here that synaptotagmin, a highly conserved synaptic vesicle protein, binds calcium at physiological concentrations in a complex with negatively charged phospholipids. This binding is specific for calcium and involves the cytoplasmic domain of synaptotagmin. Calcium binding is dependent on the intact oligomeric structure of synaptotagmin (it is abolished by proteolytic cleavage at a single site). These results suggest that synaptotagmin acts as a cooperative calcium receptor in exocytosis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Brose, N -- Petrenko, A G -- Sudhof, T C -- Jahn, R -- New York, N.Y. -- Science. 1992 May 15;256(5059):1021-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurochemistry, Max-Planck-Institute for Psychiatry, Martinsried, Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1589771" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Brain Chemistry ; Calcium/*metabolism/pharmacology ; *Calcium-Binding Proteins ; Cell Membrane/metabolism ; Cytoplasmic Granules/metabolism ; Dansyl Compounds/metabolism ; Energy Transfer ; Exocytosis ; Fluorescent Dyes ; Liposomes/metabolism ; Macromolecular Substances ; Membrane Glycoproteins/chemistry/isolation & purification/*metabolism ; Nerve Tissue Proteins/chemistry/isolation & purification/*metabolism ; Phosphatidylethanolamines/metabolism ; Rats ; Synaptic Vesicles/*metabolism ; Synaptotagmins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 53
    facet.materialart.
    Unknown
    Calcium-dependent transmitter secretion reconstituted in Xenopus oocytes: requirement for synaptophysin (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-07-31
    Description: Calcium-dependent glutamate secretion was reconstituted in Xenopus oocytes by injecting the oocyte with total rat cerebellar messenger RNA (mRNA). Co-injection of total mRNA with antisense oligonucleotides to synaptophysin message decreased the expression of synaptophysin in the oocyte and reduced the calcium-dependent secretion. A similar effect on secretion was observed for oocytes injected with total mRNA together with an antibody to rat synaptophysin. These results indicate that synaptophysin is necessary for transmitter secretion and that the oocyte expression system may be useful for dissecting the molecular events associated with the secretory process.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Alder, J -- Lu, B -- Valtorta, F -- Greengard, P -- Poo, M M -- MH 39327/MH/NIMH NIH HHS/ -- NS 22764/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 Jul 31;257(5070):657-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Sciences, Columbia University, New York, NY 10027.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1353905" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Blotting, Western ; Calcimycin/pharmacology ; Calcium/*pharmacology ; Cerebellum/chemistry ; Fluorescent Antibody Technique ; Gene Expression ; Glutamates/*secretion ; Glutamic Acid ; Kinetics ; Liver/chemistry ; Microscopy, Immunoelectron ; Molecular Sequence Data ; Oligonucleotides, Antisense/pharmacology ; Oocytes/*physiology ; RNA, Messenger/genetics ; Rats ; Synaptophysin/genetics/*physiology ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 54
    facet.materialart.
    Unknown
    Gz-mediated hormonal inhibition of cyclic AMP accumulation (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-01-17
    Description: Hormones inhibit synthesis of adenosine 3',5'-monophosphate (cAMP) in most cells via receptors coupled to pertussis toxin (PTX)-sensitive guanine nucleotide-binding (G) proteins. Mutationally activated alpha subunits of Gi2 (alpha i2) constitutively inhibit cAMP accumulation when transfected into cells. Cells have now been transfected with mutant alpha subunits of four other G proteins--Gz, a PTX-insensitive G protein of unknown function, and Gi1, Gi3, and G(o), which are PTX-sensitive. Mutant alpha z, alpha i1, and alpha i3 inhibited cAMP accumulation but alpha o did not. Moreover, expression of wild-type alpha z produced cells in which PTX did not block hormonal inhibition of cAMP accumulation. Thus, Gz can trigger an effector pathway in response to hormone receptors that ordinarily interact with PTX-sensitive Gi proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wong, Y H -- Conklin, B R -- Bourne, H R -- New York, N.Y. -- Science. 1992 Jan 17;255(5042):339-42.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1347957" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenergic alpha-Agonists/pharmacology ; Animals ; Brimonidine Tartrate ; Chorionic Gonadotropin/pharmacology ; Colforsin/pharmacology ; Cyclic AMP/*biosynthesis ; Dinoprostone/pharmacology ; Dopamine/pharmacology ; GTP-Binding Proteins/*physiology ; Gene Expression Regulation/*physiology ; Hormones/*physiology ; In Vitro Techniques ; Lysophospholipids/pharmacology ; Pertussis Toxin ; Quinoxalines/pharmacology ; Rats ; Signal Transduction/physiology ; Transfection ; Virulence Factors, Bordetella/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 55
    facet.materialart.
    Unknown
    An amino acid mutation in a potassium channel that prevents inhibition by protein kinase C (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-03-27
    Description: A slowly activating, voltage-dependent potassium channel protein cloned from rat kidney was expressed in Xenopus oocytes. Two activators of protein kinase C, 1-oleoyl-2-acetyl-rac-glycerol and phorbol 12,13-didecanoate, inhibited the current. This inhibition was blocked by the kinase inhibitor staurosporine. Inhibition of the current was not seen in channels in which Ser103 was replaced by Ala, although other properties of the current were unchanged. These results indicate that inhibition of the potassium current results from direct phosphorylation of the channel subunit protein at Ser103.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Busch, A E -- Varnum, M D -- North, R A -- Adelman, J P -- DA03160/DA/NIDA NIH HHS/ -- NS28504/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 Mar 27;255(5052):1705-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Vollum Institute, Oregon Health Sciences University, Portland 97201.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1553557" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; DNA/genetics ; Diglycerides/pharmacology ; Ion Channel Gating ; Membrane Potentials ; Molecular Sequence Data ; Mutagenesis, Site-Directed ; Phorbol Esters/pharmacology ; Phosphorylation ; Potassium Channels/*physiology ; Protein Kinase C/*metabolism ; Rats ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 56
    facet.materialart.
    Unknown
    Do antidepressants promote tumors? (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-07-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1992 Jul 3;257(5066):22-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1621088" target="_blank"〉PubMed〈/a〉
    Keywords: Amitriptyline/*toxicity ; Animals ; Breast Neoplasms/drug therapy/prevention & control ; Carcinogens/*toxicity ; Female ; Fluoxetine/*toxicity ; Humans ; Mice ; Neoplasms, Experimental/chemically induced ; Rats ; Tamoxifen/therapeutic use ; United States ; United States Food and Drug Administration
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 57
    facet.materialart.
