ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Articles  (1,941)
  • Humans  (1,941)
  • 1985-1989  (1,941)
  • Science. 230(4729): 992.  (2)
  • Science. 231(4735): 203.  (2)
  • Science. 231(4737): 442.  (2)
  • Science. 232(4748): 307.  (2)
  • Science. 232(4755): 1197.  (2)
  • Science. 233(4760): 159.  (2)
  • Science. 233(4760): 160.  (2)
  • Science. 233(4762): 414.  (2)
  • Science. 233(4762): 419.  (2)
  • Science. 235(4793): 1136.  (2)
  • Science. 235(4796): 1570.  (2)
  • Science. 236(4809): 1613.  (2)
  • Science. 238(4834): 1635.  (2)
  • Science. 239(4839): 457.  (2)
  • Science. 240(4852): 597.  (2)
  • Science. 240(4858): 1407.  (2)
  • Science. 240(4860): 1728.  (2)
  • Science. 241(4869): 1028.  (2)
  • Science. 242(4879): 651.  (2)
  • Science. 242(4883): 1227.  (2)
  • 25
  • Biology  (1,941)
Collection
  • Articles  (1,941)
Years
Year
Journal
Topic
  • 101
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Duesberg, P -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922599" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*etiology ; *Hiv ; Humans ; Publishing/*standards
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 102
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Norman, C -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):159-61.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911727" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/economics ; Budgets ; Government Agencies ; Humans ; National Institutes of Health (U.S.) ; *Research Support as Topic ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 103
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: Parasitic protozoans and helminths pose considerable medical as well as scientific challenges. Investigations of the complex and very different life cycles of these organisms, their adaptation to the obligate parasitic mode of life, and their ability to face the hostile host environment have resulted in many exciting discoveries. Invasion of host erythrocytes by plasmodial sporozoites and intact skin by schistosomal cercariae are outlined as examples of the elaborate mechanisms of parasitism. Isolation and characterization of single protective antigens or subunit vaccines from these two organisms are examined as models for vaccine development. Finally, developments in exploring gene regulation in protozoans and free and parasitic nematodes are briefly outlined.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mahmoud, A A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1015-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Case Western Reserve University School of Medicine, Cleveland, OH 44106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686024" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Eukaryota/genetics/pathogenicity/*physiology ; Gene Expression Regulation ; Helminthiasis/*immunology ; Helminths/genetics/pathogenicity/*physiology ; Humans ; Molecular Sequence Data ; Protozoan Infections/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 104
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-15
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marshall, E -- New York, N.Y. -- Science. 1989 Sep 15;245(4923):1185.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781278" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Bone and Bones/*analysis/anatomy & histology ; Female ; *Forensic Medicine ; *Fossils ; Humans ; Infant ; Male ; *Paleontology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 105
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marshall, E -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):345, 347.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2756418" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; Clinical Trials as Topic/*standards ; Humans ; *Legislation, Drug
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 106
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Olson, M -- Hood, L -- Cantor, C -- Botstein, D -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1434-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781285" target="_blank"〉PubMed〈/a〉
    Keywords: *Base Sequence ; *Chromosome Mapping ; *Chromosomes, Human ; Humans ; Research Design/standards
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 107
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Guyer, R L -- Koshland, D E Jr -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1543-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688087" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Induced ; Cystic Fibrosis/genetics ; DNA/*genetics ; DNA-Directed DNA Polymerase ; Female ; *Genetic Techniques ; Humans ; Microscopy, Electron, Scanning ; Mifepristone ; Nucleic Acid Amplification Techniques ; Pregnancy ; Research/*trends
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 108
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hamburg, B A -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):738.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814491" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Child ; Child, Preschool ; Humans ; Infant ; *Mental Disorders ; *Research ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 109
