ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Ihre E-Mail wurde erfolgreich gesendet. Bitte prüfen Sie Ihren Maileingang.

Leider ist ein Fehler beim E-Mail-Versand aufgetreten. Bitte versuchen Sie es erneut.

Vorgang fortführen?

Exportieren
Filter
  • Artikel  (333)
  • Rats  (141)
  • Male  (114)
  • Cells, Cultured  (61)
  • RNA, Messenger/genetics  (60)
  • Analytical Chemistry and Spectroscopy
  • Chemistry
  • Ertrag
  • Hafer
  • Inorganic Chemistry
  • LUNAR AND PLANETARY EXPLORATION
  • Life and Medical Sciences
  • American Association for the Advancement of Science (AAAS)  (333)
  • 2015-2019
  • 2005-2009
  • 1985-1989  (333)
  • 1935-1939
  • 1930-1934
  • 1910-1914
  • 1989  (163)
  • 1987  (170)
Sammlung
  • Artikel  (333)
Datenquelle
Schlagwörter
Verlag/Herausgeber
Erscheinungszeitraum
  • 2015-2019
  • 2005-2009
  • 1985-1989  (333)
  • 1935-1939
  • 1930-1934
    • +
Jahr
Zeitschrift
Thema
  • 1
    facet.materialart.
    Unbekannt
    Freeze avoidance in a mammal: body temperatures below 0 degree C in an Arctic hibernator (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-30
    Beschreibung: Hibernating arctic ground squirrels, Spermophilus parryii, were able to adopt and spontaneously arouse from core body temperatures as low as -2.9 degrees C without freezing. Abdominal body temperatures of ground squirrels hibernating in outdoor burrows were recorded with temperature-sensitive radiotransmitter implants. Body temperatures and soil temperatures at hibernaculum depth reached average minima during February of -1.9 degrees and -6 degrees C, respectively. Laboratory-housed ground squirrels hibernating in ambient temperatures of -4.3 degrees C maintained above 0 degree C thoracic temperatures but decreased colonic temperatures to as low as -1.3 degrees C. Plasma sampled from animals with below 0 degree C body temperatures had normal solute concentrations and showed no evidence of containing antifreeze molecules.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barnes, B M -- HD 23383/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1593-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Arctic Biology, University of Alaska Fairbanks, Fairbanks 99775-0180.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740905" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antifreeze Proteins ; Arctic Regions ; Arousal ; *Body Temperature ; Body Temperature Regulation ; Female ; *Freezing ; Glycoproteins/analysis ; *Hibernation ; Male ; Sciuridae/*physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 2
    facet.materialart.
    Unbekannt
    Specific recognition of cruciform DNA by nuclear protein HMG1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-24
    Beschreibung: Cruciform DNA, a non-double helix form of DNA, can be generated as an intermediate in genetic recombination as well as from palindromic sequences under the effect of supercoiling. Eukaryotic cells are equipped with a DNA-binding protein that selectively recognizes cruciform DNA. Biochemical and immunological data showed that this protein is HMG1, an evolutionarily conserved, essential, and abundant component of the nucleus. The interaction with a ubiquitous protein points to a critical role for cruciform DNA conformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bianchi, M E -- Beltrame, M -- Paonessa, G -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1056-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉European Molecular Biology Laboratory, Heidleberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922595" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/*metabolism ; Electrophoresis, Polyacrylamide Gel ; High Mobility Group Proteins/genetics/isolation & purification/*metabolism ; Immunoassay ; Immunoblotting ; Liver/analysis ; Molecular Sequence Data ; Molecular Weight ; *Nucleic Acid Conformation ; Peptide Fragments/genetics/isolation & purification ; Protein Biosynthesis ; Rats ; Transcription, Genetic
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 3
    facet.materialart.
    Unbekannt
    Temperature and sperm incorporation in polyploid salamanders (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-24
    Beschreibung: Although most animals reproduce sexually, a number of all-female groups exist. Triploid hybrid salamanders appear to maintain themselves by using a male's sperm to activate their eggs, after which the sperm nucleus is eliminated (gynogenesis). The incidence of sperm nuclear incorporation in eggs of these salamanders depends on temperature. Triploid offspring derived gynogenetically are more frequent at lower temperature, whereas tetraploid offspring derived sexually are far more frequent at higher temperatures. Temperature-dependent variability in sperm nuclear incorporation helps explain the variability in reproductive modes reported for hybrid salamanders.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bogart, J P -- Elinson, R P -- Licht, L E -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1032-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Zoology, College of Biological Science, University of Guelph, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587986" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Ambystoma/genetics/*physiology ; Animals ; Crosses, Genetic ; Female ; Karyotyping ; Larva ; Male ; *Polyploidy ; Sperm-Ovum Interactions ; Spermatozoa/*physiology ; Temperature
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 4
    facet.materialart.
    Unbekannt
    Endothelial interleukin-8: a novel inhibitor of leukocyte-endothelial interactions (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: Certain inflammatory stimuli render cultured human vascular endothelial cells hyperadhesive for neutrophils. This state is transient and reversible, in part because activated endothelial cells secrete a leukocyte adhesion inhibitor (LAI). LAI was identified as endothelial interleukin-8 (IL-8), the predominant species of which is an extended amino-terminal IL-8 variant. At nanomolar concentrations, purified endothelial IL-8 and recombinant human IL-8 inhibit neutrophil adhesion to cytokine-activated endothelial monolayers and protect these monolayers from neutrophil-mediated damage. These findings suggest that endothelial-derived IL-8 may function to attenuate inflammatory events at the interface between vessel wall and blood.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gimbrone, M A Jr -- Obin, M S -- Brock, A F -- Luis, E A -- Hass, P E -- Hebert, C A -- Yip, Y K -- Leung, D W -- Lowe, D G -- Kohr, W J -- P01-HL-36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1601-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688092" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Biological Factors/pharmacology ; Cell Adhesion/drug effects ; Cells, Cultured ; Chemotactic Factors/*isolation & purification/pharmacology ; Culture Media/analysis ; Cytokines ; Endothelium, Vascular/cytology/drug effects/*physiology ; Humans ; Interleukin-1/*pharmacology ; Interleukin-8 ; Interleukins/*isolation & purification/pharmacology ; Molecular Sequence Data ; Neutrophils/cytology/drug effects/*physiology ; Recombinant Proteins/pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 5
    facet.materialart.
    Unbekannt
    Expression of functional nerve growth factor receptors after gene transfer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: Nerve growth factor (NGF) interacts with both high affinity (Kd = 10(-10)-10(-11)M) and low affinity (Kd = 10(-8)-10(-9)M) receptors; the binding of NGF to the high affinity receptor is correlated with biological actions of NGF. To determine whether a single NGF binding protein is common to both forms of the receptor, a full-length receptor cDNA was introduced in the NR18 cell line, an NGF receptor-deficient variant of the PC12 pheochromocytoma cell line. The transformant displayed (i) both high and low affinity receptors detectable by receptor binding; (ii) an affinity cross-linking pattern with 125I-labeled NGF similar to that of the parent PC12 cell line; and (iii) biological responsiveness to NGF as assayed by induction of c-fos transcription. These findings support the hypothesis that a single binding protein is common to both forms of the NGF receptor and suggest that an additional protein is required to produce the high affinity form of the NGF receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hempstead, B L -- Schleifer, L S -- Chao, M V -- HD23315/HD/NICHD NIH HHS/ -- NS-21072/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):373-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536190" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Blotting, Northern ; Cloning, Molecular ; Gene Expression Regulation ; Nerve Growth Factors/pharmacology ; Pheochromocytoma ; Proto-Oncogene Proteins/genetics ; Proto-Oncogene Proteins c-fos ; Rats ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Nerve Growth Factor ; Transformation, Genetic ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 6
    facet.materialart.
    Unbekannt
    Indole-2-carboxylic acid: a competitive antagonist of potentiation by glycine at the NMDA receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-24
    Beschreibung: The N-methyl-D-aspartate (NMDA) class of excitatory amino acid receptors regulates the strength and stability of excitatory synapses and appears to play a major role in excitotoxic neuronal death associated with stroke and epilepsy. The conductance increase gated by NMDA is potentiated by the amino acid glycine, which acts at an allosteric site tightly coupled to the NMDA receptor. Indole-2-carboxylic acid (I2CA) specifically and competitively inhibits the potentiation by glycine of NMDA-gated current. In solutions containing low levels of glycine, I2CA completely blocks the response to NMDA, suggesting that NMDA alone is not sufficient for channel activation. I2CA will be useful for defining the interaction of glycine with NMDA receptors and for determining the in vivo role of glycine in excitotoxicity and synapse stabilization.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huettner, J E -- HL-35034/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467381" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Aspartic Acid/*analogs & derivatives/physiology ; Cells, Cultured ; Electric Conductivity ; Glycine/*antagonists & inhibitors ; In Vitro Techniques ; Indoles/*pharmacology ; Ion Channels/drug effects ; N-Methylaspartate ; Neural Inhibition ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*drug effects ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 7
    facet.materialart.
    Unbekannt
    Immunodeficiency and clonal growth of target cells induced by helper-free defective retrovirus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: The murine acquired immunodeficiency syndrome is induced by a defective retrovirus. To study the role of virus replication in this disease, helper-free stocks of defective Duplan virus were produced. These stocks were highly pathogenic in absence of detectable replicating murine leukemia viruses (MuLVs) other than xenotropic MuLV. They induced expansion of the infected cell population (over 1000-fold), and this cell expansion was oligoclonal in origin and, most likely, arose through cell division. These results suggest that this defective virus is oncogenic, inducing a primary neoplasia associated with an acquired immunodeficiency syndrome as a paraneoplastic syndrome. These data emphasize the need to determine whether virus replication is necessary for the progression of other immunodeficiency diseases, including acquired immunodeficiency syndrome, and whether these diseases also represent paraneoplastic syndromes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huang, M -- Simard, C -- Jolicoeur, P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1614-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Biology, Clinical Research Institute of Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480643" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Blotting, Southern ; Cells, Cultured ; DNA, Viral/isolation & purification ; Defective Viruses/isolation & purification/*pathogenicity ; Helper Viruses/isolation & purification ; Immunologic Deficiency Syndromes/*microbiology ; Leukemia Virus, Murine/pathogenicity ; Lymph Nodes/microbiology ; Lymphocytes/microbiology ; Mice ; Mice, Inbred C57BL ; RNA-Directed DNA Polymerase/analysis ; Retroviridae/isolation & purification/*pathogenicity ; Retroviridae Infections/*microbiology ; Spleen/microbiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 8
    facet.materialart.
    Unbekannt
    Sequence-specific peptide cleavage catalyzed by an antibody (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-03
    Beschreibung: Monoclonal antibodies have been induced that are capable of catalyzing specific hydrolysis of the Gly-Phe bond of peptide substrates at neutral pH with a metal complex cofactor. The antibodies were produced by immunizing with a Co(III) triethylenetetramine (trien)-peptide hapten. These antibodies as a group are capable of binding trien complexes of not only Co(III) but also of numerous other metals. Six peptides were examined as possible substrates with the antibodies and various metal complexes. Two of these peptides were cleaved by several of the antibodies. One antibody was studied in detail, and cleavage was observed for the substrates with the trien complexes of Zn(II), Ga(III), Fe(III), In(III), Cu(II), Ni(II), Lu(III), Mg(II), or Mn(II) as cofactors. A turnover number of 6 x 10(-4) per second was observed for these substrates. These results demonstrate the feasibility of the use of cofactor-assisted catalysis in an antibody binding site to accomplish difficult chemical transformations.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Iverson, B L -- Lerner, R A -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1184-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922606" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; *Antibodies, Monoclonal ; Antigens/immunology ; Binding Sites, Antibody ; Catalysis ; Chemical Phenomena ; Chemistry ; Cobalt/immunology/metabolism ; Glycine/metabolism ; Haptens/immunology ; Hydrogen-Ion Concentration ; Hydrolysis ; Immunization ; Metals/metabolism ; Mice ; Molecular Sequence Data ; Molecular Structure ; Oligopeptides/*metabolism ; Phenylalanine/metabolism ; Trientine/immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 9
    facet.materialart.
    Unbekannt
    Effects of glucocorticoids and norepinephrine on the excitability in the hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-29
    Beschreibung: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 10
    facet.materialart.
    Unbekannt
    Fibroblasts transformed with v-src show enhanced formation of an inositol tetrakisphosphate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-10-06
    Beschreibung: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 11
    facet.materialart.
    Unbekannt
    Golf: an olfactory neuron specific-G protein involved in odorant signal transduction (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-19
    Beschreibung: Biochemical and electrophysiological studies suggest that odorants induce responses in olfactory sensory neurons via an adenylate cyclase cascade mediated by a G protein. An olfactory-specific guanosine triphosphate (GTP)-binding protein alpha subunit has now been characterized and evidence is presented suggesting that this G protein, termed Golf, mediates olfaction. Messenger RNA that encodes Golf alpha is expressed in olfactory neuroephithelium but not in six other tissues tested. Moreover, within the olfactory epithelium, Golf alpha appears to be expressed only by the sensory neurons. Specific antisera were used to localize Golf alpha protein to the sensory apparatus of the receptor neurons. Golf alpha shares extensive amino acid identity (88 percent) with the stimulatory G protein, Gs alpha. The expression of Golf alpha in S49 cyc- kin- cells, a line deficient in endogenous stimulatory G proteins, demonstrates its capacity to stimulate adenylate cyclase in a heterologous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, D T -- Reed, R R -- New York, N.Y. -- Science. 1989 May 19;244(4906):790-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Molecular Biology and Genetic Johns Hopkins School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499043" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adenylyl Cyclases/metabolism ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; GTP-Binding Proteins/analysis/genetics/*physiology ; Gene Expression Regulation ; Immunoblotting ; Immunohistochemistry ; Molecular Sequence Data ; Neurons, Afferent/analysis/*physiology ; *Odors ; Olfactory Bulb/physiology ; Olfactory Mucosa/analysis/*innervation ; RNA, Messenger/analysis/genetics ; Rats ; Sequence Homology, Nucleic Acid ; *Signal Transduction ; Tissue Distribution ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 12
    facet.materialart.