    Unknown
    Trypsin-sensitive, rapid inactivation of a calcium-activated potassium channel (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-09-18
    Description: Most calcium-activated potassium channels couple changes in intracellular calcium to membrane excitability by conducting a current with a probability that depends directly on submembrane calcium concentration. In rat adrenal chromaffin cells, however, a large conductance, voltage- and calcium-activated potassium channel (BK) undergoes rapid inactivation, suggesting that this channel has a physiological role different than that of other BK channels. The inactivation of the BK channel, like that of the voltage-gated Shaker B potassium channel, is removed by trypsin digestion and channels are blocked by the Shaker B amino-terminal inactivating domain. Thus, this BK channel shares functional and possibly structural homologies with other inactivating voltage-gated potassium channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Solaro, C R -- Lingle, C J -- New York, N.Y. -- Science. 1992 Sep 18;257(5077):1694-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anesthesiology, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1529355" target="_blank"〉PubMed〈/a〉
    Keywords: Adrenal Glands/physiology ; Animals ; Calcium/*pharmacology ; Cattle ; Cell Line ; Cell Membrane/physiology ; Chromaffin System/physiology ; Electric Conductivity ; Ion Channel Gating/drug effects/physiology ; Male ; Membrane Potentials/physiology ; Potassium Channels/*physiology ; Rats ; Rats, Inbred Strains ; Trypsin/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 58
    facet.materialart.
    Unknown
    Mutation of the POU-specific domain of Pit-1 and hypopituitarism without pituitary hypoplasia (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-08-21
    Description: A point mutation in the POU-specific portion of the human gene that encodes the tissue-specific POU-domain transcription factor, Pit-1, results in hypopituitarism, with deficiencies of growth hormone, prolactin, and thyroid-stimulating hormone. In two unrelated Dutch families, a mutation in Pit-1 that altered an alanine in the first putative alpha helix of the POU-specific domain to proline was observed. This mutation generated a protein capable of binding to DNA response elements but unable to effectively activate its known target genes, growth hormone and prolactin. The phenotype of the affected individuals suggests that the mutant Pit-1 protein is competent to initiate other programs of gene activation required for normal proliferation of somatotrope, lactotrope, and thyrotrope cell types. Thus, a mutation in the POU-specific domain of Pit-1 has a selective effect on a subset of Pit-1 target genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pfaffle, R W -- DiMattia, G E -- Parks, J S -- Brown, M R -- Wit, J M -- Jansen, M -- Van der Nat, H -- Van den Brande, J L -- Rosenfeld, M G -- Ingraham, H A -- HD24960/HD/NICHD NIH HHS/ -- HD2697/HD/NICHD NIH HHS/ -- NIDDK 18477/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1992 Aug 21;257(5073):1118-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, Emory University School of Medicine, Atlanta, GA 30322.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1509263" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Blotting, Northern ; DNA/chemistry/metabolism ; DNA-Binding Proteins/*genetics/metabolism ; Growth Hormone/deficiency ; Humans ; Hypopituitarism/*genetics/pathology ; Mice ; Molecular Sequence Data ; *Mutation ; Nucleic Acid Hybridization ; Pituitary Gland, Anterior/*pathology ; Pituitary Hormones/*deficiency ; Polymerase Chain Reaction ; Prolactin/deficiency ; Rats ; Sequence Homology, Nucleic Acid ; Thyrotropin/deficiency ; Transcription Factor Pit-1 ; Transcription Factors/*genetics/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 59
    facet.materialart.
    Unknown
    Calcium-permeable AMPA-kainate receptors in fusiform cerebellar glial cells (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-06-12
    Description: Glutamate-operated ion channels (GluR channels) of the L-alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-kainate subtype are found in both neurons and glial cells of the central nervous system. These channels are assembled from the GluR-A, -B, -C, and -D subunits; channels containing a GluR-B subunit show an outwardly rectifying current-voltage relation and low calcium permeability, whereas channels lacking the GluR-B subunit are characterized by a doubly rectifying current-voltage relation and high calcium permeability. Most cell types in the central nervous system coexpress several subunits, including GluR-B. However, Bergmann glia in rat cerebellum do not express GluR-B subunit genes. In a subset of cultured cerebellar glial cells, likely derived from Bergmann glial cells. GluR channels exhibit doubly rectifying current-voltage relations and high calcium permeability, whereas GluR channels of cerebellar neurons have low calcium permeability. Thus, differential expression of the GluR-B subunit gene in neurons and glia is one mechanism by which functional properties of native GluR channels are regulated.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Burnashev, N -- Khodorova, A -- Jonas, P -- Helm, P J -- Wisden, W -- Monyer, H -- Seeburg, P H -- Sakmann, B -- New York, N.Y. -- Science. 1992 Jun 12;256(5063):1566-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Max-Planck-Institut fur Medizinische Forschung, Abteilung Zellphysiologie, Heidelberg, Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1317970" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcium/*metabolism ; Cell Membrane Permeability ; Cells, Cultured ; Cerebellum/*physiology ; Gene Expression ; Glutamates/physiology ; In Vitro Techniques ; Ion Channel Gating ; Neuroglia/*physiology ; Nucleic Acid Hybridization ; RNA, Messenger/genetics ; Rats ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 60
    facet.materialart.
    Unknown
    Control by asparagine residues of calcium permeability and magnesium blockade in the NMDA receptor (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-09-04
    Description: The N-methyl-D-aspartate (NMDA) receptor forms a cation-selective channel with a high calcium permeability and sensitivity to channel block by extracellular magnesium. These properties, which are believed to be important for the induction of long-term changes in synaptic strength, are imparted by asparagine residues in a putative channel-forming segment of the protein, transmembrane 2 (TM2). In the NR1 subunit, replacement of this asparagine by a glutamine residue decreases calcium permeability of the channel and slightly reduces magnesium block. The same substitution in NR2 subunits strongly reduces magnesium block and increases the magnesium permeability but barely affects calcium permeability. These asparagines are in a position homologous to the site in the TM2 region (Q/R site) of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors that is occupied by either glutamine (Q) or arginine (R) and that controls divalent cation permeability of the AMPA receptor channel. Hence AMPA and NMDA receptor channels contain common structural motifs in their TM2 segments that are responsible for some of their ion selectivity and conductance properties.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Burnashev, N -- Schoepfer, R -- Monyer, H -- Ruppersberg, J P -- Gunther, W -- Seeburg, P H -- Sakmann, B -- New York, N.Y. -- Science. 1992 Sep 4;257(5075):1415-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Abteilung Zellphysiologie, Max-Planck-Institut fur Medizinische Forschung, Heidelberg, Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1382314" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Asparagine/*chemistry ; Binding Sites ; Calcium/*metabolism/pharmacology ; Cell Line ; Electric Conductivity ; Glutamates/pharmacology ; Glutamic Acid ; Ion Channels/chemistry/*physiology ; Magnesium/metabolism/*pharmacology ; Mice ; Molecular Sequence Data ; Mutagenesis ; Oocytes/metabolism ; Permeability ; Rats ; Receptors, N-Methyl-D-Aspartate/chemistry/genetics/*physiology ; Structure-Activity Relationship ; Transfection ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 61
    facet.materialart.