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-06
    Description: Plasminogen activator therapy for acute myocardial infarction has become standard medical practice. Bleeding complications, however, limit the utility of the currently available agents. This article reviews how the tools of molecular biology and protein engineering are being used to develop safer and more effective plasminogen activators.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Haber, E -- Quertermous, T -- Matsueda, G R -- Runge, M S -- HL-19259/HL/NHLBI NIH HHS/ -- HL-28015/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):51-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cardiac Unit, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2492113" target="_blank"〉PubMed〈/a〉
    Keywords: Humans ; Myocardial Infarction/*drug therapy ; Plasminogen Activators/*therapeutic use ; Protein Conformation ; Recombinant Proteins/therapeutic use ; Streptokinase/therapeutic use ; Tissue Plasminogen Activator/therapeutic use ; Urokinase-Type Plasminogen Activator/therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 110
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-27
    Description: The discovery that breakdown products of cellular sphingolipids are biologically active has generated interest in the role of these molecules in cell physiology and pathology. Sphingolipid breakdown products, sphingosine and lysosphingolipids, inhibit protein kinase C, a pivotal enzyme in cell regulation and signal transduction. Sphingolipids and lysosphingolipids affect significant cellular responses and exhibit antitumor promoter activities in various mammalian cells. These molecules may function as endogenous modulators of cell function and possibly as second messengers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hannun, Y A -- Bell, R M -- CA46738/CA/NCI NIH HHS/ -- GM38737/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):500-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2643164" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Physiological Phenomena ; Ethanolamines/physiology ; Humans ; Lipids/physiology ; Protein Kinase C/antagonists & inhibitors ; Sphingolipids/*physiology ; Sphingosine/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 111
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1244.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511632" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; *Clinical Trials as Topic ; Didanosine/*therapeutic use ; Humans
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 112
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1559-60.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595368" target="_blank"〉PubMed〈/a〉
    Keywords: *ADP Ribose Transferases ; Acquired Immunodeficiency Syndrome/immunology/*therapy ; Antigens, CD4/immunology ; *Bacterial Toxins ; Drug Design ; Exotoxins/*therapeutic use ; Humans ; Immunoglobulin G ; Immunotoxins/*therapeutic use ; *Virulence Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 113
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):882.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814511" target="_blank"〉PubMed〈/a〉
    Keywords: Humans ; Personnel Staffing and Scheduling ; United States ; *United States Dept. of Health and Human Services ; *United States Food and Drug Administration
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 114
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1560.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556794" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*epidemiology/prevention & ; control/transmission ; Centers for Disease Control and Prevention (U.S.) ; Humans ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 115
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):752.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814496" target="_blank"〉PubMed〈/a〉
    Keywords: *Aborted Fetus ; *Abortion, Induced ; Federal Government ; *Fetal Research ; *Fetus ; Government Regulation ; Humans ; *Research Support as Topic ; Transplantation/*legislation & jurisprudence ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 116
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):353.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2502839" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; Antiviral Agents/*therapeutic use ; Clinical Trials as Topic ; Didanosine ; Dideoxynucleosides/*therapeutic use ; HIV/*drug effects ; Humans
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 117
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-21