    Unbekannt
    Localization and mobility of omega-conotoxin-sensitive Ca2+ channels in hippocampal CA1 neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-09
    Beschreibung: Voltage-dependent Ca2+ channels (VDCCs) are modulators of synaptic plasticity, oscillatory behavior, and rhythmic firing in brain regions such as the hippocampus. The distribution and lateral mobility of VDCCs on CA1 hippocampal neurons have been determined with biologically active fluorescent and biotinylated derivatives of the selective probe omega-conotoxin in conjunction with circular dityndallism, digital fluorescence imaging, and photobleach recovery microscopy. On noninnervated cell bodies, VDCCs were found to be organized in multiple clusters, whereas after innervation the VDCCs were concentrated and immobilized at synaptic contact sites. On dendrites, VDCC distribution was punctate and was interrupted by extensive bare regions or abruptly terminated. More than 85% of the dendritic VDCCs were found to be immobile by fluorescence photobleach recovery. Thus, before synaptic contact, specific mechanisms target, segregate, and immobilize VDCCs to neuronal cell bodies and to specialized dendritic sites. Regulation of this distribution may be critical in determining the firing activity and integrative properties of hippocampal CA1 neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Jones, O T -- Kunze, D L -- Angelides, K J -- NS01218/NS/NINDS NIH HHS/ -- NS23575/NS/NINDS NIH HHS/ -- NS24606/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1189-93.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Molecular Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543080" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Calcium Channel Blockers/*pharmacology ; Calcium Channels/drug effects/*physiology ; Cells, Cultured ; Electric Conductivity ; Hippocampus/*physiology ; Membrane Potentials/drug effects ; Mollusk Venoms/*pharmacology ; Neurons/drug effects/*physiology ; Pyramidal Tracts/*physiology ; *omega-Conotoxins
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 13
    facet.materialart.
    Unbekannt
    Increased expression of DNA cointroduced with nuclear protein in adult rat liver (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: DNA and nuclear proteins were transferred into cells simultaneously at more than 95% efficiency by means of vesicle complexes. The DNA was rapidly transported into the nuclei of cultured cells, and its expression reached a maximum within 6 to 8 hours after its introduction. Moreover, when the plasmid DNA and nuclear protein were cointroduced into nondividing cells in rat liver by injection into the portal veins of adult rats, the plasmid DNA was carried into liver cell nuclei efficiently by nuclear protein. The expression of the DNA in adult rat liver, on introduction of the DNA with nuclear protein, was more than five times as great as with nonnuclear protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaneda, Y -- Iwai, K -- Uchida, T -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):375-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911748" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Blotting, Northern ; Cell Compartmentation ; Cell Nucleus/metabolism ; Cells, Cultured ; DNA/*metabolism/pharmacokinetics ; High Mobility Group Proteins/*metabolism ; Liver/*metabolism ; Mice ; Rats ; Transformation, Genetic
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 14
    facet.materialart.
    Unbekannt
    Defensive behaviors in infant rhesus monkeys: environmental cues and neurochemical regulation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-31
    Beschreibung: To survive, primates must detect danger in time to activate appropriate defensive behaviors. In this study, the defensive behaviors of infant rhesus monkeys exposed to humans were characterized. It was observed that the direction of the human's gaze is a potent cue for the infant. Infants separated from their mothers were active and emitted frequent distress vocalizations. When a human entered the room but did not look at the infant, it became silent and froze in one position. If the human stared at the infant, it responded with aggressive barking. Alterations of the opiate system affected the frequency of the infant's distress calls without affecting barking and freezing, whereas benzodiazepine administration selectively reduced barking and freezing. This suggests that opiate and benzodiazepine systems regulate specific defensive behaviors in primates and that these systems work together to mediate behavioral responses important for survival.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kalin, N H -- Shelton, S E -- DK-35641/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1718-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, University of Wisconsin, Madison.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2564702" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Aggression/physiology ; Animals ; Behavior, Animal/drug effects/*physiology ; Benzodiazepines/physiology ; Diazepam/pharmacology ; Endorphins/antagonists & inhibitors/physiology ; *Fear ; Female ; Macaca/*physiology ; Macaca mulatta/*physiology ; Male ; Morphine/pharmacology ; Motion ; Motor Activity/drug effects/physiology ; Naloxone/pharmacology ; Neurotransmitter Agents/*physiology ; Vision, Ocular ; Vocalization, Animal/drug effects/physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 15
    facet.materialart.
    Unbekannt
    Corticosteroid modulation of hippocampal potentials: increased effect with aging (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-29
    Beschreibung: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 16
    facet.materialart.
    Unbekannt
    Antisense RNA-induced reduction in murine TIMP levels confers oncogenicity on Swiss 3T3 cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-17
    Beschreibung: Mouse 3T3 cell lines capable of constitutively synthesizing an RNA complementary to the messenger RNA encoding TIMP, tissue inhibitor of metalloproteinases, were constructed by transfection with appropriate plasmid constructs. Many of the lines were down-modulated for TIMP messenger RNA levels and secreted less TIMP into the culture medium. In comparison to noninvasive, nontumorigenic controls, these cells not only were invasive in a human amnion invasion assay, but also were tumorigenic and metastatic in athymic mice. These results indicate that TIMP suppresses oncogenicity, at least in immortal murine 3T3 cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Khokha, R -- Waterhouse, P -- Yagel, S -- Lala, P K -- Overall, C M -- Norton, G -- Denhardt, D T -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):947-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of Western Ontario, London, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2465572" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; *Cell Transformation, Neoplastic ; Cells, Cultured ; Enzyme Inhibitors/*genetics/metabolism ; Female ; Metalloendopeptidases/antagonists & inhibitors ; Mice ; Mice, Nude ; Neoplasm Metastasis ; Pituitary Neoplasms/genetics/pathology ; RNA/*genetics ; RNA, Antisense ; RNA, Messenger/*antagonists & inhibitors/genetics ; Tissue Inhibitor of Metalloproteinases ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 17
    facet.materialart.
    Unbekannt
    Potassium channels in cardiac cells activated by arachidonic acid and phospholipids (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-09
    Beschreibung: Two types of potassium-selective channels activated by intracellular arachidonic acid or phosphatidylcholine have been found in neonatal rat atrial cells. In inside-out patches, arachidonic acid and phosphatidylcholine each opened outwardly rectifying potassium-selective channels with conductances of 160 picosiemens (IK.AA) and 68 picosiemens (IK.PC), respectively. These potassium channels were not sensitive to internally applied adenosine triphosphate (ATP), magnesium, or calcium. Lowering the intracellular pH from 7.2 to 6.8 or 6.4 reversibly increased IK.AA channel activity three- or tenfold, respectively. A number of fatty acid derivatives were tested for their ability to activate IK.AA. These potassium-selective channels may help explain the increase in potassium conductance observed in ischemic cells and raise the possibility that fatty acid derivatives act as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kim, D -- Clapham, D E -- HL 34873/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1174-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, Mayo Foundation, Rochester, MN 55905.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727703" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Animals, Newborn ; Arachidonic Acids/*pharmacology ; Atrial Function ; Heart/*physiology ; Hydrogen-Ion Concentration ; In Vitro Techniques ; Kinetics ; Membrane Potentials ; Phosphatidylcholines/*pharmacology ; Potassium Channels/drug effects/*physiology ; Rats
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 18
    facet.materialart.
    Unbekannt
    cis-trans models for post-transcriptional gene regulation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-17
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Klausner, R D -- Harford, J B -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):870-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683086" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Base Sequence ; *Gene Expression Regulation ; *Models, Genetic ; Molecular Sequence Data ; Nucleic Acid Conformation ; *Protein Biosynthesis ; RNA, Messenger/genetics ; Transcription, Genetic
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 19
    facet.materialart.
    Unbekannt
    The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-31
    Beschreibung: C/EBP is a rat liver nuclear protein capable of sequence-specific interaction with DNA. The DNA sequences to which C/EBP binds in vitro have been implicated in the control of messenger RNA synthesis. It has therefore been predicted that C/EBP will play a role in regulating gene expression in mammalian cells. The region of the C/EBP polypeptide required for direct interaction with DNA has been identified and shown to bear amino acid sequence relatedness with the product of the myc, fos, and jun proto-oncogenes. The arrangement of these related amino acid sequences led to the prediction of a new structural motif, termed the "leucine zipper," that plays a role in facilitating sequence-specific interaction between protein and DNA. Experimental tests now provide support for the leucine zipper hypothesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Landschulz, W H -- Johnson, P F -- McKnight, S L -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1681-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Carnegie Institution of Washington, Department of Embryology, Baltimore, MD 21210.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2494700" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Binding Sites ; CCAAT-Enhancer-Binding Proteins ; Cross-Linking Reagents ; DNA/*metabolism ; Glutaral ; Leucine ; Liver/*analysis ; Macromolecular Substances ; Molecular Weight ; Mutation ; Nuclear Proteins/genetics/*metabolism ; Protein Conformation ; Rats ; Repetitive Sequences, Nucleic Acid ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 20
    facet.materialart.
    Unbekannt
    The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-17
    Beschreibung: T lymphocyte chemotactic factor (TCF) was purified to homogeneity from the conditioned media of phytohemagglutinin-stimulated human blood mononuclear leukocytes by a sequence of chromatography procedures. The amino-terminal amino acid sequence of the purified TCF showed identity with neutrophil-activating protein (NAP-1). Both TCF and recombinant NAP-1 (rNAP-1) were chemotactic for neutrophils and T lymphocytes in vitro supporting the identity of TCF with NAP-1. Injection of rNAP-1 into lymphatic drainage areas of lymph nodes in Fisher rats caused accelerated emigration of only lymphocytes in high endothelial venules. Intradermal injection of rNAP-1 caused dose-dependent accumulation of neutrophils and lymphocytes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larsen, C G -- Anderson, A O -- Appella, E -- Oppenheim, J J -- Matsushima, K -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1464-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, National Cancer Institute, Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648569" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Chemotactic Factors/*isolation & purification ; *Chemotaxis, Leukocyte ; Interleukin-8 ; Peptides/*isolation & purification ; Rats ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 21
    facet.materialart.
    Unbekannt
    Monitoring the AIDS epidemic in the United States: a network approach (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-09
    Beschreibung: Respondents in the 1988 General Social Survey (GSS) were asked to scan their acquaintance networks to identify all those who had been a victim of a homicide or had acquired immunodeficiency syndrome (AIDS). Estimates of the sex, race, age, and regional breakdowns for homicides in the last year and for people with AIDS were compared with official statistics. The GSS estimates for the distribution of homicide victims replicate the official statistics quite well. The GSS estimates for AIDS cases suggest that the data provided to the Centers for Disease Control may underestimate by a substantial margin the prevalence of AIDS in the white population of higher socioeconomic status, overstate the relative prevalence of the disease in the minority populations, underestimate the prevalence of the disease in the Midwest, and overstate it for the East.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Laumann, E O -- Gagnon, J H -- Michaels, S -- Michael, R T -- Coleman, J S -- N0I-HD-8-2907/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1186-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Sociology, University of Chicago, IL 60637.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543079" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acquired Immunodeficiency Syndrome/*epidemiology ; Centers for Disease Control and Prevention (U.S.) ; Demography ; Female ; Humans ; Male ; Population Surveillance ; United States
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 22
    facet.materialart.
    Unbekannt
    Identification of the molecular defect in a family with spondyloepiphyseal dysplasia (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-26
    Beschreibung: Spondyloepiphyseal dysplasias (SED) are a heterogeneous group of inherited disorders characterized by disproportionate short stature and pleiotropic involvement of the skeletal and ocular systems. Evidence has suggested that SED may result from structural defects in type II collagen. To confirm the validity of this hypothesis, the structure of the "candidate" type II collagen gene (COL2A1) has been directly examined in a relatively large SED family. Coarse scanning of the gene by Southern blot hybridization identified an abnormal restriction pattern in one of the affected members of the kindred. Analysis of selected genomic fragments, amplified by the polymerase chain reaction, precisely localized the molecular defect and demonstrated that all affected family members carried the same heterozygous single-exon deletion. As a consequence of the mutation, nearly 90 percent of the assembled type II collagen homotrimers are expected to contain one or more procollagen subunits harboring an interstitial deletion of 36 amino acids in the triple helical domain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, B -- Vissing, H -- Ramirez, F -- Rogers, D -- Rimoin, D -- AR-38648/AR/NIAMS NIH HHS/ -- HD-22657/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 May 26;244(4907):978-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, State University of New York Health Science Center, Brooklyn 11203.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543071" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Child, Preschool ; Chromosome Deletion ; Collagen/*genetics ; DNA Restriction Enzymes ; DNA-Directed DNA Polymerase ; Exons ; Female ; Gene Amplification ; Humans ; Macromolecular Substances ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Osteochondrodysplasias/*genetics ; Pedigree ; Procollagen/genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 23
    facet.materialart.
    Unbekannt
    Purification and complementary DNA cloning of a receptor for basic fibroblast growth factor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-07
    Beschreibung: Basic fibroblast growth factor (bFGF) participates in many processes including early developmental events, angiogenesis, wound healing, and maintenance of neuronal cell viability. A 130-kilodalton protein was isolated on the basis of its ability to specifically bind to bFGF. A complementary DNA clone was isolated with an oligonucleotide probe corresponding to determined amino acid sequences of tryptic peptide fragments of the purified protein. The putative bFGF receptor encoded by this complementary DNA is a transmembrane protein that contains three extracellular immunoglobulin-like domains, an unusual acidic region, and an intracellular tyrosine kinase domain. These domains are arranged in a pattern that is different from that of any growth factor receptor described.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, P L -- Johnson, D E -- Cousens, L S -- Fried, V A -- Williams, L T -- CA 21765/CA/NCI NIH HHS/ -- R01 HL32898/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):57-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2544996" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Base Sequence ; Cells, Cultured ; Chick Embryo ; *Cloning, Molecular ; DNA/*genetics ; Fibroblast Growth Factors/*genetics ; Kinetics ; Mice ; Molecular Sequence Data ; Peptide Fragments/analysis ; Receptors, Cell Surface/*genetics/metabolism ; Receptors, Fibroblast Growth Factor ; Recombinant Proteins/metabolism
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 24
    facet.materialart.