    Unknown
    Nitric oxide: a physiologic mediator of penile erection (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-07-17
    Description: Nitric oxide (NO) is a cytotoxic agent of macrophages, a messenger molecule of neurons, and a vasodilator produced by endothelial cells. NO synthase, the synthetic enzyme for NO, was localized to rat penile neurons innervating the corpora cavernosa and to neuronal plexuses in the adventitial layer of penile arteries. Small doses of NO synthase inhibitors abolished electrophysiologically induced penile erections. These results establish NO as a physiologic mediator of erectile function.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Burnett, A L -- Lowenstein, C J -- Bredt, D S -- Chang, T S -- Snyder, S H -- DA-00266/DA/NIDA NIH HHS/ -- DK-19300/DK/NIDDK NIH HHS/ -- MH-18501/MH/NIMH NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1992 Jul 17;257(5068):401-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Urology, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1378650" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Oxidoreductases/antagonists & inhibitors/biosynthesis ; Animals ; Arginine/analogs & derivatives/pharmacology ; Dose-Response Relationship, Drug ; Male ; Nerve Fibers/metabolism ; *Nitric Oxide ; Nitric Oxide Synthase ; Nitroarginine ; Penile Erection/drug effects/*physiology ; Penis/metabolism ; Rats ; Urethra/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 62
    facet.materialart.
    Unknown
    Alzheimer's debate boils over (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-09-04
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1992 Sep 4;257(5075):1336-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1529329" target="_blank"〉PubMed〈/a〉
    Keywords: Alzheimer Disease/*etiology/pathology ; Amyloid beta-Peptides/*metabolism/pharmacology/toxicity ; Animals ; History, 20th Century ; Humans ; Nervous System Diseases/chemically induced/pathology ; Neurons/drug effects/pathology ; Rats ; Research/standards
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 63
    facet.materialart.
    Unknown
    Specific binding of chromosomal protein HMG1 to DNA damaged by the anticancer drug cisplatin (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-04-10
    Description: The mechanism of action of the anticancer compound cis-diamminedichloroplatinum(II) (cisplatin) involves covalent binding to DNA. In an effort to understand the tumor-specific cytotoxicity of such DNA damage, the interactions of these lesions with cellular proteins have been studied. One such protein has been identified as the high-mobility group protein HMG1. Recombinant rat HMG1 binds specifically (dissociation constant 3.7 +/- 2.0 x 10(-7) molar) to DNA containing cisplatin d(GpG) or d(ApG) intrastrand cross-links, which unwind and bend DNA in a specific manner, but not to DNA modified by therapeutically inactive platinum analogs. These results suggest how HMG1 might bind to altered DNA structures and may be helpful in designing new antitumor drugs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pil, P M -- Lippard, S J -- CA34992/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1992 Apr 10;256(5054):234-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemistry, Massachusetts Institute of Technology, Cambridge 02139.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1566071" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cell Nucleus/metabolism ; Cisplatin/*pharmacology ; *DNA Damage ; DNA, Neoplasm/drug effects/*metabolism ; HeLa Cells ; High Mobility Group Proteins/*metabolism ; Humans ; Molecular Sequence Data ; Oligodeoxyribonucleotides/*metabolism ; Protein Binding ; Rats ; Recombinant Proteins/metabolism ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 64
    facet.materialart.
    Unknown
    Cloning and characterization of inducible nitric oxide synthase from mouse macrophages (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-04-10
    Description: Nitric oxide (NO) conveys a variety of messages between cells, including signals for vasorelaxation, neurotransmission, and cytotoxicity. In some endothelial cells and neurons, a constitutive NO synthase is activated transiently by agonists that elevate intracellular calcium concentrations and promote the binding of calmodulin. In contrast, in macrophages, NO synthase activity appears slowly after exposure of the cells to cytokines and bacterial products, is sustained, and functions independently of calcium and calmodulin. A monospecific antibody was used to clone complementary DNA that encoded two isoforms of NO synthase from immunologically activated mouse macrophages. Liquid chromatography-mass spectrometry was used to confirm most of the amino acid sequence. Macrophage NO synthase differs extensively from cerebellar NO synthase. The macrophage enzyme is immunologically induced at the transcriptional level and closely resembles the enzyme in cytokine-treated tumor cells and inflammatory neutrophils.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Xie, Q W -- Cho, H J -- Calaycay, J -- Mumford, R A -- Swiderek, K M -- Lee, T D -- Ding, A -- Troso, T -- Nathan, C -- AI30165/AI/NIAID NIH HHS/ -- CA43610/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1992 Apr 10;256(5054):225-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Beatrice and Samuel A. Seaver Laboratory, Department of Medicine, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1373522" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Oxidoreductases/biosynthesis/*genetics ; Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cells, Cultured ; Cloning, Molecular ; Codon ; Enzyme Induction ; Interferon-gamma/pharmacology ; Isoenzymes/biosynthesis/*genetics ; Kinetics ; Lipopolysaccharides ; Macrophages/drug effects/*enzymology ; Mammary Neoplasms, Experimental ; Mice ; Molecular Sequence Data ; Molecular Weight ; Neutrophils/drug effects/enzymology ; Nitric Oxide Synthase ; Oligodeoxyribonucleotides ; Poly A/genetics ; RNA/genetics ; RNA, Messenger ; Rats ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 65
    facet.materialart.
    Unknown
    Gene therapy for CF advances (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-01-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1992 Jan 17;255(5042):289.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1549773" target="_blank"〉PubMed〈/a〉
    Keywords: Adenoviridae/genetics ; Animals ; Cystic Fibrosis/*therapy ; Genetic Therapy/*methods ; Genetic Vectors ; Rats ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 66
    facet.materialart.
    Unknown
    High-frequency network oscillation in the hippocampus (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-15
    Description: Pyramidal cells in the CA1 hippocampal region displayed transient network oscillations (200 hertz) during behavioral immobility, consummatory behaviors, and slow-wave sleep. Simultaneous, multisite recordings revealed temporal and spatial coherence of neuronal activity during population oscillations. Participating pyramidal cells discharged at a rate lower than the frequency of the population oscillation, and their action potentials were phase locked to the negative phase of the simultaneously recorded oscillatory field potentials. In contrast, interneurons discharged at population frequency during the field oscillations. Thus, synchronous output of cooperating CA1 pyramidal cells may serve to induce synaptic enhancement in target structures of the hippocampus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Buzsaki, G -- Horvath, Z -- Urioste, R -- Hetke, J -- Wise, K -- NS02383/NS/NINDS NIH HHS/ -- NS27058/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 May 15;256(5059):1025-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Molecular and Behavioral Neuroscience, Rutgers University, Newark, NJ 07102.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1589772" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials ; Animals ; Behavior, Animal/physiology ; Cell Membrane/physiology ; Electrophysiology ; Hippocampus/*physiology ; Interneurons/physiology ; Male ; Neurons/physiology ; Periodicity ; Pyramidal Tracts/physiology ; Rats ; Sleep/physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 67
    facet.materialart.