    Description: An article in 30 June issue (";Dangerous' liaisons in cell biology," p. 1539), which discussed the commentary in the 2 June issue of the journal Cell by Max L. Birnstiel and Meinrad Busslinger regarding the transgenic mice experiments of Corrado Spadafora and co-workers, stated that Vienna's Institute of Molecular Pathology (IMP), for which Birnstiel and Busslinger work, was seeking patents on extensions of the Spadafora experiments. On further investigation, we have learned that this is not correct. At present no applications have been applied for or granted to IMP or its parent companies Genentech and Boehringer Ingelheim. We wish to correct the record, apologize to Dr. Birnstiel and Dr. Busslinger for this misstatement, and alert our readers to their letter, which is printed in our Letters section on page 243.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jul 21;245(4915):252-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2526371" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; CDC2 Protein Kinase ; *Cell Cycle ; Cell Division ; Cyclins ; Growth Substances/physiology ; Humans ; Invertebrate Hormones/physiology ; Maturation-Promoting Factor ; Phosphoproteins/*physiology ; Protein Kinases/*physiology ; Proto-Oncogenes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 118
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):131.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749252" target="_blank"〉PubMed〈/a〉
    Keywords: *Base Sequence ; *Chromosome Mapping ; *Chromosomes, Human ; Humans ; *National Institutes of Health (U.S.) ; Plants/*genetics ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 119
    Publication Date: 1989-10-27
    Description: According to the place principles of the classical hearing theory, the physical entity frequency is encoded in the auditory periphery as place information (tonotopic representation), which is decoded in more central parts of the auditory system to form the subjective entity pitch. However, this relation is true only for pure-tone signals (spectral pitch); it can be quite different in the case of complex auditory stimuli (virtual pitch), thus requiring a multistage process for pitch formation. Neuromagnetic measurements showed that the tonotopic organization of the primary auditory cortex reflects the pitch rather than the frequency of the stimulus; that is, the pitch formation process must take place in subcortical regions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pantev, C -- Hoke, M -- Lutkenhoner, B -- Lehnertz, K -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):486-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Experimental Audiology, University of Munster, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814476" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Acoustics ; Audiometry/methods ; Auditory Cortex/*physiology ; Brain Mapping ; Humans ; Magnetics ; Pitch Perception/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 120
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Jul 28;245(4916):351-2.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2756422" target="_blank"〉PubMed〈/a〉
    Keywords: Humans ; Research ; Sleep/*physiology ; Sleep Wake Disorders/*physiopathology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 121
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):885-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2919279" target="_blank"〉PubMed〈/a〉
    Keywords: *Educational Measurement ; Female ; Humans ; *Jurisprudence ; Male ; *Prejudice ; *School Admission Criteria ; Sex Factors ; United States ; *Universities
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 122
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1551-2.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928791" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; *Drug Resistance, Microbial ; HIV/*drug effects ; Humans ; Zidovudine/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 123
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1012-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2538000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Transformation, Neoplastic ; Cell Transformation, Viral ; DNA Tumor Viruses/genetics/*physiology ; Genes, Viral ; Hepatitis B virus/genetics/*physiology ; Herpesvirus 4, Human/genetics/*physiology ; Humans ; Neoplasms/*etiology/immunology/prevention & control ; Oncogenes ; Papillomaviridae/genetics/*physiology ; Tumor Virus Infections/microbiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 124
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):737-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2783787" target="_blank"〉PubMed〈/a〉
    Keywords: Cells, Cultured ; Electrophoresis/methods ; Humans ; Hypoxanthine Phosphoribosyltransferase/genetics ; *Mutagenicity Tests ; T-Lymphocytes/drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 125
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):315-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2521401" target="_blank"〉PubMed〈/a〉
    Keywords: Aging ; Blood Coagulation Disorders/physiopathology ; Emphysema/genetics/therapy ; Heart Diseases/*genetics ; Hematologic Diseases/*genetics ; Humans ; Lipoprotein(a) ; Lipoproteins/genetics ; Lung Diseases/*genetics ; Thrombin/physiology ; alpha 1-Antitrypsin/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 126
    Publication Date: 1989-02-17