    Unbekannt
    Secretion of activin by interstitial cells in the testis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: Activin, a dimer formed by the beta subunits of inhibin, has an effect that is opposite to that of inhibin in a number of biological systems. Which cell types secrete activin in vivo is not known. TM3 cells, a Leydig-derived cell line, contained messenger RNAs that hybridized with human beta A and beta B complementary DNA probes and were similar in size to the porcine messenger RNA for the beta subunits of inhibin. No hybridization to the inhibin alpha subunit was detectable in the TM3 cells. Conditioned medium from TM3 cells and from primary cultures of rat and porcine interstitial cells stimulated the release of follicle-stimulating hormone in a pituitary cell culture assay. It is likely that, in the testis, the Leydig cells secrete activin and the Sertoli cells produce inhibin, or a combination of both.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lee, W -- Mason, A J -- Schwall, R -- Szonyi, E -- Mather, J P -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):396-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture, Genentech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492117" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Activins ; Animals ; Cell Line ; Follicle Stimulating Hormone/secretion ; Inhibins/*physiology/*secretion ; Leydig Cells/*physiology ; Male ; Mice ; Rats ; Sertoli Cells/physiology ; Swine ; Testis/cytology/*physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 25
    facet.materialart.
    Unbekannt
    Atrial natriuretic peptide inhibits a cation channel in renal inner medullary collecting duct cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: The patch-clamp technique was used to examine the effects of atrial natriuretic peptide (ANP) and its second messenger guanosine 3',5'-monophosphate (cGMP) on an amiloride-sensitive cation channel in the apical membrane of renal inner medullary collecting duct cells. Both ANP (10(-11) M) and dibutyryl guanosine 3',5'-monophosphate (10(-4) M) inhibited the channel in cell-attached patches, and cGMP (10(-5) M) inhibited the channel in inside-out patches. The inner medullary collecting duct is the first tissue in which ANP, via its second messenger cGMP, has been shown to regulate single ion channels. The results suggest that the natriuretic action of ANP is related in part to cGMP-mediated inhibition of electrogenic Na+ absorption by the inner medullary collecting duct.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Light, D B -- Schwiebert, E M -- Karlson, K H -- Stanton, B A -- DK-34533/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):383-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463673" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Aminoquinolines/pharmacology ; Animals ; Atrial Natriuretic Factor/*pharmacology ; Cell Membrane/drug effects ; Cells, Cultured ; Cyclic GMP/pharmacology ; Ion Channels/*drug effects ; Kidney Medulla/drug effects ; Kidney Tubules/*drug effects ; Kidney Tubules, Collecting/*drug effects ; Natriuresis ; Rats ; Sodium/metabolism
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 26
    facet.materialart.
    Unbekannt
    Polymerase chain reaction with single-sided specificity: analysis of T cell receptor delta chain (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-13
    Beschreibung: In the polymerase chain reaction (PCR), two specific oligonucleotide primers are used to amplify the sequences between them. However, this technique is not suitable for amplifying genes that encode molecules where the 5' portion of the sequences of interest is not known, such as the T cell receptor (TCR) or immunoglobulins. Because of this limitation, a novel technique, anchored polymerase chain reaction (A-PCR), was devised that requires sequence specificity only on the 3' end of the target fragment. It was used to analyze TCR delta chain mRNA's from human peripheral blood gamma delta T cells. Most of these cells had a V delta gene segment not previously described (V delta 3), and the delta chain junctional sequences formed a discrete subpopulation compared with those previously reported.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loh, E Y -- Elliott, J F -- Cwirla, S -- Lanier, L L -- Davis, M M -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):217-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Departments of Medicine and Microbiology and Immunology, Stanford University School of Medicine, CA 94305-5402.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2463672" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Cell Line ; Gene Amplification ; *Genes ; Humans ; Macromolecular Substances ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; RNA-Directed DNA Polymerase ; Receptors, Antigen, T-Cell/*genetics ; T-Lymphocytes/immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 27
    facet.materialart.
    Unbekannt
    Molecular cloning of genes under control of the circadian clock in Neurospora (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: To investigate the regulation of messenger RNA abundance by circadian clocks, genomic and complementary DNA libraries were screened with complementary DNA probes enriched, by means of sequential rounds of subtractive hybridization, for sequences complementary to transcripts specific to either early morning or early evening cultures of Neurospora. Only two morning-specific genes were identified through this protocol. RNA blot analysis verified that the abundance of the transcripts arising from these genes oscillates with a period of 21.5 hours in a clock wild-type strain and 29 hours in the long-period clock mutant strain frq7. Genetic mapping through the use of restriction fragment length polymorphisms shows the two genes, ccg-1 and ccg-2, to be unlinked. These data provide a view of the extent of clock control of gene expression.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loros, J J -- Denome, S A -- Dunlap, J C -- CA-23108/CA/NCI NIH HHS/ -- GM 34985/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Dartmouth Medical School, Hanover, NH 03756.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563175" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Chromosome Mapping ; *Circadian Rhythm ; Cloning, Molecular ; Genes, Fungal ; Neurospora/*genetics ; Neurospora crassa/*genetics/physiology ; Polymorphism, Restriction Fragment Length ; RNA, Fungal/genetics ; RNA, Messenger/genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 28
    facet.materialart.
    Unbekannt
    Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-19
    Beschreibung: T cell vaccination against experimental autoimmune disease is herein shown to be mediated in part by anti-ergotypic T cells, T cells that recognize and respond to the state of activation of other T cells. The anti-ergotypic response thus combines with the previously shown anti-idiotypic T cell response to regulate autoimmunity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lohse, A W -- Mor, F -- Karin, N -- Cohen, I R -- NS 23372/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):820-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Weizmann Institute of Science, Department of Cell Biology, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2471264" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, Bacterial/immunology ; Autoimmune Diseases/*immunology ; Concanavalin A/pharmacology ; Encephalomyelitis, Autoimmune, Experimental/*immunology ; Hypersensitivity, Delayed ; Immunization ; Immunization, Passive ; Immunoglobulin Idiotypes/immunology ; Lymphocyte Activation ; Mycobacterium tuberculosis/immunology ; Myelin Basic Protein/immunology ; Rats ; Rats, Inbred Lew ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 29
    facet.materialart.
    Unbekannt
    Specific block of calcium channel expression by a fragment of dihydropyridine receptor cDNA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-03
    Beschreibung: Although the structure of rabbit skeletal muscle dihydropyridine (DHP) receptor, deduced from cDNA sequence, indicates that this protein is the channel-forming subunit of voltage-dependent calcium channel (VDCC), no functional proof for this prediction has been presented. Two DNA oligonucleotides complementary to DHP-receptor RNA sequences coding for putative membrane-spanning regions of the DHP receptor specifically suppress the expression of the DHP-sensitive VDCC from rabbit and rat heart in Xenopus oocytes. However, these oligonucleotides do not suppress the expression of the DHP-insensitive VDCC and of voltage-dependent sodium and potassium channels. Thus, the gene for DHP receptor of rabbit skeletal muscle is closely related, or identical to, a gene expressed in heart that encodes a component of the DHP-sensitive VDCC. The DHP-sensitive and DHP-insensitive VDCCs are distinct molecular entities.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lotan, I -- Goelet, P -- Gigi, A -- Dascal, N -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):666-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2464853" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): 3-Pyridinecarboxylic acid, ; 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ; ester/pharmacology ; Animals ; Calcium Channels/drug effects/*physiology ; DNA/*genetics ; DNA Probes ; Electric Conductivity ; *Gene Expression Regulation ; Muscles/analysis ; Myocardium/analysis ; Nucleic Acid Hybridization ; Oocytes/physiology ; RNA/genetics ; RNA, Messenger/genetics ; Rabbits ; Rats ; Receptors, Nicotinic/*genetics ; Xenopus
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 30
    facet.materialart.
    Unbekannt
    Cloning and sequencing of porcine LH-hCG receptor cDNA: variants lacking transmembrane domain (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-04
    Beschreibung: Complementary DNA clones, encoding the LH-hCG (luteinizing hormone-human choriogonadotropic hormone) receptor were isolated by screening a lambda gt11 library with monoclonal antibodies. The primary structure of the protein was deduced from the DNA sequence analysis; the protein contains 696 amino acids with a putative signal peptide of 27 amino acids. Hydropathy analysis suggests the existence of seven transmembrane domains that show homology with the corresponding regions of other G protein-coupled receptors. Three other types of clones corresponding to shorter proteins were observed, in which the putative transmembrane domain was absent. These probably arose through alternative splicing. RNA blot analysis showed similar patterns in testis and ovary with a major RNA of 4700 nucleotides and several minor species. The messenger RNA was expressed in COS-7 cells, yielding a protein that bound hCG with the same affinity as the testicular receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Loosfelt, H -- Misrahi, M -- Atger, M -- Salesse, R -- Vu Hai-Luu Thi, M T -- Jolivet, A -- Guiochon-Mantel, A -- Sar, S -- Jallal, B -- Garnier, J -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):525-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut National de la Sante et de la Recherche Medicale Unite 135, Hopital de Bicetre, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502844" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Base Sequence ; Cell Membrane/*metabolism ; *Cloning, Molecular ; DNA/*genetics ; Female ; GTP-Binding Proteins/metabolism ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Ovary/analysis ; Protein Sorting Signals/genetics ; RNA, Messenger/analysis/genetics ; Receptors, LH/*genetics/metabolism ; Sequence Homology, Nucleic Acid ; Swine ; Testis/analysis ; Tissue Distribution
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 31
    facet.materialart.
    Unbekannt
    Pavlovian conditioning of rat mucosal mast cells to secrete rat mast cell protease II (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-06
    Beschreibung: Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacQueen, G -- Marshall, J -- Perdue, M -- Siegel, S -- Bienenstock, J -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):83-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, McMaster University, Hamilton, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911721" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acoustic Stimulation ; Animals ; *Conditioning, Classical ; Mast Cells/*enzymology/immunology ; Ovalbumin ; Photic Stimulation ; Rats ; Reference Values ; Serine Endopeptidases/*secretion
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 32
    facet.materialart.
    Unbekannt
    Relation of the amyloid beta protein precursor to heparan sulfate proteoglycans (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-19
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gowda, D C -- Margolis, R K -- Frangione, B -- Ghiso, J -- Larrondo-Lillo, M -- Margolis, R U -- New York, N.Y. -- Science. 1989 May 19;244(4906):826-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2499044" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adrenal Gland Neoplasms ; *Amyloid ; Amyloid beta-Protein Precursor ; Animals ; Heparin/*analogs & derivatives ; Pheochromocytoma ; *Protein Precursors ; *Proteoglycans ; Rats ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 33
    facet.materialart.
    Unbekannt
    Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-25
    Beschreibung: Long-term potentiation (LTP) of synaptic transmission is a widely studied cellular example of synaptic plasticity. However, the identity, localization, and interplay among the biochemical signals underlying LTP remain unclear. Intracellular microelectrodes have been used to record synaptic potentials and deliver protein kinase inhibitors to postsynaptic CA1 pyramidal cells. Induction of LTP is blocked by intracellular delivery of H-7, a general protein kinase inhibitor, or PKC(19-31), a selective protein kinase C (PKC) inhibitor, or CaMKII(273-302), a selective inhibitor of the multifunctional Ca2+-calmodulin-dependent protein kinase (CaMKII). After its establishment, LTP appears unresponsive to postsynaptic H-7, although it remains sensitive to externally applied H-7. Thus both postsynaptic PKC and CaMKII are required for the induction of LTP and a presynaptic protein kinase appears to be necessary for the expression of LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malinow, R -- Schulman, H -- Tsien, R W -- GM30179/GM/NIGMS NIH HHS/ -- NS24067/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):862-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular and Cellular Physiology, Beckman Center, Stanford University School of Medicine 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2549638" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine ; Animals ; Calcium-Calmodulin-Dependent Protein Kinases ; In Vitro Techniques ; Isoquinolines/pharmacology ; Piperazines/pharmacology ; Protein Kinase C/antagonists & inhibitors/*physiology ; Protein Kinase Inhibitors ; Protein Kinases/*physiology ; Rats ; Receptors, AMPA ; Receptors, Kainic Acid ; Receptors, Neurotransmitter/physiology ; Synapses/*physiology ; *Synaptic Transmission/drug effects
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 34
    facet.materialart.
    Unbekannt
    A pertussis toxin-sensitive G protein in hippocampal long-term potentiation (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-26
    Beschreibung: High-frequency (tetanic) stimulation of presynaptic nerve tracts in the hippocampal region of the brain can lead to long-term synaptic potentiation (LTP). Pertussis toxin prevented the development of tetanus-induced LTP in the stratum radiatum-CA1 synaptic system of rat hippocampal slices, indicating that a guanosine triphosphate-binding protein (G protein) may be required for the initiation of LTP. This G protein may be located at a site distinct from the postsynaptic neuron (that is, in presynaptic terminals or glial cells) since maximal activation of CA1 neuronal G proteins by intracellular injection of guanosine-5'-O-(3-thiotriphosphate), a nonhydrolyzable analog of guanosine 5'-triphosphate, did not occlude LTP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Goh, J W -- Pennefather, P S -- New York, N.Y. -- Science. 1989 May 26;244(4907):980-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Faculty of Pharmacy, University of Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543072" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Baclofen/pharmacology ; Electric Conductivity ; Enzyme Activation ; Evoked Potentials/drug effects ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Hippocampus/drug effects/*physiology ; Injections, Intraventricular ; Male ; Membrane Potentials ; Neurons/drug effects/physiology ; *Pertussis Toxin ; Protein Kinase C/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, GABA-A/physiology ; Synapses/drug effects/*physiology ; Thionucleotides/pharmacology ; Virulence Factors, Bordetella/*pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 35
    facet.materialart.