    Unknown
    Hidden messages in genetic maps (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-10-02
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Farr, C J -- Goodfellow, P N -- New York, N.Y. -- Science. 1992 Oct 2;258(5079):49.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genetics Department, University of Cambridge, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1439767" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Mapping ; Conserved Sequence ; Dosage Compensation, Genetic ; Gene Expression Regulation ; *Genome ; Humans ; Mammals/*genetics ; Rats ; *X Chromosome ; *Y Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 68
    facet.materialart.
    Unknown
    Roles of SWI1, SWI2, and SWI3 proteins for transcriptional enhancement by steroid receptors (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-12-04
    Description: The SWI1, SWI2, and SWI3 proteins, which are required for regulated transcription of numerous yeast genes, were found also to be essential for rat glucocorticoid receptor function in yeast; the receptor failed to activate transcription in strains with mutations in the SWI1, SWI2, or SWI3 genes. Certain mutations in genes encoding components of chromatin, identified as suppressors of swi mutations, partially relieved the SWI- requirement for receptor function. Immunoprecipitation of glucocorticoid receptor derivatives from wild-type (SWI+) yeast extracts coprecipitated the SWI3 protein; such receptor-SWI3 complexes were not detected in swi1- or swi2- mutant strains, implying that a complex of multiple SWI proteins may associate with the receptor. Prior incubation of a Drosophila embryo transcription extract with the yeast SWI3-specific antibody inhibited receptor function in vitro whereas the antibody had no effect if added after initiation complex formation. Thus, positive regulation by the glucocorticoid receptor in vivo and in vitro appears to require its interaction, at an early step, with one or more SWI proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yoshinaga, S K -- Peterson, C L -- Herskowitz, I -- Yamamoto, K R -- New York, N.Y. -- Science. 1992 Dec 4;258(5088):1598-604.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1360703" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphatases ; Animals ; Chromosomal Proteins, Non-Histone ; Cloning, Molecular ; DNA-Binding Proteins/genetics/*metabolism ; Fungal Proteins/genetics/*metabolism ; Gene Deletion ; *Gene Expression Regulation, Fungal ; Glucosephosphate Dehydrogenase/genetics/metabolism ; Nuclear Proteins/genetics/*metabolism ; Promoter Regions, Genetic ; RNA Polymerase II/metabolism ; Rats ; Receptors, Glucocorticoid/*genetics/metabolism ; Receptors, Steroid/*genetics/metabolism ; Saccharomyces cerevisiae/*genetics ; *Saccharomyces cerevisiae Proteins ; TATA Box ; *Trans-Activators ; Transcription Factors/genetics/*metabolism ; *Transcription, Genetic ; Tyrosine Transaminase/genetics/metabolism ; beta-Galactosidase/genetics/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 69
    facet.materialart.
    Unknown
    Prevention of autoimmune diabetes in the BB rat by intrathymic islet transplantation at birth (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-29
    Description: Spontaneous diabetes in the BioBreeding (BB) rat, like human type I diabetes, results from the destruction of pancreatic islets by autoreactive T lymphocytes recognizing beta cell-specific antigens. T cell tolerance is in part mediated by interactions of maturing thymocytes with antigens expressed in the thymic microenvironment; islets were therefore implanted into the thymus of neonatal diabetes-prone BB rats to determine whether exposure of T cell precursors to beta cell antigens could influence the development of diabetes. This treatment completely prevented diabetes and insulitis in the native pancreas. The effect may be the result of specific modulation of diabetogenic T cells maturing in an islet-bearing thymus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Posselt, A M -- Barker, C F -- Friedman, A L -- Naji, A -- DK26007/DK/NIDDK NIH HHS/ -- DK34878/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1992 May 29;256(5061):1321-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Surgery, Hospital of the University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1598576" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Antigens, CD4/analysis ; Antigens, CD8/analysis ; Autoimmune Diseases/genetics/immunology/*prevention & control ; Diabetes Mellitus, Type 1/immunology/*prevention & control ; Immune Tolerance ; *Islets of Langerhans Transplantation ; Lymph Nodes/immunology ; Male ; Pancreas/cytology ; Rats ; Rats, Inbred BB ; Rats, Inbred WF ; T-Lymphocytes/*immunology ; Thymus Gland/cytology ; Thyroid Gland/cytology ; Transplantation, Heterotopic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 70
    facet.materialart.
    Unknown
    Neuronal domains in developing neocortex (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-07-31
    Description: The mammalian neocortex consists of a mosaic of columnar units whose development is poorly understood. Optical recordings of brain slices labeled with the fluorescent calcium indicator fura-2 revealed that the neonatal rat cortex was partitioned into distinct domains of spontaneously coactive neurons. In tangential slices, these domains were 50 to 120 micrometers in diameter; in coronal slices they spanned several cortical layers and resembled columns found in the adult cortex. In developing somatosensory cortex, domains were smaller than, and distinct from, the barrels, which represent sensory input from a single vibrissa. The neurons within each domain were coupled by gap junctions. Thus, nonsynaptic communication during cortical development defines discrete multicellular patterns that could presage adult functional architecture.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yuste, R -- Peinado, A -- Katz, L C -- EY07960/EY/NEI NIH HHS/ -- MH15177/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1992 Jul 31;257(5070):665-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1496379" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials ; Animals ; Brain Mapping ; Calcium/analysis/metabolism ; Cell Communication ; Cerebral Cortex/cytology/*growth & development/physiology ; Computer Simulation ; Fluorescent Dyes ; Fura-2 ; Image Processing, Computer-Assisted ; Intercellular Junctions/physiology ; Neurons/cytology/*physiology ; Rats ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 71
    facet.materialart.
    Unknown
    Bone like plywood (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-03-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉New York, N.Y. -- Science. 1992 Mar 27;255(5052):1638.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1553550" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Biophysical Phenomena ; Biophysics ; Bone and Bones/*ultrastructure ; Calcium Phosphates ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 72
    facet.materialart.
    Unknown
    The neostriatal mosaic: striatal patch-matrix organization is related to cortical lamination (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 73
    facet.materialart.
    Unknown
    Identification of a thyroid hormone receptor that is pituitary-specific (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-07
    Description: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 74
    facet.materialart.
    Unknown
    Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 75
    facet.materialart.
    Unknown
    The EGF receptor kinase substrate p35 in the floor plate of the embryonic rat CNS (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-17
    Description: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 76
    facet.materialart.