    Description: The retinoblastoma (Rb) antioncogene encodes a nuclear phosphoprotein, p105-Rb, that forms protein complexes with the adenovirus E1A and SV40 large T oncoproteins. A novel, aberrant Rb protein detected in J82 bladder carcinoma cells was not able to form a complex with E1A and was less stable than p105-Rb. By means of a rapid method for the detection of mutations in Rb mRNA, this defective Rb protein was observed to result from a single point mutation within a splice acceptor sequence in J82 genomic DNA. This mutation eliminates a single exon and 35 amino acids from its encoded protein product.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Horowitz, J M -- Yandell, D W -- Park, S H -- Canning, S -- Whyte, P -- Buchkovich, K -- Harlow, E -- Weinberg, R A -- Dryja, T P -- CA 08131/CA/NCI NIH HHS/ -- CA 13106/CA/NCI NIH HHS/ -- CA 39826/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):937-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge 02142.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2521957" target="_blank"〉PubMed〈/a〉
    Keywords: Adenovirus Early Proteins ; Antigens, Polyomavirus Transforming ; Base Sequence ; DNA-Binding Proteins/metabolism ; Eye Neoplasms/*genetics ; Humans ; Molecular Sequence Data ; *Mutation ; Oncogene Proteins, Viral/metabolism ; *Oncogenes ; Phosphoproteins/*genetics/metabolism ; Retinoblastoma/*genetics ; Retinoblastoma Protein
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 127
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-25
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J L -- New York, N.Y. -- Science. 1989 Aug 25;245(4920):811.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672331" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; Clinical Trials as Topic ; Humans ; Zidovudine/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 128
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pauling, L -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1535.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928785" target="_blank"〉PubMed〈/a〉
    Keywords: Ascorbic Acid/*history ; Humans ; Publishing/standards
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 129
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pavlakis, S G -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):874.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814504" target="_blank"〉PubMed〈/a〉
    Keywords: Epilepsy/*therapy ; Humans ; Magnetics ; Periodicals as Topic/standards ; Publishing
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 130
    Publication Date: 1989-06-09
    Description: Vasoactive intestinal peptide (VIP) labeled with 125I, [Tyr10-125I]VIP, can be hydrolyzed by immunoglobulin G (IgG) purified from a human subject, as judged by trichloroacetic acid precipitation and reversed-phase high-performance liquid chromatography (HPLC). The hydrolytic activity was precipitated by antibody to human IgG, it was bound by immobilized protein G and showed a molecular mass close to 150 kilodaltons by gel filtration chromatography, properties similar to those of authentic IgG. The Fab fragment, prepared from IgG by papain treatment, retained the VIP hydrolytic activity of the IgG. Peptide fragments produced by treatment of VIP with the antibody fraction were purified by reversed-phase HPLC and identified by fast atom bombardment-mass spectrometry and peptide sequencing. The scissile bond in VIP deduced from these experiments was Gln16-Met17. The antibody concentration (73.4 fmol per milligram of IgG) and the Kd (0.4 nM) were computed from analysis of VIP binding under conditions that did not result in peptide hydrolysis. Analysis of the antibody-mediated VIP hydrolysis at varying concentrations of substrate suggested conformity with Michaelis-Menton kinetics (Km). The values for Km (37.9 X 10(-9) M) and the turnover number kcat (15.6 min-1) suggested relatively tight VIP binding and a moderate catalytic efficiency of the antibody.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Paul, S -- Volle, D J -- Beach, C M -- Johnson, D R -- Powell, M J -- Massey, R J -- HL 35506/HL/NHLBI NIH HHS/ -- HL 40348/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1158-62.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Nebraska Medical Center, Omaha 68105.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727702" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; *Autoantibodies ; Catalysis ; Chromatography, High Pressure Liquid ; Humans ; Hydrolysis ; Immunoglobulin Fab Fragments ; *Immunoglobulin G ; Kinetics ; Molecular Sequence Data ; Peptide Fragments/isolation & purification ; Vasoactive Intestinal Peptide/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 131
    Publication Date: 1989-11-10