    Unbekannt
    Molecular mechanisms and forces involved in the adhesion and fusion of amphiphilic bilayers (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-17
    Beschreibung: The surface forces apparatus technique was used for measuring the adhesion, deformation, and fusion of bilayers supported on mica surfaces in aqueous solutions. The most important force leading to the direct fusion of bilayers is the hydrophobic interaction, although the occurrence of fusion is not simply related to the force law between bilayers. Bilayers do not need to "overcome" some repulsive force barrier, such as hydration, before they can fuse. Instead, once bilayer surfaces come within about 1 nanometer of each other, local deformations and molecular rearrangements allow them to "bypass" these forces.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Helm, C A -- Israelachvili, J N -- McGuiggan, P M -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):919-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Chemical and Nuclear Engineering, University of California, Santa Barbara 93106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814514" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Chemical Phenomena ; Chemistry ; *Lipid Bilayers ; Models, Biological ; Models, Structural ; Phosphatidylcholines ; Phosphatidylethanolamines
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 36
    facet.materialart.
    Unbekannt
    Do sperm spread the AIDS virus? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-07
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):30.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740912" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acquired Immunodeficiency Syndrome/*transmission ; HIV/isolation & purification/pathogenicity/ultrastructure ; Humans ; Male ; Spermatozoa/*microbiology/ultrastructure
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 37
    facet.materialart.
    Unbekannt
    New type of receptor found (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-09
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1140-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2567057" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Atrial Natriuretic Factor/*physiology ; Cyclic AMP/physiology ; Cyclic GMP/physiology ; Female ; Guanylate Cyclase/metabolism ; Male ; Receptors, Atrial Natriuretic Factor ; Receptors, Cell Surface/*physiology ; Sea Urchins ; Second Messenger Systems ; Sperm-Ovum Interactions
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 38
    facet.materialart.
    Unbekannt
    p53: a frequent target for genetic abnormalities in lung cancer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-10-27
    Beschreibung: Allele loss is a hallmark of chromosome regions harboring recessive oncogenes. Lung cancer frequently demonstrates loss of heterozygosity on 17p. Recent evidence suggests that the p53 gene located on 17p13 has many features of such an antioncogene. The p53 gene was frequently mutated or inactivated in all types of human lung cancer. The genetic abnormalities of p53 include gross changes such as homozygous deletions and abnormally sized messenger RNAs along with a variety of point or small mutations, which map to the p53 open reading frame and change amino acid sequence in a region highly conserved between mouse and man. In addition, very low or absent expression of p53 messenger RNA in lung cancer cell lines compared to normal lung was seen. These findings, coupled with the previous demonstration of 17p allele loss in lung cancer, strongly implicate p53 as an anti-oncogene whose disruption is involved in the pathogenesis of human lung cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, T -- Nau, M M -- Chiba, I -- Birrer, M J -- Rosenberg, R K -- Vinocour, M -- Levitt, M -- Pass, H -- Gazdar, A F -- Minna, J D -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):491-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉National Cancer Institute-Navy Medical Oncology Branch, Bethesda, MD 20814.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554494" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Base Sequence ; Carcinoid Tumor/genetics ; Carcinoma, Non-Small-Cell Lung/genetics ; Carcinoma, Small Cell/genetics ; Chromosomes, Human, Pair 17 ; DNA, Neoplasm/genetics ; Gene Amplification ; Humans ; Lung Neoplasms/*genetics ; Mutation ; Oncogene Proteins/*genetics ; Phosphoproteins/*genetics ; RNA, Messenger/genetics ; RNA, Neoplasm/genetics ; Ribonucleases ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 39
    facet.materialart.
    Unbekannt
    Quisqualate activates a rapidly inactivating high conductance ionic channel in hippocampal neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-17
    Beschreibung: Glutamate activates a number of different receptor-channel complexes, each of which may contribute to generation of excitatory postsynaptic potentials in the mammalian central nervous system. The rapid application of the selective glutamate agonist, quisqualate, activates a large rapidly inactivating current (3 to 8 milliseconds), which is mediated by a neuronal ionic channel with high unitary conductance (35 picosiemens). The current through this channel shows pharmacologic characteristics similar to those observed for the fast excitatory postsynaptic current (EPSC); it reverses near 0 millivolts and shows no significant voltage dependence. The amplitude of the current through this channel is many times larger than that through the other non-NMDA (N-methyl-D-aspartate) channels. These results suggest that this high-conductance quisqualate-activated channel may mediate the fast EPSC in the mammalian central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tang, C M -- Dichter, M -- Morad, M -- NS24927/NS/NINDS NIH HHS/ -- R01 HL 16152/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1474-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2467378" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Electric Conductivity ; Glutamates/physiology ; Hippocampus/*drug effects ; In Vitro Techniques ; Ion Channels/*drug effects ; Neurons/drug effects ; Oxadiazoles/*pharmacology ; Quisqualic Acid ; Rats ; Receptors, Glutamate ; Receptors, Neurotransmitter/physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 40
    facet.materialart.
    Unbekannt
    5-bromo-2'-deoxyuridine blocks myogenesis by extinguishing expression of MyoD1 (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-04
    Beschreibung: The pyrimidine analog 5-bromodeoxyuridine (BUdR) competes with thymidine for incorporation into DNA. Substitution of BUdR for thymidine does not significantly affect cell viability but does block cell differentiation in many different lineages. BUdR substitution in a mouse myoblast line blocked myogenic differentiation and extinguished the expression of the myogenic determination gene MyoD1. Forced expression of MyoD1 from a transfected expression vector in a BUdR-substituted myoblast overcame the block to differentiation imposed by BUdR. Activation of BUdR-substituted muscle structural genes and apparently normal differentiation were observed in transfected myoblasts. This shows that BUdR blocks myogenesis at the level of a myogenic regulatory gene, possibly MyoD1, not by directly inhibiting the activation of muscle structural genes. It is consistent with the idea that BUdR selectively blocks a class of regulatory genes, each member of which is important for the development of a different cell lineage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tapscott, S J -- Lassar, A B -- Davis, R L -- Weintraub, H -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):532-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Fred Hutchinson Cancer Research Center, Seattle, WA 98104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547249" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Bromodeoxyuridine/metabolism/*pharmacology ; Cell Differentiation/drug effects ; Cell Line ; Creatine Kinase/genetics ; DNA/metabolism ; Desmin/genetics ; Gene Expression Regulation/*drug effects ; Genes ; Mice ; Muscle Proteins/*genetics ; Muscles/*cytology ; Myogenin ; Nuclear Proteins/*genetics ; Plasmids ; RNA, Messenger/genetics ; Repetitive Sequences, Nucleic Acid ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 41
    facet.materialart.
    Unbekannt
    Beta-adrenergic inhibition of cardiac sodium channels by dual G-protein pathways (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-04
    Beschreibung: The signaling pathways by which beta-adrenergic agonists modulate voltage-dependent cardiac sodium currents are unknown, although it is likely that adenosine 3'5'-monophosphate (cAMP) is involved. Single-channel and whole-cell sodium currents were measured in cardiac myocytes and the signal transducing G protein Gs was found to couple beta-adrenergic receptors to sodium channels by both cytoplasmic (indirect) and membrane-delimited (direct) pathways. Hence, Gs can act on at least three effectors in the heart: sodium channels, calcium channels, and adenylyl cyclase. The effect on sodium currents was inhibitory and was enhanced by membrane depolarization. During myocardial ischemia the sodium currents of depolarized cells may be further inhibited by the accompanying increase in catecholamine levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schubert, B -- VanDongen, A M -- Kirsch, G E -- Brown, A M -- DK19319/DK/NIDDK NIH HHS/ -- HL36930/HL/NHLBI NIH HHS/ -- HL39262/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):516-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2547248" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): 8-Bromo Cyclic Adenosine Monophosphate/pharmacology ; Animals ; Cyclic AMP/physiology ; Electric Conductivity ; GTP-Binding Proteins/*physiology ; Guanosine 5'-O-(3-Thiotriphosphate) ; Guanosine Triphosphate/analogs & derivatives/pharmacology ; Heart/drug effects/*physiology ; Isoproterenol/pharmacology ; Potassium Channels/physiology ; Rats ; Receptors, Adrenergic, beta/*physiology ; Signal Transduction ; Sodium Channels/*physiology ; Thionucleotides/pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 42
    facet.materialart.
    Unbekannt
    Germ-line transmission of a c-abl mutation produced by targeted gene disruption in ES cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-10
    Beschreibung: A substitution mutation has been introduced into the c-abl locus of murine embryonic stem cells by homologous recombination between exogenously added DNA and the endogenous gene, and these cells have been used to generate chimeric mice. It is shown that the c-abl mutation was transmitted to progeny by several male chimeras. This work demonstrates the feasibility of germ-line transmission of a mutation introduced into a nonselectable autosomal gene by homologous recombination.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schwartzberg, P L -- Goff, S P -- Robertson, E J -- P01 CA 23767/CA/NCI NIH HHS/ -- R01 HD 25208/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):799-803.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, Columbia University, College of Physicians & Surgeons, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554496" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Abelson murine leukemia virus/*genetics ; Animals ; Blotting, Southern ; Cell Line ; Chimera ; Cloning, Molecular ; *DNA, Recombinant ; Female ; Leukemia Virus, Murine/*genetics ; Male ; Mice ; Mice, Inbred C57BL ; *Mutation ; Oncogenes/*physiology ; Retroviridae Proteins, Oncogenic/*genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 43
    facet.materialart.
    Unbekannt
    "Chemzymes" mimic biology in miniature (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-28
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Waldrop, M M -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):354-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2756423" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): *Catalysis ; Chemical Phenomena ; Chemistry ; *Enzymes ; Technology, Pharmaceutical
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 44
    facet.materialart.
    Unbekannt
    Brain region and gene specificity of neuropeptide gene expression in cultured astrocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-28
    Beschreibung: Astrocytes have many neuronal characteristics, such as neurotransmitter receptors, ion channels, and neurotransmitter uptake systems. Cultured astrocytes were shown to express certain neuropeptide genes, with specificity for both the gene expressed and the brain region from which the cells were prepared. Somatostatin messenger RNA and peptides were detected only in cerebellar astrocytes, whereas proenkephalin messenger RNA and enkephalin peptides were present in astrocytes of cortex, cerebellum, and striatum. Cholecystokinin was not expressed in any of the cells. These results support the hypothesis that peptides synthesized in astrocytes may play a role in the development of the central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shinoda, H -- Marini, A M -- Cosi, C -- Schwartz, J P -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):415-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Neuroscience Branch, National Institute of Neurological Disorders and Stroke, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2569236" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Animals, Newborn ; Astrocytes/*metabolism ; Blotting, Northern ; Cells, Cultured ; Cerebellum/cytology/metabolism ; Cerebral Cortex/cytology/metabolism ; Corpus Striatum/cytology/metabolism ; Enkephalin, Methionine/biosynthesis/genetics ; Enkephalins/biosynthesis/genetics ; *Gene Expression Regulation ; Neuropeptides/biosynthesis/*genetics ; Protein Precursors/biosynthesis/genetics ; RNA, Messenger/analysis ; Radioimmunoassay ; Rats ; Somatostatin/biosynthesis/genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 45
    facet.materialart.
    Unbekannt
    Inescapable versus escapable shock modulates long-term potentiation in the rat hippocampus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-14
    Beschreibung: A group of rats was trained to escape low-intensity shock in a shuttle-box test, while another group of yoked controls could not escape but was exposed to the same amount and regime of shock. After 1 week of training, long-term potentiation (LTP) was measured in vitro in hippocampal slices. Exposure to uncontrollable shock massively impaired LTP relative to exposure to the same amount and regime of controllable shock. These results provide evidence that controllability modulates plasticity at the cellular-neuronal level.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shors, T J -- Seib, T B -- Levine, S -- Thompson, R F -- HD02881/HD/NICHD NIH HHS/ -- MH11936/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 14;244(4901):224-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Southern California, Los Angeles 90089.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2704997" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Avoidance Learning ; Corticosterone/blood ; *Electroshock ; *Escape Reaction ; Hippocampus/*physiology ; Learning/physiology ; Male ; Memory/physiology ; *Neuronal Plasticity ; Rats ; Stress, Psychological/physiopathology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 46
    facet.materialart.
    Unbekannt
    Commitment of neural crest cells to the sensory neuron lineage (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-24
    Beschreibung: Clonal cultures and monoclonal antibodies against a lineage-specific epitope, stage-specific embryonic antigen-1 (SSEA-1) were used to analyze the commitment of quail neural crest cells to the sensory neuron pathway. There were two distinct populations of sensory cells at the time of gangliogenesis. Postmitotic neuroblasts that remained in close association with the neural tube coexisted with a large number of pluripotent cells that formed the leading edge of the emigrating cells and gave rise to sensory and autonomic neuroblasts and to melanocytes. The data suggest a dual origin of spinal sensory neuroblasts and a predominantly late divergence of the autonomic and sensory lineages.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sieber-Blum, M -- HD21423/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy and Cellular Biology, Medical College of Wisconsin, Milwaukee 53226.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2564699" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antibodies, Monoclonal/immunology ; Antigens, CD15 ; Cell Differentiation ; Cell Division ; Cells, Cultured ; Coturnix ; Glycolipids/*physiology ; Neural Crest/*cytology ; Neurons, Afferent/*embryology ; Pigmentation
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 47
    facet.materialart.
    Unbekannt
    Mouse lymph node homing receptor cDNA clone encodes a glycoprotein revealing tandem interaction domains (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-03
    Beschreibung: Isolation of a clone encoding the mouse lymph node homing receptor reveals a deduced protein with an unusual protein mosaic architecture, containing a separate carbohydrate-binding (lectin) domain, an epidermal growth factor-like (EGF) domain, and an extracellular precisely duplicated repeat unit, which preserves the motif seen in the homologous repeat structure of complement regulatory proteins and other proteins. The receptor molecule is potentially highly glycosylated, and contains an apparent transmembrane region. Analysis of messenger RNA transcripts reveals a predominantly lymphoid distribution in direct relation to the cell surface expression of the MEL-14 determinant, and the cDNA clone is shown to confer the MEL-14 epitope in heterologous cells. The many novel features, including ubiquitination, embodied in this single receptor molecule form the basis for numerous approaches to the study of cell-cell interactions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siegelman, M H -- van de Rijn, M -- Weissman, I L -- AI09022/AI/NIAID NIH HHS/ -- OIG43551/PHS HHS/ -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1165-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2646713" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Antibodies, Monoclonal ; Base Sequence ; Binding Sites ; Carbohydrate Metabolism ; Cell Membrane/metabolism ; DNA/*genetics ; Epidermal Growth Factor ; Glycosylation ; Lymph Nodes/*metabolism ; Membrane Glycoproteins/*genetics ; Mice ; Molecular Sequence Data ; Oligonucleotide Probes ; RNA, Messenger/genetics ; Receptors, Lymphocyte Homing ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 48
    facet.materialart.