    Unknown
    Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-04
    Description: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 77
    facet.materialart.
    Unknown
    Novel sites of expression of functional angiotensin II receptors in the late gestation fetus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-06-16
    Description: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Keywords: Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 78
    facet.materialart.
    Unknown
    Expression of high-affinity binding of human immunoglobulin E by transfected cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 79
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 80
    facet.materialart.
    Unknown
    Regulation of calcium release is gated by calcium current, not gating charge, in cardiac myocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-05-19
    Description: In skeletal muscle, intramembrane charge movement initiates the processes that lead to the release of calcium from the sarcoplasmic reticulum. In cardiac muscle, in contrast, the similarity of the voltage dependence of developed tension and intracellular calcium transients to that of calcium current suggests that the calcium current may gate the release of calcium. Nevertheless, a mechanism similar to that of skeletal muscle continues to be postulated for cardiac muscle. By using rapid exchange (20 to 50 milliseconds) of the extracellular solutions in rat ventricular myocytes in which the intracellular calcium transients or cell shortening were measured, it has now been shown that the influx of calcium through the calcium channel is a mandatory link in the processes that couple membrane depolarization to the release of calcium. Thus, intramembrane charge movement does not contribute to the release of calcium in heart muscle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nabauer, M -- Callewaert, G -- Cleemann, L -- Morad, M -- R01-HL16152/HL/NHLBI NIH HHS/ -- R01-HL33720/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):800-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Pennsylvania, Department of Physiology, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543067" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Barium/metabolism/pharmacology ; Benzofurans ; Buffers ; Calcium/*metabolism ; Calcium Channels/*physiology ; Dialysis ; Egtazic Acid/pharmacology ; Extracellular Space/metabolism ; Fluorescent Dyes ; Fura-2 ; Heart/drug effects/*physiology ; Heart Ventricles ; Membrane Potentials ; Myocardial Contraction ; Rats ; Sarcoplasmic Reticulum/metabolism ; Sodium/metabolism ; Spectrometry, Fluorescence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 81
    facet.materialart.
    Unknown
    Angiotensin II: does it have a direct obligate role in ovulation? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-25
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Naftolin, F -- Andrade-Gordon, P -- Pellicer, A -- Palumbo, A -- Apa, R -- Zreik, T -- Yoon, T K -- DeCherney, A -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):870-1.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Obstetrics and Gynecology, Yale University, New Haven, CT 06510-8063.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772639" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Sarcosine-8-Isoleucine Angiotensin II/pharmacology ; Angiotensin II/*physiology ; Animals ; Chorionic Gonadotropin/pharmacology ; Female ; Gonadotropins, Equine/pharmacology ; *Ovulation ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/analysis ; Receptors, LH/analysis ; Saralasin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 82
    facet.materialart.
    Unknown
    Protection of dentate hilar cells from prolonged stimulation by intracellular calcium chelation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-13
    Description: Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein-negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Scharfman, H E -- Schwartzkroin, P A -- NS-01744/NS/NINDS NIH HHS/ -- NS-15317/NS/NINDS NIH HHS/ -- NS-18895/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):257-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2508225" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Calcium/*metabolism ; Calcium-Binding Proteins/metabolism ; Egtazic Acid/pharmacology ; Electric Stimulation ; Female ; Hippocampus/cytology/drug effects/*physiology ; In Vitro Techniques ; Neurons/drug effects/physiology ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 83
    facet.materialart.
    Unknown
    Selective loss of hippocampal granule cells in the mature rat brain after adrenalectomy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-01-27
    Description: Adrenalectomy of adult male rats resulted in a nearly complete loss of hippocampal granule cells 3 to 4 months after surgery. Nissl and immunocytochemical staining of hippocampal neurons revealed that the granule cell loss was selective; there was no apparent loss of hippocampal pyramidal cells or of gamma-amino butyric acid (GABA)-, somatostatin-, neuropeptide Y-, calcium binding protein-, or parvalbumin-containing hippocampal interneurons. The hippocampal CA1 pyramidal cells of adrenalectomized animals exhibited normal electrophysiological responses to afferent stimulation, whereas responses evoked in the dentate gyrus were severely attenuated. Corticosterone replacement prevented both the adrenalectomy-induced granule cell loss and the attenuated physiological response. Thus, the adrenal glands play a role in maintaining the structural integrity of the normal adult brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sloviter, R S -- Valiquette, G -- Abrams, G M -- Ronk, E C -- Sollas, A L -- Paul, L A -- Neubort, S -- NS18201/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):535-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurology Research Center, Helen Hayes Hospital, New York State Department of Health, West Haverstraw 10993.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911756" target="_blank"〉PubMed〈/a〉
    Keywords: *Adrenalectomy ; Animals ; Annexin A6 ; Calcium-Binding Proteins/analysis ; Corticosterone/pharmacology ; Cytoplasmic Granules ; Electrophysiology ; Evoked Potentials ; Hippocampus/*cytology/drug effects/physiology ; Immunohistochemistry ; Male ; Neurons/cytology/physiology ; Potassium/blood ; Rats ; Sodium/blood ; Weight Gain
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 84
    facet.materialart.
    Unknown
    Hyperpolarizing vasodilators activate ATP-sensitive K+ channels in arterial smooth muscle (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-07-14
    Description: Vasodilators are used clinically for the treatment of hypertension and heart failure. The effects of some vasodilators seem to be mediated by membrane hyperpolarization. The molecular basis of this hyperpolarization has been investigated by examining the properties of single K+ channels in arterial smooth muscle cells. The presence of adenosine triphosphate (ATP)-sensitive K+ channels in these cells was demonstrated at the single channel level. These channels were opened by the hyperpolarizing vasodilator cromakalim and inhibited by the ATP-sensitive K+ channel blocker glibenclamide. Furthermore, in arterial rings the vasorelaxing actions of the drugs diazoxide, cromakalim, and pinacidil and the hyperpolarizing actions of vasoactive intestinal polypeptide and acetylcholine were blocked by inhibitors of the ATP-sensitive K+ channels, suggesting that all these agents may act through a common pathway in smooth muscle by opening ATP-sensitive K+ channels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Standen, N B -- Quayle, J M -- Davies, N W -- Brayden, J E -- Huang, Y -- Nelson, M T -- HL 35911/HL/NHLBI NIH HHS/ -- Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):177-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Leicester, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2501869" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylcholine/pharmacology ; Adenosine Triphosphate/*metabolism ; Animals ; Benzopyrans/antagonists & inhibitors/pharmacology ; Cerebral Arteries ; Cromakalim ; Diazoxide/pharmacology ; Glyburide/pharmacology ; Guanidines/pharmacology ; Mesenteric Arteries ; Muscle, Smooth, Vascular/*metabolism ; Pinacidil ; Potassium Channels/*drug effects/metabolism ; Pyrroles/antagonists & inhibitors/pharmacology ; Rabbits ; Rats ; Tolbutamide/pharmacology ; Vasoactive Intestinal Peptide/pharmacology ; Vasodilator Agents/antagonists & inhibitors/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 85
    facet.materialart.