    Description: Genomic sequencing permits studies of in vivo DNA methylation and protein-DNA interactions, but its use has been limited because of the complexity of the mammalian genome. A newly developed genomic sequencing procedure in which a ligation mediated polymerase chain reaction (PCR) is used generates high quality, reproducible sequence ladders starting with only 1 microgram of uncloned mammalian DNA per reaction. Different sequence ladders can be created simultaneously by inclusion of multiple primers and visualized separately by rehybridization. Relatively little radioactivity is needed for hybridization and exposure times are short. Methylation patterns in genomic DNA are readily detectable; for example, 17 CpG dinucleotides in the 5' region of human X-linked PGK-1 (phosphoglycerate kinase 1) were found to be methylated on an inactive human X chromosome, but unmethylated on an active X chromosome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pfeifer, G P -- Steigerwald, S D -- Mueller, P R -- Wold, B -- Riggs, A D -- AG08196/AG/NIA NIH HHS/ -- GM355262BW/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):810-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Biology Section, Beckman Research Institute of the City of Hope, Duarte, CA 91010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814502" target="_blank"〉PubMed〈/a〉
    Keywords: 5-Methylcytosine ; Animals ; Autoradiography ; Base Sequence ; Cytosine ; DNA/*genetics/metabolism ; Exons ; HeLa Cells ; Humans ; Methylation ; Molecular Sequence Data ; *Nucleic Acid Amplification Techniques ; *Nucleic Acid Hybridization ; Phosphoglycerate Kinase/genetics ; Polymerase Chain Reaction/*methods ; Promoter Regions, Genetic ; X Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 132
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-16
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pool, R -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1256-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734609" target="_blank"〉PubMed〈/a〉
    Keywords: *Circadian Rhythm ; Humans ; *Phototherapy ; Sleep Wake Disorders/*therapy ; Travel
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 133
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pool, R -- New York, N.Y. -- Science. 1989 Feb 3;243(4891):604-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2916117" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/*physiopathology ; Electrocardiography ; Electroencephalography ; Epilepsy/physiopathology ; Heart/*physiopathology ; Heart Rate ; Homeostasis ; Humans ; Myocardial Infarction/physiopathology ; *Periodicity ; Risk Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 134
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pool, R -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):25-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911717" target="_blank"〉PubMed〈/a〉
    Keywords: Child ; Computer Simulation ; *Epidemiology ; Humans ; Measles/epidemiology ; *Models, Statistical ; *Models, Theoretical ; New York City ; Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 135
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, D -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1555-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595367" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*prevention & control ; *Biotechnology ; Canada ; Drug Evaluation ; Humans ; Public Relations ; Viral Vaccines/adverse effects/therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 136
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-07
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Poole, R -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):26-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740911" target="_blank"〉PubMed〈/a〉
    Keywords: Heart/physiology/physiopathology ; *Heart Rate ; Humans ; *Models, Theoretical ; Physical Phenomena ; *Physics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 137
    Publication Date: 1989-09-22
    Description: GABAA (gamma-aminobutyric acid A)-benzodiazepine receptors expressed in mammalian cells and assembled from one of three different alpha subunit variants (alpha 1, alpha 2, or alpha 3) in combination with a beta 1 and a gamma 2 subunit display the pharmacological properties of either type I or type II receptor subtypes. These receptors contain high-affinity binding sites for benzodiazepines. However, CL 218 872, 2-oxoquazepam, and methyl beta-carboline-3-carboxylate (beta-CCM) show a temperature-modulated selectivity for alpha 1 subunit-containing receptors. There were no significant differences in the binding of clonazepam, diazepam, Ro 15-1788, or dimethoxy-4-ethyl-beta-carboline-3-carboxylate (DMCM) to all three recombinant receptors. Receptors containing the alpha 3 subunit show greater GABA potentiation of benzodiazepine binding than receptors containing the alpha 1 or alpha 2 subunit, indicating that there are subtypes within the type II class. Thus, diversity in benzodiazepine pharmacology is generated by heterogeneity of the alpha subunit of the GABAA receptor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pritchett, D B -- Luddens, H -- Seeburg, P H -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1389-92.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Neuroendocrinology, Zentrum fur Molekulare Biologie, Universitat Heidelberg, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2551039" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Line ; Diazepam/metabolism ; Flumazenil/metabolism ; Flunitrazepam/metabolism ; Humans ; Molecular Weight ; Pyridazines/metabolism ; Receptors, GABA-A/classification/*genetics/metabolism ; Recombinant Proteins/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 138