    Unbekannt
    The effect of deprenyl (selegiline) on the natural history of Parkinson's disease (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-04
    Beschreibung: The effects of MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), a neurotoxin that produces the symptoms of Parkinson's disease, can be fully prevented in experimental animals by inhibiting monoamine oxidase B. On the basis of this observation, a double-blind, placebo-controlled study in patients with early Parkinson's disease was initiated to determine whether deprenyl (a selective monoamine oxidase B inhibitor) would delay the need for L-dopa therapy by slowing the progression of the disease. Fifty-four patients were randomly assigned to deprenyl (10 mg/day) or placebo treatment groups and followed until L-dopa therapy was indicated or until the patient had been in the study for 3 years. Analysis of Kaplan-Meier survival curves for each group showed that deprenyl delayed the need for L-dopa therapy; the average time until L-dopa was needed was 312.1 days for patients in the placebo group and 548.9 days for patients in the deprenyl group. Disease progression, as monitored by five different assessment scales, was slowed (by 40 to 83% per year) in the deprenyl group compared to placebo. Therefore, early deprenyl therapy delays the requirement for antiparkinsonian medication, possibly by slowing progression of the disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tetrud, J W -- Langston, J W -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):519-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉California Parkinson's Foundation, San Jose 95128.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502843" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine ; Aged ; Clinical Trials as Topic ; Double-Blind Method ; Female ; Humans ; Levodopa/therapeutic use ; Male ; Middle Aged ; Monoamine Oxidase Inhibitors/*therapeutic use ; Parkinson Disease/*drug therapy/physiopathology ; Parkinson Disease, Secondary/chemically induced ; Phenethylamines/*therapeutic use ; Pyridines/adverse effects/antagonists & inhibitors ; Random Allocation ; Selegiline/adverse effects/*therapeutic use
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 49
    facet.materialart.
    Unbekannt
    The neuronal growth-associated protein GAP-43 induces filopodia in non-neuronal cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-09
    Beschreibung: The neuron-specific protein GAP-43 is associated with the membrane of the nerve growth cone and thus may be important to the activity of this distinctive neuronal structure. Transient transfection of COS and NIH 3T3 cells with appropriate vectors resulted in expression of GAP-43 in these non-neuronal cells; as in neurons, transfected GAP-43 associated with the membrane. In addition, many long fine filopodial processes extended from the periphery of such transfected cells. Stable CHO cell lines expressing GAP-43 also exhibited processes that were more numerous, far longer, and more complex than those of CHO cell lines not transfected or transfected with control plasmids. Thus GAP-43 may directly contribute to growth cone activity by regulating cell membrane structure and enhancing extension of filopodial processes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zuber, M X -- Goodman, D W -- Karns, L R -- Fishman, M C -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1193-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Developmental Biology Laboratory, Massachusetts General Hospital Cancer Center, Boston.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658062" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Cell Membrane/*ultrastructure ; Cells, Cultured ; Fluorescent Antibody Technique ; GAP-43 Protein ; Growth Substances/*physiology ; Membrane Proteins/genetics/*physiology ; Mice ; Nerve Tissue Proteins/genetics/*physiology ; Recombinant Proteins/pharmacology ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 50
    facet.materialart.
    Unbekannt
    Transneuronal transfer of herpes virus from peripheral nerves to cortex and brainstem (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-06
    Beschreibung: The transneuronal transfer of neurotropic viruses may represent an effective tool for tracing chains of connected neurons because replication of virus in the recipient neurons after transfer amplifies the "tracer signal." Herpes simplex virus type 1 was transferred transneuronally from forelimb and hindlimb nerves of rats to the cortical and brainstem neurons that project to the spinal enlargements to which the nerves receiving injections are connected. This transneuronal transfer of herpes simplex virus type 1 from peripheral nerves has the potential to be used to identify neurons in the brain that are related transsynaptically to different nerves and muscles.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ugolini, G -- Kuypers, H G -- Strick, P L -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):89-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Anatomy, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536188" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Brain Stem/*microbiology ; Cerebral Cortex/*microbiology ; DNA Replication ; Herpes Simplex/*pathology ; Neurons/*microbiology ; Rats ; Simplexvirus/genetics/isolation & purification ; Spinal Cord/microbiology ; Tibial Nerve/*microbiology ; Virus Replication
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 51
    facet.materialart.
    Unbekannt
    "Dangerous" liaisons in cell biology (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-30
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dickson, D -- New York, N.Y. -- Science. 1989 Jun 30;244(4912):1539-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740899" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Absorption ; Animals ; *Dna ; Ethics ; Male ; Mice ; Mice, Transgenic ; *Patents as Topic ; Research Personnel ; Rome ; *Spermatozoa ; *Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 52
    facet.materialart.
    Unbekannt
    Duplication, deletion, and polymorphism in the sex-determining region of the mouse Y chromosome (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-06
    Beschreibung: The ZFY gene in the sex-determining region of the human Y chromosome encodes a "zinc-finger" protein that may be the testis-determining factor, TDF. Although the Y chromosomes of most placental mammals carry a single homolog of ZFY, the mouse Y chromosome has two homologs, both in the sex-determining (Sxr) region. Zfy-1 alone may suffice to determine maleness; Zfy-2 is dispensable, as it was deleted in an Sxr variant that retains sex-determining function but has lost other genes. Both loci mapped near the centromere of the mouse Y chromosome. The Y chromosomes of the subspecies Mus musculus musculus and M. m. domesticus were distinguishable by a Zfy-1 restriction fragment polymorphism, which can be used to study their differing interactions with autosomal sex-determining genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mardon, G -- Mosher, R -- Disteche, C M -- Nishioka, Y -- McLaren, A -- Page, D C -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):78-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute, Nine Cambridge Center, MA 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563173" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Chromosome Deletion ; Chromosome Mapping ; Male ; Mice ; Mice, Inbred Strains/*genetics ; *Multigene Family ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; *Sex Determination Analysis ; *Y Chromosome
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 53
    facet.materialart.
    Unbekannt
    In vitro transcription enhancement by purified derivatives of the glucocorticoid receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-21
    Beschreibung: Mammalian glucocorticoid receptors enhance transcription from linked promoters by binding to glucocorticoid response element (GRE) DNA sequences. Understanding the mechanism of receptor action will require biochemical studies with purified components. Enhancement was observed in vitro with derivatives of the receptor that were expressed in Escherichia coli, purified, and added to a cell-free extract from Drosophila embryo nuclei. Transcription from promoters linked to one or multiple GREs was selectively enhanced by as much as six times. The effect was weaker with only one GRE, and enhancement was abolished by a point mutation that inactivates the GRE in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Freedman, L P -- Yoshinaga, S K -- Vanderbilt, J N -- Yamamoto, K R -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):298-301.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2473529" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cloning, Molecular ; DNA/genetics/metabolism ; Drosophila melanogaster ; Mutation ; Promoter Regions, Genetic ; RNA/biosynthesis ; Rats ; Receptors, Glucocorticoid/*genetics/isolation & purification/metabolism ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 54
    facet.materialart.
    Unbekannt
    Old bones solve new problems (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-15
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marshall, E -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1185.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781278" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adult ; Bone and Bones/*analysis/anatomy & histology ; Female ; *Forensic Medicine ; *Fossils ; Humans ; Infant ; Male ; *Paleontology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 55
    facet.materialart.
    Unbekannt
    Pathological changes induced in cerebrocortical neurons by phencyclidine and related drugs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-16
    Beschreibung: Phencyclidine (PCP), a dissociative anesthetic and widely abused psychotomimetic drug, and MK-801, a potent PCP receptor ligand, have neuroprotective properties stemming from their ability to antagonize the excitotoxic actions of endogenous excitatory amino acids such as glutamate and aspartate. There is growing interest in the potential application of these compounds in the treatment of neurological disorders. However, there is an apparent neurotoxic effect of PCP and related agents (MK-801, tiletamine, and ketamine), which has heretofore been overlooked: these drugs induce acute pathomorphological changes in specific populations of brain neurons when administered subcutaneously to adult rats in relatively low doses. These findings raise new questions regarding the safety of these agents in the clinical management of neurodegenerative diseases and reinforce concerns about the potential risks associated with illicit use of PCP.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olney, J W -- Labruyere, J -- Price, M T -- DA 53568/DA/NIDA NIH HHS/ -- MH 38894/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1360-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660263" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cerebral Cortex/cytology/*drug effects/pathology ; Dibenzocycloheptenes/*toxicity ; Dizocilpine Maleate ; Female ; Ketamine/toxicity ; Male ; Microscopy, Electron ; Neurons/drug effects ; Phencyclidine/*toxicity ; Rats ; Rats, Inbred Strains ; Tiletamine/toxicity ; Time Factors
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 56
    facet.materialart.
    Unbekannt
    Court ruling rekindles controversy over SATs (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-17
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):885-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2919279" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): *Educational Measurement ; Female ; Humans ; *Jurisprudence ; Male ; *Prejudice ; *School Admission Criteria ; Sex Factors ; United States ; *Universities
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 57
    facet.materialart.
    Unbekannt
    Detecting mutations in human genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-10
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):737-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2783787" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Cells, Cultured ; Electrophoresis/methods ; Humans ; Hypoxanthine Phosphoribosyltransferase/genetics ; *Mutagenicity Tests ; T-Lymphocytes/drug effects
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 58
    facet.materialart.
    Unbekannt
    Molecular cloning of the thyrotropin receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: The pituitary hormone thyrotropin, or thyroid-stimulating hormone (TSH), is the main physiological agent that regulates the thyroid gland. The thyrotropin receptor (TSHR) was cloned by selective amplification with the polymerase chain reaction of DNA segments presenting sequence similarity with genes for G protein-coupled receptors. Out of 11 new putative receptor clones obtained from genomic DNA, one had sequence characteristics different from all the others. Although this clone did not hybridize to thyroid transcripts, screening of a dog thyroid complementary DNA (cDNA) library at moderate stringency identified a cDNA encoding a 4.9-kilobase thyroid-specific transcript. The polypeptide encoded by this thyroid-specific transcript consisted of a 398-amino acid residue amino-terminal segment, constituting a putative extracellular domain, connected to a 346-residue carboxyl-terminal domain that contained seven putative transmembrane segments. Expression of the cDNA conferred TSH responsiveness to Xenopus oocytes and Y1 cells and a TSH binding phenotype to COS cells. The TSHR and the receptor for luteinizing hormone-choriogonadotropin constitute a subfamily of G protein-coupled receptors with distinct sequence characteristics.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parmentier, M -- Libert, F -- Maenhaut, C -- Lefort, A -- Gerard, C -- Perret, J -- Van Sande, J -- Dumont, J E -- Vassart, G -- R01-DK21732/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1620-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556796" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Blotting, Northern ; Cell Line ; *Cloning, Molecular ; Cyclic AMP ; Dogs ; Female ; *Genes ; Molecular Sequence Data ; Oocytes/drug effects/metabolism ; Organ Specificity ; Polymerase Chain Reaction/methods ; RNA, Messenger/genetics ; Receptors, Thyrotropin/*genetics ; Thyrotropin/pharmacology ; Transcription, Genetic ; Xenopus
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 59
    facet.materialart.
    Unbekannt
    Factors that predict individual vulnerability to amphetamine self-administration (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-29
    Beschreibung: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 60
    facet.materialart.
    Unbekannt
    Inhibitors of angiotensin-converting enzyme prevent myointimal proliferation after vascular injury (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-14
    Beschreibung: The role of a local angiotensin system in the vascular response to arterial injury was investigated by administering the angiotensin-converting enzyme (CE) inhibitor cilazapril to normotensive rats in which the left carotid artery was subjected to endothelial denudation and injury by balloon catheterization. In control animals, by 14 days after balloon injury, the processes of smooth muscle cell (SMC) proliferation, migration of SMCs from the media to the intima, and synthesis of extracellular matrix produced marked thickening of the intima, with reduction of the cross-sectional area of the lumen. However, in animals that received continuous treatment with the CE inhibitor, neointima formation was decreased (by about 80 percent), and lumen integrity was preserved. Thus, the angiotensin-converting enzyme may participate in modulating the proliferative response of the vascular wall after arterial injury, and inhibition of this enzyme may have therapeutic applications to prevent the proliferative lesions that occur after coronary angioplasty and vascular surgery.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, J S -- Clozel, J P -- Muller, R K -- Kuhn, H -- Hefti, F -- Hosang, M -- Baumgartner, H R -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):186-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Pharmaceutical Research Department, F. Hoffmann-La Roche Ltd., Basel, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526370" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Angiotensin-Converting Enzyme Inhibitors/*pharmacology ; Animals ; Blood Pressure/drug effects ; Catheterization ; Cell Division/drug effects ; Cilazapril ; Male ; Muscle, Smooth, Vascular/*drug effects/pathology ; Pyridazines/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 61
    facet.materialart.
    Unbekannt
    Role of Na+/H+ exchange by interferon-gamma in enhanced expression of JE and I-A beta genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-28
    Beschreibung: The rapid transductional sequences initiated by interferon-gamma (IFN-gamma) on binding to its receptor regulate functional and genomic responses in many cells but are not well defined. Induction of macrophage activation is an example of such functional and genomic changes in response to IFN-gamma. Addition of IFN-gamma to murine macrophages, at activating concentrations, produced rapid (within 60 seconds) alkalinization of the cytosol and a concomitant, rapid influx of 22Na+. Amiloride inhibited the ion fluxes and the accumulation of specific messenger RNA for two genes induced by IFN-gamma (the early gene JE and the beta chain of the class II major histocompatibility complex gene I-A). The data indicate that IFN-gamma initiates rapid exchange of Na+ and H+ by means of the Na+/H+ antiporter and that these amiloride-sensitive ion fluxes are important to some of the genomic effects of IFN-gamma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Prpic, V -- Yu, S F -- Figueiredo, F -- Hollenbach, P W -- Gawdi, G -- Herman, B -- Uhing, R J -- Adams, D O -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):469-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2541500" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amiloride/pharmacology ; Animals ; Carrier Proteins/antagonists & inhibitors/metabolism ; Cells, Cultured ; Cytosol/metabolism ; *Gene Expression Regulation ; Histocompatibility Antigens Class II/*genetics ; Hydrogen-Ion Concentration ; Interferon-gamma/*physiology ; Kinetics ; Macrophage Activation ; Macrophages/drug effects/metabolism ; Mice ; *Protons ; RNA, Messenger/biosynthesis ; Sodium/*metabolism ; Sodium-Hydrogen Antiporter
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 62
    facet.materialart.