    Unknown
    NMDA antagonists differentiate epileptogenesis from seizure expression in an in vitro model (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-08-11
    Description: In an electrographic model of seizures in the hippocampal slice, both of the N-methyl-D-aspartate (NMDA) antagonists 2-amino-5-phosphonovaleric acid and 5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohepten-5,10-imine maleate (MK-801) prevented the progressive development of seizures but did not block previously induced seizures. Thus, a process dependent on the NMDA receptor-ionophore complex establishes a long-lasting, seizure-prone state; thereafter the seizures depend on non-NMDA receptor-ionophore mechanisms. This suggests that there is an important distinction between epileptogenesis and seizure expression and between antiepileptogenic and anticonvulsant pharmacological agents.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stasheff, S F -- Anderson, W W -- Clark, S -- Wilson, W A -- NS 17771/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):648-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Epilepsy Center, Veterans Administration Medical Center, Durham, NC 27705.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569762" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate ; Animals ; Anticonvulsants/pharmacology ; Aspartic Acid/*analogs & derivatives/antagonists & inhibitors ; Dibenzocycloheptenes/pharmacology ; *Disease Models, Animal ; Dizocilpine Maleate ; Electric Stimulation ; Electrophysiology ; Epilepsy/*physiopathology ; Evoked Potentials ; Hippocampus/*physiopathology ; In Vitro Techniques ; N-Methylaspartate ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Seizures/*physiopathology ; Valine/analogs & derivatives/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 86
    facet.materialart.
    Unknown
    Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-03-31
    Description: The discovery that the AP-1 family of enhancer binding factors includes a complex of the cellular Fos (cFos) and cellular Jun (cJun) proteins established a direct and important link between oncogenesis and transcriptional regulation. Homodimeric cJun protein synthesized in vitro is capable of binding selectively to AP-1 recognition sites, whereas the cFos polypeptide is not. When cotranslated, the cFos and cJun proteins can form a stable, heterodimeric complex with the DNA binding properties of AP-1/cJun. The related proteins Jun B and vJun are also able to form DNA binding complexes with cFos. Directed mutagenesis of the cFos protein reveals that a leucine repeat structure is required for binding to cJun, in a manner consistent with the proposed function of the "leucine zipper." A novel domain adjacent to, but distinct from, the leucine repeat of cFos is required for DNA binding by cFos-cJun heterodimers. Thus experimental evidence is presented that leucine repeats can mediate complex formation between heterologous proteins and that promotes further understanding of the molecular mechanisms underlying the function of two proto-oncogene products.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Turner, R -- Tjian, R -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1689-94.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494701" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Binding Sites ; Chromatography, Affinity ; DNA/*metabolism ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation ; Humans ; *Leucine ; Macromolecular Substances ; Molecular Sequence Data ; Mutation ; Oncogenes ; Protein Biosynthesis ; Proto-Oncogene Proteins/genetics/*metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship ; Transcription Factors/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 87
    facet.materialart.
    Unknown
    The cholinergic neuronal differentiation factor from heart cells is identical to leukemia inhibitory factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 88
    facet.materialart.
    Unknown
    Specific acceptance of cardiac allograft after treatment with antibodies to ICAM-1 and LFA-1 (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-02-28
    Description: An indefinite survival of cardiac allografts between fully incompatible mice strains was observed when monoclonal antibodies (MAbs) to intercellular adhesion molecule-1 (ICAM-1) and leukocyte function-associated antigen-1 (LFA-1) were simultaneously administered after the transplantation for 6 days. Mice with long-term surviving cardiac allografts accepted skin grafts from the donor-strain but rejected skin grafts from a third-party strain. Because MAbs to ICAM-1 or LFA-1 alone were insufficient for prolonged tolerance, the two MAbs probably acted synergistically to induce specific unresponsiveness. Thus, ICAM-1----LFA-1 adhesion participates in the induction of allograft rejection and MAbs may be useful as therapeutic agents.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Isobe, M -- Yagita, H -- Okumura, K -- Ihara, A -- New York, N.Y. -- Science. 1992 Feb 28;255(5048):1125-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cardiac Unit, Massachusetts General Hospital, Boston, 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1347662" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal/administration & dosage/*therapeutic use ; Cell Adhesion Molecules/*immunology ; Cytotoxicity, Immunologic ; Graft Survival ; Heart Transplantation/*immunology/pathology ; Immunity, Cellular ; Immunosuppression ; Intercellular Adhesion Molecule-1 ; Lymphocyte Function-Associated Antigen-1/*immunology ; Mice ; Mice, Inbred Strains ; Rats ; Skin Transplantation/immunology ; Spleen/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 89
    facet.materialart.
    Unknown
    X-ray laser microscopy of rat sperm nuclei (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-10-19
    Description: The development of high brightness and short pulse width (〈 200 picoseconds) x-ray lasers now offers biologists the possibility of high-resolution imaging of specimens in an aqueous environment without the blurring effects associated with natural motions and chemical erosion. As a step toward developing the capabilities of this type of x-ray microscopy, a tantalum x-ray laser at 44.83 angstrom wavelength was used together with an x-ray zone plate lens to image both unlabeled and selectively gold-labeled dried rat sperm nuclei. The observed images show approximately 500 angstrom features, illustrate the importance of x-ray microscopy in determining chemical composition, and provide information about the uniformity of sperm chromatin organization and the extent of sperm chromatin hydration.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Da Silva, L B -- Trebes, J E -- Balhorn, R -- Mrowka, S -- Anderson, E -- Attwood, D T -- Barbee, T W Jr -- Brase, J -- Corzett, M -- Gray, J -- New York, N.Y. -- Science. 1992 Oct 9;258(5080):269-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physics, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1411525" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Fractionation ; Cell Nucleus/*ultrastructure ; Chromatin/ultrastructure ; DNA/ultrastructure ; Epididymis/cytology ; Immunohistochemistry ; *Lasers ; Male ; Microscopy/*methods ; Rats ; Spermatozoa/*ultrastructure ; X-Rays
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 90
    facet.materialart.