    Publication Date: 1989-01-20
    Description: Both interleukin-1 (IL-1) and platelet-derived growth factor (PDGF) induce proliferation of cultured fibroblasts and smooth muscle cells. These polypeptide mediators are released by activated macrophages and other cell types in response to injury and are thought to have a role in tissue remodeling and a number of pathologic processes. Analysis of the kinetics of [3H]thymidine incorporation by cultured fibroblasts demonstrated that the response to IL-1 is delayed approximately 8 hours relative to their response to PDGF. IL-1 transiently stimulated expression of the PDGF A-chain gene, with maximum induction after approximately 2 hours. Subsequent synthesis and release of PDGF activity into the medium was detected as early as 4 hours after IL-1 stimulation, and downregulation of the binding site for the PDGF-AA isoform of PDGF followed PDGF-AA secretion. Antibodies to PDGF completely block the mitogenic response to IL-1. Therefore, the mitogenic activity of IL-1 for fibroblasts and smooth muscle cells appears to be indirect and mediated by induction of the PDGF A-chain gene.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raines, E W -- Dower, S K -- Ross, R -- HL-18645/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):393-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2783498" target="_blank"〉PubMed〈/a〉
    Keywords: Cells, Cultured ; Fibroblasts/cytology/*drug effects ; Gene Expression Regulation/drug effects ; Humans ; Interleukin-1/*pharmacology ; Muscle, Smooth/cytology/*drug effects ; Platelet-Derived Growth Factor/*physiology ; RNA, Messenger/genetics ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 139
    Publication Date: 1989-08-11
    Description: Cholesterol balance in mammalian cells is maintained in part by sterol-mediated repression of gene transcription for the low density lipoprotein receptor and enzymes in the cholesterol biosynthetic pathway. A promoter sequence termed the sterol regulatory element (SRE) is essential for this repression. With the use of an oligonucleotide containing the SRE to screen a human hepatoma complementary DNA expression library, a clone for a DNA binding protein was isolated that binds to the conserved SRE octanucleotide in both a sequence-specific and a single-strand--specific manner. This protein contains seven highly conserved zinc finger repeats that exhibit striking sequence similarity to retroviral nucleic acid binding proteins (NBPs). We have designated the protein "cellular NBP" (CNBP). CNBP is expressed in a wide variety of tissues, is up regulated by sterols, and exhibits binding specificity that correlates with in vivo function. These properties are consistent with a role in sterol-mediated control of transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rajavashisth, T B -- Taylor, A K -- Andalibi, A -- Svenson, K L -- Lusis, A J -- HL30568/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):640-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2562787" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Binding Sites ; Carcinoma, Hepatocellular/metabolism ; Cholesterol/biosynthesis ; DNA/*metabolism ; DNA Probes ; DNA-Binding Proteins/genetics/*metabolism ; Gene Expression Regulation/*drug effects ; Humans ; Hydroxymethylglutaryl CoA Reductases/genetics ; Liver Neoplasms/metabolism ; Metalloproteins/genetics/*metabolism ; Molecular Sequence Data ; Promoter Regions, Genetic ; *RNA-Binding Proteins ; Receptors, LDL/genetics ; *Regulatory Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid ; Sterols/*pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 140
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rall, D P -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):564.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2619823" target="_blank"〉PubMed〈/a〉
    Keywords: *Accidents ; Alaska ; *Environmental Pollution ; *Fuel Oils ; Humans ; *Petroleum
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 141
    Publication Date: 1989-04-07
    Description: The myb-ets-containing acute leukemia virus, E26, transforms myeloblasts and erythroblasts in culture and causes a mixed erythroid and myeloid leukemia in chicks. Genes (ets-1, ets-2, and erg) with variable relatedness to the v-ets oncogene of the E26 virus have been identified, cloned, and characterized in several species. Two new members (elk-1 and elk-2) of the ets oncogene superfamily have now been identified. Nucleotide sequence analysis of the elk-1 cDNA clone revealed that this gene encodes a 428-residue protein whose predicted amino acid sequence showed 82% similarity to the 3' region of v-ets. The elk or related sequences appear to be transcriptionally active in testis and lung. The elk cDNA probe detects two loci in the human genome, elk-1 and elk-2, which map to chromosome regions Xp11.2 and 14q32.3, respectively. These loci are near the translocation breakpoint seen in the t(X;18) (p11.2;q11.2), which is characteristic of synovial sarcoma, and the chromosome 14q32 breakpoints seen in ataxia telangiectasia and other T cell malignancies. This suggests the possibility that rearrangements of elk loci may be involved in pathogenesis of certain tumors.