    Unbekannt
    Fitness differences among remnant populations of the endangered sonoran topminnow (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-09-01
    Beschreibung: Four correlates of fitness were measured in three stocks of the endangered Sonoran topminnow, Poeciliopsis occidentalis, from Arizona. Survival, growth, early fecundity, and developmental stability were greatest in laboratory-reared fish from the most heterozygous natural population studied. Conversely, all four traits were poorest in fish from a population with no electrophoretically detectable genetic variation. These results emphasize the need for genetic as well as demographic information for the development of comprehensive species recovery programs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Quattro, J M -- Vrijenhoek, R C -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):976-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Theoretical and Applied Genetics, Cook College, Rutgers University, New Brunswick, NJ 08903.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772650" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Arizona ; *Biological Evolution ; Cyprinodontiformes/*genetics ; Female ; Fertility ; Genetic Variation ; Male ; Poecilia/anatomy & histology/*genetics ; Species Specificity
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 63
    facet.materialart.
    Unbekannt
    Interleukin-1 mitogenic activity for fibroblasts and smooth muscle cells is due to PDGF-AA (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: Both interleukin-1 (IL-1) and platelet-derived growth factor (PDGF) induce proliferation of cultured fibroblasts and smooth muscle cells. These polypeptide mediators are released by activated macrophages and other cell types in response to injury and are thought to have a role in tissue remodeling and a number of pathologic processes. Analysis of the kinetics of [3H]thymidine incorporation by cultured fibroblasts demonstrated that the response to IL-1 is delayed approximately 8 hours relative to their response to PDGF. IL-1 transiently stimulated expression of the PDGF A-chain gene, with maximum induction after approximately 2 hours. Subsequent synthesis and release of PDGF activity into the medium was detected as early as 4 hours after IL-1 stimulation, and downregulation of the binding site for the PDGF-AA isoform of PDGF followed PDGF-AA secretion. Antibodies to PDGF completely block the mitogenic response to IL-1. Therefore, the mitogenic activity of IL-1 for fibroblasts and smooth muscle cells appears to be indirect and mediated by induction of the PDGF A-chain gene.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raines, E W -- Dower, S K -- Ross, R -- HL-18645/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):393-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2783498" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Cells, Cultured ; Fibroblasts/cytology/*drug effects ; Gene Expression Regulation/drug effects ; Humans ; Interleukin-1/*pharmacology ; Muscle, Smooth/cytology/*drug effects ; Platelet-Derived Growth Factor/*physiology ; RNA, Messenger/genetics ; Time Factors
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 64
    facet.materialart.
    Unbekannt
    Glial cell diversification in the rat optic nerve (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-17
    Beschreibung: A central challenge in developmental neurobiology is to understand how an apparently homogeneous population of neuroepithelial cells in the early mammalian embryo gives rise to the great diversity of nerve cells (neurons) and supporting cells (glial cells) in the mature central nervous system. Because the optic nerve is one of the several types of glial cells but no intrinsic neurons, it is an attractive place to investigate how neuroepithelial cells diversify. Studies of developing rat optic nerve cells in culture suggest that both cell-cell interactions and intrinsic cellular programs play important parts in glial cell diversification.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raff, M C -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1450-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2648568" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Astrocytes/cytology ; Brain/cytology ; Cell Differentiation ; Cell Movement ; Cells, Cultured ; Epithelial Cells ; Morphogenesis ; Neuroglia/*cytology ; Oligodendroglia/cytology ; Optic Nerve/*cytology ; Rats
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 65
    facet.materialart.
    Unbekannt
    A genetic polymorphism in the renin gene of Dahl rats cosegregates with blood pressure (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-27
    Beschreibung: Blood pressure is influenced by multiple genetic loci whose identities are largely unknown. A restriction fragment length polymorphism (RFLP) in the renin gene was found between Dahl salt-hypertension-sensitive (S) and Dahl salt-hypertension-resistant (R) rats. In an F2 population derived from crossing S and R rats, the renin RFLP cosegregated with blood pressure. One dose of the S-rat renin allele was associated with an increment in blood pressure of approximately 10 mmHg, and two doses of this allele increased blood pressure approximately 20 mmHg. From this it can be definitively concluded that in the rat the renin gene is, or is closely linked to, one of the genes regulating blood pressure.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rapp, J P -- Wang, S M -- Dene, H -- HL-07357/HL/NHLBI NIH HHS/ -- HL-20176/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):542-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Medical College of Ohio, Toledo 43699.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563177" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Alleles ; Animals ; *Blood Pressure/drug effects ; Blotting, Southern ; DNA Probes ; Female ; Genotype ; Hypertension/*genetics ; Male ; *Polymorphism, Genetic ; Polymorphism, Restriction Fragment Length ; Rats ; Rats, Inbred Strains ; Renin/*genetics ; Sodium Chloride/pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 66
    facet.materialart.
    Unbekannt
    elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-07
    Beschreibung: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 67
    facet.materialart.
    Unbekannt
    Autoimmune target in Heymann nephritis is a glycoprotein with homology to the LDL receptor (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-09
    Beschreibung: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 68
    facet.materialart.
    Unbekannt
    Amplification and molecular cloning of HTLV-I sequences from DNA of multiple sclerosis patients (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-27
    Beschreibung: Techniques of gene amplification, molecular cloning, and sequence analysis were used to test for the presence of sequences related to human T-lymphotropic virus type I (HTLV-I) in peripheral blood mononuclear cells of six patients with multiple sclerosis (MS) and 20 normal individuals. HTLV-I sequences were detected in all six MS patients and in one individual from the control group by DNA blot analysis and molecular cloning of amplified DNAs. The viral sequence in MS patients were associated with adherent cell populations consisting predominantly of monocytes and macrophages. Molecular cloning and nucleotide sequence analysis indicated that these amplified viral sequences were related to the HTLV-I proviral genome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- Sandberg-Wollheim, M -- Mettus, R V -- Ray, P E -- DeFreitas, E -- Koprowski, H -- CA-10815/CA/NCI NIH HHS/ -- NS-11036/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):529-33.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536193" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adolescent ; Adult ; Base Sequence ; Child ; *Cloning, Molecular ; DNA Restriction Enzymes ; DNA, Viral/*genetics ; Female ; *Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Leukocytes, Mononuclear/analysis/microbiology ; Macrophages/analysis/microbiology ; Male ; Molecular Sequence Data ; Multiple Sclerosis/*microbiology ; Nucleic Acid Hybridization ; Oligonucleotide Probes
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 69
    facet.materialart.
    Unbekannt
    Treatment with tin prevents the development of hypertension in spontaneously hypertensive rats (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-20
    Beschreibung: Cytochrome P-450-dependent metabolites of arachidonic acid (AA) increased in the kidneys of young, spontaneously hypertensive rats (SHRs) during the period of rapid elevation of blood pressure (BP) but not in adult SHRs or in Wistar Kyoto rats (WKYs) with normal BP. Treatment of SHRs and WKYs with stannous chloride (SnCl2), which selectively depletes renal cytochrome P-450, restored BP to normal, coincident with a natriuresis, in young but not in adult SHRs and did not affect either BP or sodium excretion in WKYs. Depletion of renal cytochrome P-450 was associated with decreased generation of these AA metabolites only in young SHRs. The antihypertensive effect of SnCl2 in young SHRs was greatly reduced by prevention of its cytochrome P-450-depleting action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sacerdoti, D -- Escalante, B -- Abraham, N G -- McGiff, J C -- Levere, R D -- Schwartzman, M L -- AM29742/AM/NIADDK NIH HHS/ -- HL25394/HL/NHLBI NIH HHS/ -- HL34300/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):388-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, New York Medical College, Valhalla 10595.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492116" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Arachidonic Acid ; Arachidonic Acids/metabolism ; Blood Pressure/drug effects ; Cobalt/pharmacology ; Cytochrome P-450 Enzyme System/metabolism ; Heme Oxygenase (Decyclizing)/metabolism ; Hypertension/*prevention & control ; Kidney/metabolism ; Rats ; Rats, Inbred SHR/*physiology ; Rats, Inbred Strains/*physiology ; Tin/*therapeutic use
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 70
    facet.materialart.
    Unbekannt
    Tonic activation of NMDA receptors by ambient glutamate enhances excitability of neurons (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-10
    Beschreibung: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 71
    facet.materialart.
    Unbekannt
    High-level recombinant gene expression in rabbit endothelial cells transduced by retroviral vectors (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-13
    Beschreibung: By virtue of its immediate contact with the circulating blood, the endothelium provides an attractive target for retroviral vector transduction for the purpose of gene therapy. To see whether efficient gene transfer and expression was feasible, rabbit aortic endothelial cells were infected with three Moloney murine leukemia virus-derived retroviral vectors. Two of these vectors carry genes encoding products that are not secreted: N2, containing only the selectable marker gene neoR, and SAX, containing both neoR gene and an SV40-promoted adenosine deaminase (ADA) gene. The third vector, G2N, contains a secretory rat growth hormone (rGH) gene and an SV40-promoted neoR gene. Infection with all three vectors resulted in expression of the respective genes. A high level of human ADA expression was observed in infected endothelial cell populations both before and after selection in G418. G2N-infected rabbit aortic endothelial cells that were grown on a synthetic vascular graft continued to secrete rGH into the culture medium. These studies suggest that endothelial cells may serve as vehicles for the introduction in vivo of functioning recombinant genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Zwiebel, J A -- Freeman, S M -- Kantoff, P W -- Cornetta, K -- Ryan, U S -- Anderson, W F -- HL21568/HL/NHLBI NIH HHS/ -- HL33064/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):220-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911735" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adenosine Deaminase/analysis/genetics ; Animals ; Aorta ; DNA, Recombinant/metabolism ; Endothelium, Vascular/*metabolism ; *Genes ; *Genes, Viral ; Genetic Markers/analysis ; *Genetic Vectors ; Growth Hormone/analysis/genetics ; Moloney murine leukemia virus/*genetics ; Promoter Regions, Genetic ; Rabbits ; Rats ; Recombinant Proteins/analysis ; *Transduction, Genetic ; *Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 72
    facet.materialart.
    Unbekannt
    La difference (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-24
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fischer, R -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1536.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928786" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Body Composition ; *Energy Metabolism ; Female ; Humans ; Male ; *Sex Factors
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 73
    facet.materialart.
    Unbekannt
    Finite social space, evolutionary pathways, and reconstructing hominid behavior (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-17
    Beschreibung: Changes in social behavior were a key aspect of human evolution, and yet it is notoriously difficult for paleobiologists to determine patterns of social evolution. By defining the limited number of distributional strategies available to members of each sex of any species and investigating the conditions under which they may occur and change, the social behavior of different hominid taxa may be reconstructed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foley, R A -- Lee, P C -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):901-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Cambridge, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2493158" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Behavior ; *Biological Evolution ; Female ; Haplorhini/genetics ; Hominidae/*genetics ; Humans ; Male ; Models, Genetic ; *Social Behavior
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 74
    facet.materialart.
    Unbekannt
    The neostriatal mosaic: striatal patch-matrix organization is related to cortical lamination (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-10-20
    Beschreibung: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 75
    facet.materialart.
    Unbekannt
    Myristoylated and nonmyristoylated forms of a protein are phosphorylated by protein kinase C (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-10-27
    Beschreibung: Activation of protein kinase C is thought to require association of the kinase with the cell membrane. It has been assumed that cellular substrates for the kinase must likewise be associated with membranes, and previous studies with membrane-associated myristoylated proteins have supported this view. It is now shown that a mutation that prevents the normal amino-terminal myristoylation of a prominent cellular substrate of protein kinase C, and appears to prevent its membrane association, does not prevent the normal phosphorylation of this protein in intact cells in response to phorbol esters. Thus, membrane association may not be required in order for protein kinase C substrates to undergo phosphorylation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Graff, J M -- Gordon, J I -- Blackshear, P J -- 2T32-GM 07171/GM/NIGMS NIH HHS/ -- AI27179/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):503-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratories, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814478" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Cells, Cultured ; Chickens ; Enzyme Activation ; *Intracellular Signaling Peptides and Proteins ; Membrane Proteins/metabolism ; Mutation ; Myristic Acid ; Myristic Acids ; Phosphorylation ; Protein Kinase C/*metabolism ; Proteins/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 76
    facet.materialart.
    Unbekannt
    Interleukin-2 receptor beta chain gene: generation of three receptor forms by cloned human alpha and beta chain cDNA's (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-05
    Beschreibung: Interleukin-2 (IL-2) binds to two distinct receptor molecules, the IL-2 receptor alpha (IL-2R alpha, p55) chain and the newly identified IL-2 receptor beta (IL-2R beta, p70-75) chain. The cDNA encoding the human IL-2R beta chain has now been isolated. The overall primary structure of the IL-2R beta chain shows no apparent homology to other known receptors. Unlike the IL-2R alpha chain, the IL-2R beta chain has a large cytoplasmic region in which a functional domain (or domains) mediating an intracellular signal transduction pathway (or pathways) may be embodied. The cDNA-encoded beta chain binds and internalizes IL-2 when expressed on T lymphoid cells but not fibroblast cells. Furthermore, the cDNA gives rise to the generation of high-affinity IL-2 receptor when co-expressed with the IL-2R alpha chain cDNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hatakeyama, M -- Tsudo, M -- Minamoto, S -- Kono, T -- Doi, T -- Miyata, T -- Miyasaka, M -- Taniguchi, T -- New York, N.Y. -- Science. 1989 May 5;244(4904):551-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785715" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; Cross-Linking Reagents ; DNA/*genetics/isolation & purification ; Fibroblasts/metabolism ; Gene Expression Regulation ; Humans ; Interleukin-2/metabolism ; Leukemia ; Molecular Sequence Data ; Nucleic Acid Hybridization ; RNA, Messenger/genetics ; Receptors, Interleukin-2/*genetics/metabolism ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Signal Transduction ; Succinimides ; T-Lymphocytes/metabolism ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 77
    facet.materialart.