    Unknown
    Primary structure and functional expression of the beta 1 subunit of the rat brain sodium channel (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-08
    Description: Voltage-sensitive sodium channels are responsible for the initiation and propagation of the action potential and therefore are important for neuronal excitability. Complementary DNA clones encoding the beta 1 subunit of the rat brain sodium channel were isolated by a combination of polymerase chain reaction and library screening techniques. The deduced primary structure indicates that the beta 1 subunit is a 22,851-dalton protein that contains a single putative transmembrane domain and four potential extracellular N-linked glycosylation sites, consistent with biochemical data. Northern blot analysis reveals a 1,400-nucleotide messenger RNA in rat brain, heart, skeletal muscle, and spinal cord. Coexpression of beta 1 subunits with alpha subunits increases the size of the peak sodium current, accelerates its inactivation, and shifts the voltage dependence of inactivation to more negative membrane potentials. These results indicate that the beta 1 subunit is crucial in the assembly, expression, and functional modulation of the heterotrimeric complex of the rat brain sodium channel.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Isom, L L -- De Jongh, K S -- Patton, D E -- Reber, B F -- Offord, J -- Charbonneau, H -- Walsh, K -- Goldin, A L -- Catterall, W A -- NS15751/NS/NINDS NIH HHS/ -- NS25704/NS/NINDS NIH HHS/ -- NS26729/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 May 8;256(5058):839-42.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1375395" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Blotting, Northern ; Brain/*physiology ; Cloning, Molecular ; DNA/genetics/isolation & purification ; Female ; Kinetics ; Macromolecular Substances ; Membrane Potentials ; Molecular Sequence Data ; Oocytes/physiology ; Polymerase Chain Reaction/methods ; Protein Conformation ; RNA/genetics/isolation & purification ; RNA, Messenger/genetics ; Rats ; Sodium Channels/*genetics/*physiology ; Voltage-Gated Sodium Channel beta-1 Subunit ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 91
    facet.materialart.
    Unknown
    Inhibition of long-term potentiation by NMDA-mediated nitric oxide release (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-08-28
    Description: Activation of N-methyl-D-aspartate (NMDA) receptors before tetanic stimulation blocks long-term potentiation (LTP) in the CA1 region of the hippocampus. This NMDA-mediated inhibition of LTP can be reversed by the nitric oxide (NO) inhibitors L-NG-monomethyl-arginine or hemoglobin and mimicked by sodium nitroprusside. These results indicate that the timing of NO release relative to high-frequency activation of CA1 synapses may be an important determinant of LTP generation and suggest that NO may play a positive or negative modulatory role in LTP depending on prior events at the tetanized synapse and the ambient concentration of excitatory amino acids.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Izumi, Y -- Clifford, D B -- Zorumski, C F -- AG05681/AG/NIA NIH HHS/ -- MH00964/MH/NIMH NIH HHS/ -- MH45493/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1992 Aug 28;257(5074):1273-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1519065" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Arginine/analogs & derivatives/pharmacology ; Electrophysiology ; Hemoglobins/pharmacology ; Hippocampus/drug effects/*physiology ; In Vitro Techniques ; N-Methylaspartate/*pharmacology ; Nitric Oxide/*metabolism ; Nitroprusside/pharmacology ; Rats ; Time Factors ; omega-N-Methylarginine
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 92
    facet.materialart.
    Unknown
    Carcinogenicity of butadiene (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-09-04
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dankovic, D A -- Stayner, L T -- Smith, R J -- Bailer, A J -- New York, N.Y. -- Science. 1992 Sep 4;257(5075):1330; author reply 1331.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1529327" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Butadienes/*toxicity ; Humans ; Mice ; Neoplasms, Experimental/*chemically induced ; Occupational Diseases/chemically induced ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 93
    facet.materialart.
    Unknown
    Gating of the cardiac Ca2+ release channel: the role of Na+ current and Na(+)-Ca2+ exchange (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-02-14
    Description: In cardiac myocytes, calcium influx through the calcium channel is the primary pathway for triggering calcium release. Recently it has been suggested that the calcium-induced calcium release mechanism can also be activated indirectly by the sodium current, which elevates the sodium concentration under the cell membrane, thereby favoring the entry of "trigger" calcium via the sodium-calcium exchanger. To test this hypothesis, sodium current was suppressed by reducing the external sodium concentration or applying tetrodotoxin. At potentials positive to -30 millivolts, calcium release was unaffected. A small calcium release at more negative potentials could be attributed to partial activation of calcium channels, because it was unaltered by replacement of sodium with lithium and was blocked by cadmium. Thus, sodium influx or its accumulation does not initiate calcium release. In addition, sodium-calcium exchange-related calcium release at potentials positive to +80 millivolts has slower kinetics than calcium channel-induced release. Therefore, only the calcium channel gates the fast release of calcium from the sarcoplasmic reticulum in the range of the action potential.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sham, J S -- Cleemann, L -- Morad, M -- HL-07400/HL/NHLBI NIH HHS/ -- HL-16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1992 Feb 14;255(5046):850-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1311127" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cadmium/physiology ; Calcium Channels/*physiology ; Heart/*physiology ; In Vitro Techniques ; Ion Channel Gating/*drug effects ; Lithium/pharmacology ; Membrane Potentials ; Rats ; Sodium/*pharmacology ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 94
    facet.materialart.
    Unknown
    Widespread dispersion of neuronal clones across functional regions of the cerebral cortex (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-01-24
    Description: The cerebral cortex of the mammalian brain has expanded rapidly during the course of evolution and acquired structurally distinguishable areas devoted to separate functions. In some brain regions, topographic restrictions to cell intermixing occur during embryonic development. As a means of examining experimentally whether such restrictions occur during formation of functional subdivisions in the rat neocortex, clonally related neocortical cells were marked by retroviral-mediated transfer of a histochemical marker gene. Clonal boundaries were determined by infection of the developing brain with a library of genetically distinct viruses and amplification of single viral genomes by the polymerase chain reaction. Many clonally related neurons in the cerebral cortex became widely dispersed across functional areas of the cortex. Specification of cortical areas therefore occurs after neurogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Walsh, C -- Cepko, C L -- NS 23021/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1992 Jan 24;255(5043):434-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1734520" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Brain Mapping ; Cerebral Cortex/*cytology/embryology ; Clone Cells ; Genetic Vectors ; Molecular Sequence Data ; Neurons/*cytology ; Oligonucleotides/chemistry ; Polymerase Chain Reaction ; Rats ; Retroviridae/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 95
    facet.materialart.
    Unknown
    Neurotransmitter release from synaptotagmin-deficient clonal variants of PC12 cells (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-06-26
    Description: Synaptotagmin (p65) is an abundant synaptic vesicle protein of neurons and contains regions similar to the regulatory domain of protein kinase C. These domains are thought to be involved in calcium-dependent interaction with membrane phospholipids during exocytosis. To assess the functional role of synaptotagmin, synaptotagmin-deficient clonal variants of PC12 cells were isolated. All of the variant cells released catecholamine and adenosine triphosphate in response to elevated intracellular concentrations of calcium, which suggests that synaptotagmin is not essential for secretion of catecholamine and adenosine triphosphate from PC12 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shoji-Kasai, Y -- Yoshida, A -- Sato, K -- Hoshino, T -- Ogura, A -- Kondo, S -- Fujimoto, Y -- Kuwahara, R -- Kato, R -- Takahashi, M -- New York, N.Y. -- Science. 1992 Jun 26;256(5065):1821-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mitsubishi Kasel Institute of Life Sciences, Tokyo, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1352065" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Triphosphate/secretion ; Animals ; Blotting, Northern ; Blotting, Western ; Calcium/pharmacology ; *Calcium-Binding Proteins ; Cerebellum/metabolism ; Dopamine/secretion ; Ionomycin/pharmacology ; Membrane Glycoproteins/*physiology ; Nerve Tissue Proteins/*physiology ; Neurotransmitter Agents/*secretion ; PC12 Cells ; Prosencephalon/metabolism ; RNA, Messenger/analysis ; Rats ; Synaptotagmin I ; Synaptotagmins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 96
    facet.materialart.
    Unknown
    Stress-induced facilitation of classical conditioning (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-07-24
    Description: Stress has been shown to impair subsequent learning. To determine whether stress would impair classical conditioning, rats were exposed to inescapable, low-intensity tail shock and subsequently classically conditioned under freely moving conditions with a brief periorbital shock unconditioned stimulus and a white noise conditioned stimulus. Unexpectedly stressed rats exhibited significantly more conditioned eyeblink responses and the magnitude of their individual responses was also enhanced. These results stand in contrast to the learning deficits typically observed and suggest that stress can enhance the acquisition of discrete conditioned responses.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Weiss, C -- Thompson, R F -- AG00093/AG/NIA NIH HHS/ -- AG05500/AG/NIA NIH HHS/ -- AG05514/AG/NIA NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1992 Jul 24;257(5069):537-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, Princeton University, NJ 08544.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1636089" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Animals ; Blinking ; Conditioning, Classical/*physiology ; Corticosterone/blood ; Electromyography ; Electroshock ; Learning/physiology ; Male ; Rats ; Rats, Inbred F344 ; Stress, Psychological/*physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 97
    facet.materialart.
    Unknown
    Initiation of deregulated growth of multipotent progenitor cells by bcr-abl in vitro (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-08
    Description: Expression of the bcr-abl oncogene in multipotent progenitor cells (MPPCs) is implicated as a key event in the development of chronic myelogenous leukemia. Bone marrow enriched for MPPCs was infected with a retrovirus that carried bcr-abl. The mixed-lineage colonies that resulted were responsive to growth factors and could differentiate. These cells later became growth factor-independent but, when injected into severe combined immunodeficient mice, were not leukemogenic. Thus, the presence of bcr-abl alone does not cause growth factor independence, although it initiates a stepwise process. This system may prove useful in the study of other oncogenes that cause leukemia.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gishizky, M L -- Witte, O N -- New York, N.Y. -- Science. 1992 May 8;256(5058):836-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Molecular Genetics, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1375394" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bone Marrow/drug effects ; Bone Marrow Cells ; Cell Differentiation/drug effects ; Cell Division/drug effects ; Cells, Cultured ; Clone Cells ; Drug Resistance, Microbial/genetics ; Fluorouracil/pharmacology ; Fusion Proteins, bcr-abl/*genetics ; Hematopoietic Cell Growth Factors/pharmacology ; Hematopoietic Stem Cells/*cytology/drug effects/physiology ; Humans ; Interleukin-3/pharmacology ; Macrophages/cytology/drug effects ; Mast Cells/cytology/drug effects ; Mice ; Rats ; Retroviridae/genetics ; Stem Cell Factor ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 98
    facet.materialart.
    Unknown
    Modality-specific retrograde amnesia of fear (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-05-01
    Description: Emotional responses such as fear are rapidly acquired through classical conditioning. This report examines the neural substrate underlying memory of acquired fear. Rats were classically conditioned to fear both tone and context through the use of aversive foot shocks. Lesions were made in the hippocampus either 1, 7, 14, or 28 days after training. Contextual fear was abolished in the rats that received lesions 1 day after fear conditioning. However, rats for which the interval between learning and hippocampal lesions was longer retained significant contextual fear memory. In the same animals, lesions did not affect fear response to the tone at any time. These results indicate that fear memory is not a single process and that the hippocampus may have a time-limited role in associative fear memories evoked by polymodal (contextual) but not unimodal (tone) sensory stimuli.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, J J -- Fanselow, M S -- New York, N.Y. -- Science. 1992 May 1;256(5057):675-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1585183" target="_blank"〉PubMed〈/a〉
    Keywords: Amnesia, Retrograde/*etiology/physiopathology ; Animals ; Behavior, Animal/physiology ; Conditioning, Classical/*physiology ; Electroshock ; Fear/*physiology ; Female ; Hippocampus/physiopathology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 99
    facet.materialart.
    Unknown
    Involvement of the N-methyl D-aspartate (NMDA) receptor in synapse elimination during cerebellar development (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-06-26
    Description: In many instances, the establishment of highly specific neuronal connections during development results from the rearrangement of axonal projections through the trimming of exuberant collaterals or the elimination of functional synapses or both. Although the involvement of the N-methyl D-aspartate (NMDA) subtype of the glutamate receptor has been demonstrated in the shaping of axonal arbors, its participation in the process of selective stabilization of synapses remains an open issue. In this study, the effects of chronic in vivo application of D,L-2-amino-5-phosphonovaleric acid (D,L-APV), a selective antagonist of the NMDA receptor, on the synapse elimination process that takes place in the developing cerebellum of the rat have been analyzed. D,L-APV treatment prevented the regression of supernumerary climbing fiber synapses in 49 percent of the recorded Purkinje cells, while the inactive isomer L-APV was ineffective. Thus, activation of the NMDA receptor is a critical step in the regression of functional synapses during development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rabacchi, S -- Bailly, Y -- Delhaye-Bouchaud, N -- Mariani, J -- New York, N.Y. -- Science. 1992 Jun 26;256(5065):1823-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Universite Pierre and Marie Curie, Institut des Neurosciences, Paris, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1352066" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Animals ; Animals, Newborn ; Cerebellum/*growth & development ; Electrophysiology ; Purkinje Cells/drug effects/physiology ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/*physiology ; Synapses/drug effects/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 100
    facet.materialart.
    Unknown
    The dispersion of neuronal clones across the cerebral cortex (1992)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1992-10-09
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kirkwood, T B -- Price, J -- Grove, E A -- New York, N.Y. -- Science. 1992 Oct 9;258(5080):317-20.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/1411530" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Count ; Cerebral Cortex/*cytology ; Clone Cells/*cytology ; Genetic Markers ; Neurons/*cytology ; Rats ; Retroviridae
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...