    Unbekannt
    Identification of a thyroid hormone receptor that is pituitary-specific (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-07
    Beschreibung: Three cellular homologs of the v-erbA oncogene were previously identified in the rat; two of them encode high affinity receptors for the thyroid hormone triiodothyronine (T3). A rat complementary DNA clone encoding a T3 receptor form of the ErbA protein, called r-ErbA beta-2, was isolated. The r-ErbA beta-2 protein differs at its amino terminus from the previously described rat protein encoded by c-erbA beta and referred to as r-ErbA beta-1. Unlike the other members of the c-erbA proto-oncogene family, which have a wide tissue distribution, r-erbA beta-2 appears to be expressed only in the anterior pituitary gland. In addition, thyroid hormone downregulates r-erbA beta-2 messenger RNA but not r-erbA beta-1 messenger RNA in a pituitary tumor-derived cell line. The presence of a pituitary-specific form of the thyroid hormone receptor that may be selectively regulated by thyroid hormone could be important for the differential regulation of gene expression by T3 in the pituitary gland.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodin, R A -- Lazar, M A -- Wintman, B I -- Darling, D S -- Koenig, R J -- Larsen, P R -- Moore, D D -- Chin, W W -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):76-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Brigham and Women's Hospital, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539642" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; DNA/isolation & purification ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Organ Specificity ; Pituitary Gland, Anterior/*metabolism ; Proto-Oncogene Proteins/genetics/*isolation & purification ; Rats ; Receptors, Thyroid Hormone/genetics/*isolation & purification ; Transfection
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 78
    facet.materialart.
    Unbekannt
    Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-03
    Beschreibung: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 79
    facet.materialart.
    Unbekannt
    Sex pheromones in snakes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-07-21
    Beschreibung: The majority of pheromones identified to date are insect pheromones, which are volatile in nature. Identification of nonvolatile pheromones have been relatively rare, especially in vertebrates. Male and female garter snakes use pheromones to mediate sexual behavior. The female sex attractiveness pheromone of the Canadian red-sided garter snake, Thamnophis sirtalis parietalis, consists of a novel series of nonvolatile saturated and monounsaturated long-chain methyl ketones, whereas the male sex recognition pheromone contains squalene. These compounds were isolated, identified, and partially synthesized, and field tests show them to be biologically active.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mason, R T -- Fales, H M -- Jones, T H -- Pannell, L K -- Chinn, J W -- Crews, D -- NICHHD 16687/HD/NICHD NIH HHS/ -- NIMH 00135/MH/NIMH NIH HHS/ -- NIMH 09310/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):290-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Chemistry, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749261" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Chromatography, Ion Exchange ; Female ; Gas Chromatography-Mass Spectrometry ; Magnetic Resonance Spectroscopy ; Male ; Pheromones/*isolation & purification ; Sex Attractants/analysis/chemical synthesis/*isolation & purification ; *Sexual Behavior, Animal ; Snakes/*physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 80
    facet.materialart.
    Unbekannt
    Isolation of a novel receptor cDNA establishes the existence of two PDGF receptor genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-10
    Beschreibung: A genomic sequence and cloned complementary DNA has been identified for a novel receptor-like gene of the PDGF receptor/CSF1 receptor subfamily (platelet-derived growth factor receptor/colony-stimulating factor type 1 receptor). The gene recognized a 6.4-kilobase transcript that was coexpressed in normal human tissues with the 5.3-kilobase PDGF receptor messenger RNA. Introduction of complementary DNA of the novel gene into COS-1 cells led to expression of proteins that were specifically detected with antiserum directed against a predicted peptide. When the new gene was transfected into COS-1 cells, a characteristic pattern of binding of the PDGF isoforms was observed, which was different from the pattern observed with the known PDGF receptor. Tyrosine phosphorylation of the receptor in response to the PDGF isoforms was also different from the known receptor. The new PDGF receptor gene was localized to chromosome 4q11-4q12. The existence of genes encoding two PDGF receptors that interact in a distinct manner with three different PDGF isoforms likely confers considerable regulatory flexibility in the functional responses to PDGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matsui, T -- Heidaran, M -- Miki, T -- Popescu, N -- La Rochelle, W -- Kraus, M -- Pierce, J -- Aaronson, S -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):800-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536956" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Cells, Cultured ; *Chromosomes, Human, Pair 4 ; Cloning, Molecular ; DNA/genetics ; Gene Expression Regulation ; *Genes ; Humans ; Molecular Sequence Data ; Multigene Family ; Platelet-Derived Growth Factor/*physiology ; Protein-Tyrosine Kinases/genetics ; RNA, Messenger/genetics ; Receptors, Cell Surface/*genetics ; Receptors, Platelet-Derived Growth Factor ; Tissue Distribution
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 81
    facet.materialart.
    Unbekannt
    The EGF receptor kinase substrate p35 in the floor plate of the embryonic rat CNS (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-17
    Beschreibung: P35 is a calcium- and phospholipid-binding protein that was originally isolated as a substrate for the epidermal growth factor (EGF) receptor tyrosine kinase and later was found to be related to lipocortin I. Immunohistochemistry was used to localize p35 to a raphe of primitive glial ependymal cells in the median one-third of the floor plate in the central nervous system (CNS) of rat embryos. The p35 appears by embryonic day 12 before the arrival of pioneering ventral commissural axons. The unexpected, discrete distribution of this protein during development opens the question of its role in neural morphogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McKanna, J A -- Cohen, S -- CA43720/CA/NCI NIH HHS/ -- HD00700/HD/NICHD NIH HHS/ -- HD15052/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1477-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, TN 37232.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928781" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Central Nervous System/*embryology ; Microfilament Proteins/metabolism ; Nerve Tissue Proteins/*metabolism ; Phosphoproteins/*metabolism ; Raphe Nuclei/embryology ; Rats ; Receptor, Epidermal Growth Factor/*metabolism
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 82
    facet.materialart.
    Unbekannt
    Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-04
    Beschreibung: A complementary DNA (cDNA) for the rat luteal lutropin-choriogonadotropin receptor (LH-CG-R) was isolated with the use of a DNA probe generated in a polymerase chain reaction with oligonucleotide primers based on peptide sequences of purified receptor protein. As would be predicted from the cDNA sequence, the LH-CG-R consists of a 26-residue signal peptide, a 341-residue extracellular domain displaying an internal repeat structure characteristic of members of the leucine-rich glycoprotein (LRG) family, and a 333-residue region containing seven transmembrane segments. This membrane-spanning region displays sequence similarity with all members of the G protein-coupled receptor family. Hence, the LH-CG-R gene may have evolved by recombination of LRG and G protein-coupled receptor genes. Cells engineered to express LH-CG-R cDNA bind human choriogonadotropin with high affinity and show an increase in cyclic adenosine monophosphate when exposed to hormone. As revealed by RNA blot analysis and in situ hybridization, the 4.4-kilobase cognate messenger RNA is prominently localized in the rat ovary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McFarland, K C -- Sprengel, R -- Phillips, H S -- Kohler, M -- Rosemblit, N -- Nikolics, K -- Segaloff, D L -- Seeburg, P H -- HD22196/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):494-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Developmental Biology, Genetech, Inc., South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502842" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; DNA/genetics/isolation & purification ; DNA Probes ; Female ; GTP-Binding Proteins/*physiology ; Glycoproteins/genetics ; Molecular Sequence Data ; Nucleic Acid Hybridization ; Ovary/analysis ; RNA, Messenger/analysis/genetics ; Rats ; Receptors, LH/*genetics ; Sequence Homology, Nucleic Acid ; Tissue Distribution
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 83
    facet.materialart.
    Unbekannt
    Molecular recognition and metal ion template synthesis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-26
    Beschreibung: Methods for the design and synthesis of ligands intended to be specific for a metal ion have been a recent chemical development. This article describes how this process can be inverted so that the specifics of the coordination environment around the metal ion can be used as a template in large-scale ligand synthesis. The synthesis of macrobicyclic ligands for ferric ion has been accomplished by using active esters of catechol ligands in which catecholate coordination to iron is a prelude to the organic chemical reactions that link the coordination subunits together into one ligand system surrounding a central metal ion coordination site. The lanthanide(III) ions, which are among the most labile metal ions known, have coordination numbers of 8 or higher, and thus their encapsulation into a macrobicyclic structure is a challenging problem. Lanthanide amine complexes have been used as metal templates in the synthesis of such macrobicyclic lanthanide complexes. There is evidence that such a complex is inert to exchange in aqueous solution.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McMurry, T J -- Raymond, K N -- Smith, P H -- New York, N.Y. -- Science. 1989 May 26;244(4907):938-43.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Radiation Oncology Branch, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658057" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Cations ; Chemical Phenomena ; Chemistry ; Iron/metabolism ; *Ligands ; Macromolecular Substances ; Metals/*metabolism ; Metals, Rare Earth/metabolism ; Molecular Structure ; Templates, Genetic
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 84
    facet.materialart.
    Unbekannt
    Buprenorphine suppresses cocaine self-administration by rhesus monkeys (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-25
    Beschreibung: Cocaine abuse has reached epidemic proportions in the United States, and the search for an effective pharmacotherapy continues. Because primates self-administer most of the drugs abused by humans, they can be used to predict the abuse liability of new drugs and for preclinical evaluation of new pharmacotherapies for drug abuse treatment. Daily administration of buprenorphine (an opioid mixed agonist-antagonist) significantly suppressed cocaine self-administration by rhesus monkeys for 30 consecutive days. The effects of buprenorphine were dose-dependent. The suppression of cocaine self-administration by buprenorphine did not reflect a generalized suppression of behavior. These data suggest that buprenorphine would be a useful pharmacotherapy for treatment of cocaine abuse. Because buprenorphine is a safe and effective pharmacotherapy for heroin dependence, buprenorphine treatment may also attenuate dual abuse of cocaine and heroin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mello, N K -- Mendelson, J H -- Bree, M P -- Lukas, S E -- DA-00101/DA/NIDA NIH HHS/ -- DA-02519/DA/NIDA NIH HHS/ -- DA-04059/DA/NIDA NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):859-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Alcohol and Drug Abuse Research Center, Harvard Medical School, McLean Hospital, Belmont, MA 02178.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772637" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Buprenorphine/*pharmacology/therapeutic use ; Cocaine/*administration & dosage ; Dose-Response Relationship, Drug ; Female ; Macaca mulatta ; Male ; Self Administration ; Substance-Related Disorders/*drug therapy
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 85
    facet.materialart.
    Unbekannt
    Novel sites of expression of functional angiotensin II receptors in the late gestation fetus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-06-16
    Beschreibung: In the adult, the peptide hormone angiotensin II (AII) is primarily known as a regulator of circulatory homeostasis, but recent evidence also suggests a role in cell growth. This study of AII in late gestation rat fetuses revealed the unexpected presence of receptors in skeletal muscle and connective tissue, in addition to those in recognized adult target tissues. The AII receptors in this novel location decreased by 80 percent 1 day after birth and were almost undetectable in the adult. Studies in fetal skin fibroblasts showed that the receptors were coupled to phospholipid breakdown, with concomitant increases in inositol phosphate and cytosolic calcium. The abundance, timing of expression, and unique localization of functional AII receptors in the fetus suggest a role for AII in fetal development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millan, M A -- Carvallo, P -- Izumi, S -- Zemel, S -- Catt, K J -- Aguilera, G -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1340-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Endocrine Physiology, National Institute of Child Health and Human Development, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734613" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Angiotensin II/*metabolism/physiology ; Animals ; Calcium/metabolism ; Fetus/*metabolism ; Fibroblasts/metabolism ; Inositol Phosphates/metabolism ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/*biosynthesis
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 86
    facet.materialart.
    Unbekannt
    Delay of gratification in children (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-26
    Beschreibung: To function effectively, individuals must voluntarily postpone immediate gratification and persist in goal-directed behavior for the sake of later outcomes. The present research program analyzed the nature of this type of future-oriented self-control and the psychological processes that underlie it. Enduring individual differences in self-control were found as early as the preschool years. Those 4-year-old children who delayed gratification longer in certain laboratory situations developed into more cognitively and socially competent adolescents, achieving higher scholastic performance and coping better with frustration and stress. Experiments in the same research program also identified specific cognitive and attentional processes that allow effective self-regulation early in the course of development. The experimental results, in turn, specified the particular types of preschool delay situations diagnostic for predicting aspects of cognitive and social competence later in life.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mischel, W -- Shoda, Y -- Rodriguez, M I -- New York, N.Y. -- Science. 1989 May 26;244(4907):933-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, Columbia University, New York 10027〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658056" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adaptation, Psychological ; Attention ; Child ; *Child Development ; Child, Preschool ; *Cognition ; Female ; *Frustration ; Humans ; *Individuality ; Male ; Reward ; Social Adjustment
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 87
    facet.materialart.
    Unbekannt
    Vaccination with a synthetic zona pellucida peptide produces long-term contraception in female mice (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-11-17
    Beschreibung: The zona pellucida surrounding mouse oocytes is an extracellular matrix composed of three sulfated glycoproteins, ZP1, ZP2, and ZP3. It has been demonstrated that a monoclonal antibody to ZP3 injected into female mice inhibits fertilization by binding to the zona pellucida and blocking sperm penetration. A complementary DNA encoding ZP3 was randomly cleaved and 200- to 1000-base pair fragments were cloned into the expression vector lambda gt11. This epitope library was screened with the aforementioned contraceptive antibody, and the positive clones were used to map the seven-amino acid epitope recognized by the antibody. Female mice were immunized with a synthetic peptide containing this B cell epitope coupled to a carrier protein to provide helper T cell epitopes. The resultant circulating antibodies to ZP3 bound to the zona pellucida of immunized animals and produced long-lasting contraception. The lack of ovarian histopathology or cellular cytotoxicity among the immunized animals may be because of the absence of zona pellucida T cell epitopes in this vaccine.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millar, S E -- Chamow, S M -- Baur, A W -- Oliver, C -- Robey, F -- Dean, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):935-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479101" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Antigens/immunology ; Base Sequence ; Cloning, Molecular ; *Contraception ; *Contraception, Immunologic ; DNA/genetics ; *Egg Proteins ; Epitopes/analysis ; Female ; Glycoproteins/genetics/*immunology ; Male ; *Membrane Glycoproteins ; Mice ; Molecular Sequence Data ; Ovum/*physiology ; Protein Conformation ; RNA, Messenger/genetics ; *Receptors, Cell Surface ; *Vaccination ; Zona Pellucida/*physiology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 88
    facet.materialart.
    Unbekannt
    Expression of high-affinity binding of human immunoglobulin E by transfected cells (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-21
    Beschreibung: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 89
    facet.materialart.
    Unbekannt
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-01
    Beschreibung: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 90
    facet.materialart.
    Unbekannt
    Receptor-mediated drug delivery to macrophages in chemotherapy of leishmaniasis (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-12
    Beschreibung: Methotrexate coupled to maleylated bovine serum albumin was taken up efficiently through the "scavenger" receptors present on macrophages and led to selective killing of intracellular Leishmania mexicana amazonensis amastigotes in cultured hamster peritoneal macrophages. The drug conjugate was nearly 100 times as effective as free methotrexate in eliminating the intracellular parasites. Furthermore, in a model of experimental cutaneous leishmaniasis in hamsters, the drug conjugate brought about more than 90% reduction in the size of footpad lesions within 11 days. In contrast, the free drug at a similar concentration did not significantly affect lesion size. These studies demonstrate the potential of receptor-mediated drug delivery in the therapy of macrophage-associated diseases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mukhopadhyay, A -- Chaudhuri, G -- Arora, S K -- Sehgal, S -- Basu, S K -- New York, N.Y. -- Science. 1989 May 12;244(4905):705-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Microbial Technology, Chandigarh, India.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2717947" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Albumins/*administration & dosage/metabolism ; Animals ; Cells, Cultured ; Cricetinae ; Female ; Kinetics ; Leishmania mexicana/*drug effects ; Leishmaniasis/*drug therapy ; Macrophages/metabolism/*parasitology ; Male ; *Membrane Proteins ; Mesocricetus ; Methotrexate/*administration & dosage/pharmacology/therapeutic use ; *Receptors, Immunologic/metabolism ; *Receptors, Lipoprotein ; Receptors, Scavenger ; Scavenger Receptors, Class B ; Serum Albumin, Bovine
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 91
    facet.materialart.
    Unbekannt
    Chromosome mapping and expression of a putative testis-determining gene in mouse (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-01-06
    Beschreibung: Isolation and mapping of a mouse complementary DNA sequence (mouse Y-finger) encoding a multiple, potential zinc-binding, finger protein homologous to the candidate human testis-determining factor gene is reported. Four similar sequences were identified in Hind III-digested mouse genomic DNA. Two (7.2 and 2.0 kb) were mapped to the Y chromosome. Only the 2.0-kb fragment, however, was correlated with testis determination. Polymerase chain reaction analysis suggests both Y loci are transcribed in adult testes. A 3.6-kb fragment was mapped to the X chromosome between the T16H and T6R1 translocation breakpoints, and a fourth (6.0 kb) was mapped to chromosome 10. Hence, mYfin sequences have been duplicated several times in the mouse, although they are not duplicated in humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nagamine, C M -- Chan, K M -- Kozak, C A -- Lau, Y F -- N01-CB-25584/CB/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):80-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2563174" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; *Chromosome Mapping ; DNA-Binding Proteins/genetics ; *Genes ; Male ; Metalloproteins/genetics ; Mice ; Nucleic Acid Hybridization ; Polymorphism, Restriction Fragment Length ; *Sex Determination Analysis ; Testis/*anatomy & histology ; *Transcription, Genetic ; X Chromosome ; Y Chromosome
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 92
    facet.materialart.
    Unbekannt
    Regulation of calcium release is gated by calcium current, not gating charge, in cardiac myocytes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-05-19
    Beschreibung: In skeletal muscle, intramembrane charge movement initiates the processes that lead to the release of calcium from the sarcoplasmic reticulum. In cardiac muscle, in contrast, the similarity of the voltage dependence of developed tension and intracellular calcium transients to that of calcium current suggests that the calcium current may gate the release of calcium. Nevertheless, a mechanism similar to that of skeletal muscle continues to be postulated for cardiac muscle. By using rapid exchange (20 to 50 milliseconds) of the extracellular solutions in rat ventricular myocytes in which the intracellular calcium transients or cell shortening were measured, it has now been shown that the influx of calcium through the calcium channel is a mandatory link in the processes that couple membrane depolarization to the release of calcium. Thus, intramembrane charge movement does not contribute to the release of calcium in heart muscle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nabauer, M -- Callewaert, G -- Cleemann, L -- Morad, M -- R01-HL16152/HL/NHLBI NIH HHS/ -- R01-HL33720/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 May 19;244(4906):800-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Pennsylvania, Department of Physiology, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2543067" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Barium/metabolism/pharmacology ; Benzofurans ; Buffers ; Calcium/*metabolism ; Calcium Channels/*physiology ; Dialysis ; Egtazic Acid/pharmacology ; Extracellular Space/metabolism ; Fluorescent Dyes ; Fura-2 ; Heart/drug effects/*physiology ; Heart Ventricles ; Membrane Potentials ; Myocardial Contraction ; Rats ; Sarcoplasmic Reticulum/metabolism ; Sodium/metabolism ; Spectrometry, Fluorescence
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 93
    facet.materialart.
    Unbekannt
    Angiotensin II: does it have a direct obligate role in ovulation? (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-25
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Naftolin, F -- Andrade-Gordon, P -- Pellicer, A -- Palumbo, A -- Apa, R -- Zreik, T -- Yoon, T K -- DeCherney, A -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):870-1.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Obstetrics and Gynecology, Yale University, New Haven, CT 06510-8063.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772639" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): 1-Sarcosine-8-Isoleucine Angiotensin II/pharmacology ; Angiotensin II/*physiology ; Animals ; Chorionic Gonadotropin/pharmacology ; Female ; Gonadotropins, Equine/pharmacology ; *Ovulation ; Rats ; Rats, Inbred Strains ; Receptors, Angiotensin/analysis ; Receptors, LH/analysis ; Saralasin/pharmacology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 94
    facet.materialart.
    Unbekannt
    Molecular genetics of human blue cone monochromacy (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-25
    Beschreibung: Blue cone monochromacy is a rare X-linked disorder of color vision characterized by the absence of both red and green cone sensitivities. In 12 of 12 families carrying this trait, alterations are observed in the red and green visual pigment gene cluster. The alterations fall into two classes. One class arose from the wild type by a two-step pathway consisting of unequal homologous recombination and point mutation. The second class arose by nonhomologous deletion of genomic DNA adjacent to the red and green pigment gene cluster. These deletions define a 579-base pair region that is located 4 kilobases upstream of the red pigment gene and 43 kilobases upstream of the nearest green pigment gene; this 579-base pair region is essential for the activity of both pigment genes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nathans, J -- Davenport, C M -- Maumenee, I H -- Lewis, R A -- Hejtmancik, J F -- Litt, M -- Lovrien, E -- Weleber, R -- Bachynski, B -- Zwas, F -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):831-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology and Genetics, Wilmer Ophthalmologic Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2788922" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Adolescent ; Adult ; Base Sequence ; Child ; Child, Preschool ; Chromosome Deletion ; Color Vision Defects/*genetics ; DNA/analysis ; Female ; Humans ; Male ; Molecular Sequence Data ; Mutation ; Nucleic Acid Hybridization ; Retinal Pigments/genetics ; Thalassemia/genetics ; X Chromosome
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 95
    facet.materialart.
    Unbekannt
    The mutations in Ashkenazi Jews with adult GM2 gangliosidosis, the adult form of Tay-Sachs disease (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-03-17
    Beschreibung: The adult form of Tay-Sachs disease, adult GM2 gangliosidosis, is an autosomal recessive disorder that results from mutations in the alpha chain of beta-hexosaminidase A. This disorder, like infantile Tay-Sachs disease, is more frequent in the Ashkenazi Jewish population. A point mutation in the alpha-chain gene was identified that results in the substitution of Gly with Ser in eight Ashkenazi adult GM2 gangliosidosis patients from five different families. This amino acid substitution was shown to depress drastically the catalytic activity of the alpha chain after expression in COS-1 cells. All of these patients proved to be compound heterozygotes of the allele with the Gly to Ser change and one of the two Ashkenazi infantile Tay-Sachs alleles. These findings will aid in the diagnosis and understanding of beta-hexosaminidase A deficiency disorders.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Navon, R -- Proia, R L -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1471-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Genetics and Biochemistry Branch, National Institute of Diabetes, Digestive, and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2522679" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; Humans ; Jews ; Pedigree ; RNA, Messenger/genetics ; Structure-Activity Relationship ; Tay-Sachs Disease/*genetics ; beta-N-Acetylhexosaminidases/*genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 96
    facet.materialart.
    Unbekannt
    Conserved repetitive epitope recognized by CD4+ clones from a malaria-immunized volunteer (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: T cell clones obtained from a human volunteer immunized with Plasmodium falciparum sporozoites specifically recognized the native circumsporozoite (CS) antigen expressed on P. falciparum sporozoites, as well as bacteria- and yeast-derived recombinant falciparum CS proteins. The response of these CD4+ CD8- cells was species-specific, since the clones did not proliferate or secrete gamma interferon when challenged with sporozoites or recombinant CS proteins of other human, simian, or rodent malarias. The epitope recognized by the sporozoite-specific human T cell clones mapped to the 5' repeat region of the CS protein and was contained in the NANPNVDPNANP sequence.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nardin, E H -- Herrington, D A -- Davis, J -- Levine, M -- Stuber, D -- Takacs, B -- Caspers, P -- Barr, P -- Altszuler, R -- Clavijo, P -- AI25085/AI/NIAID NIH HHS/ -- AI62533/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1603-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical and Molecular Parasitology, New York University, NY 10010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480642" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Animals ; Antigens, CD4/*immunology ; Antigens, Protozoan/*immunology ; Cells, Cultured ; Clone Cells ; Epitopes/*analysis ; Humans ; Interferon-gamma/biosynthesis ; Lymphocyte Activation ; Malaria/*immunology ; Molecular Sequence Data ; Plasmodium falciparum/*immunology ; *Protozoan Proteins ; Recombinant Proteins/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 97
    facet.materialart.
    Unbekannt
    Mouse embryonic stem cells and reporter constructs to detect developmentally regulated genes (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-04-28
    Beschreibung: A strategy was devised for identifying regions of the mouse genome that are transcriptionally active in a temporally and spatially restricted manner during development. The approach is based on the introduction into embryonic stem cells of two types of lacZ reporter constructs that can be activated by flanking mouse genomic sequences. Embryonic stem cells containing the lacZ constructs were used to produce chimaeric mice. Developmental regulation of lacZ expression occurred at a high frequency. Molecular cloning of the flanking endogenous genes and introduction of these potential insertional mutations into the mouse germ line should provide an efficient means of identifying and mutating novel genes important for the control of mammalian development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gossler, A -- Joyner, A L -- Rossant, J -- Skarnes, W C -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):463-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Mount Sinai Hospital Research Institute, Division of Molecular and Developmental Biology, Toronto, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2497519" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Cell Line ; Chimera ; Cloning, Molecular ; Embryo, Mammalian/*metabolism ; Galactosidases/*genetics ; *Gene Expression Regulation ; Genetic Vectors ; Germ Cells ; Heat-Shock Proteins/genetics ; Male ; Mice ; Promoter Regions, Genetic ; Stem Cells/*metabolism ; Transfection ; Transformation, Genetic ; beta-Galactosidase/*genetics
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 98
    facet.materialart.
    Unbekannt
    Polymer synthesis and organotransition metal chemistry (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-02-17
    Beschreibung: Mechanistic and synthetic studies in organometallic chemistry have provided considerable insight into olefin metathesis and Ziegler-Natta polymerization. New homogeneous olefin metathesis catalysts based on high oxidation state transition metals have opened new opportunities in polymer synthesis by providing unprecedented control in ring-opening polymerization of cyclic alkenes. The recent development of living coordinative polymerization systems has led to the preparation of a number of new, interesting materials, including block copolymers, conducting polymers or precursors, and ionophoric polymeric substrates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Grubbs, R H -- Tumas, W -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):907-15.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2645643" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Chemical Phenomena ; Chemistry ; *Organometallic Compounds ; *Polymers
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 99
    facet.materialart.
    Unbekannt
    RNA editing in plant mitochondria (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-12-22
    Beschreibung: Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hiesel, R -- Wissinger, B -- Schuster, W -- Brennicke, A -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1632-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Genbiologische Forschung, Berlin, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480644" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA, Mitochondrial/genetics ; Electron Transport Complex IV/*genetics ; *Genes, Plant ; Humans ; Mitochondria/*enzymology ; Molecular Sequence Data ; Plants/enzymology/*genetics ; RNA/*genetics ; RNA Processing, Post-Transcriptional ; RNA, Messenger/genetics ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
  • 100
    facet.materialart.
    Unbekannt
    Circumcision may protect against the AIDS virus (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publikationsdatum: 1989-08-04
    Beschreibung: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Aug 4;245(4917):470-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2756431" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Acquired Immunodeficiency Syndrome/*prevention & control/transmission ; Africa ; *Circumcision, Male ; Humans ; Male ; Prostitution ; Risk Factors ; Sexual Behavior
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Publiziert von American Association for the Advancement of Science (AAAS)
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
    AKTUELLE ARTIKEL
Schließen ⊗
Diese Webseite nutzt Cookies und das Analyse-Tool Matomo. Weitere Informationen finden Sie hier...