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rao, V N -- Huebner, K -- Isobe, M -- ar-Rushdi, A -- Croce, C M -- Reddy, E S -- CA-21124/CA/NCI NIH HHS/ -- CA-25875/CA/NCI NIH HHS/ -- CA-39860/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Apr 7;244(4900):66-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2539641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Avian Leukosis Virus/*genetics ; Base Sequence ; Chick Embryo ; Chickens ; Chromosome Mapping ; Cloning, Molecular ; DNA Probes ; *DNA-Binding Proteins ; Humans ; Mice ; Molecular Sequence Data ; *Oncogenes ; *Proto-Oncogene Proteins ; Rats ; Retroviridae Proteins/*genetics/isolation & purification ; *Transcription Factors ; *Translocation, Genetic ; *X Chromosome ; ets-Domain Protein Elk-1
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 142
    Publication Date: 1989-06-09
    Description: The pathogenesis of Heymann nephritis, a rat model of human membranous glomerulonephritis, depends on the interaction of autoantibodies with a renal glycoprotein (GP330) on glomerular podocytes. Partial complementary DNAs coding for GP330 were isolated and sequenced. The deduced amino acid sequence from 4.3 kilobases of complementary DNA contains the sequences identical to two peptides derived from the isolated glycoprotein. The deduced amino acid sequence of this protein contains regions with homology to the human low density lipoprotein (LDL) receptor, an indication that GP330 and the LDL receptor may be members of the same gene family. Autoantibodies from the kidneys of rats with Heymann nephritis reacted with a nonglycosylated segment of GP330 that contains cysteine-rich 40-amino acid repeats, which are also features of the LDL receptor. GP330 is also similar in some regions to the mouse epidermal growth factor precursor.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Raychowdhury, R -- Niles, J L -- McCluskey, R T -- Smith, J A -- P01-DK38452/DK/NIDDK NIH HHS/ -- R01-DK18729/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1163-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Massachusetts General Hospital, Boston 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786251" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Autoantibodies/*genetics ; DNA/genetics ; Glomerulonephritis/genetics/*immunology ; Heymann Nephritis Antigenic Complex ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; Rats ; Rats, Inbred Lew ; Receptors, LDL/*genetics ; Reference Values ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 143
    Publication Date: 1989-01-27
    Description: Techniques of gene amplification, molecular cloning, and sequence analysis were used to test for the presence of sequences related to human T-lymphotropic virus type I (HTLV-I) in peripheral blood mononuclear cells of six patients with multiple sclerosis (MS) and 20 normal individuals. HTLV-I sequences were detected in all six MS patients and in one individual from the control group by DNA blot analysis and molecular cloning of amplified DNAs. The viral sequence in MS patients were associated with adherent cell populations consisting predominantly of monocytes and macrophages. Molecular cloning and nucleotide sequence analysis indicated that these amplified viral sequences were related to the HTLV-I proviral genome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- Sandberg-Wollheim, M -- Mettus, R V -- Ray, P E -- DeFreitas, E -- Koprowski, H -- CA-10815/CA/NCI NIH HHS/ -- NS-11036/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):529-33.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536193" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Adult ; Base Sequence ; Child ; *Cloning, Molecular ; DNA Restriction Enzymes ; DNA, Viral/*genetics ; Female ; *Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Leukocytes, Mononuclear/analysis/microbiology ; Macrophages/analysis/microbiology ; Male ; Molecular Sequence Data ; Multiple Sclerosis/*microbiology ; Nucleic Acid Hybridization ; Oligonucleotide Probes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 144
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-24
    Description: Positron emission tomographic measurements of regional blood flow, a marker of local neuronal activity, were used to investigate the neuroanatomical correlates of a normal emotion. Healthy volunteers were studied before, during, and after anticipation of a painful electric shock. During anticipatory anxiety, there were significant blood flow increases in bilateral temporal poles, the same regions recently implicated in a lactate-induced anxiety attack in patients with panic disorder. Thus, the temporal poles seem to be involved in normal and pathological forms of human anxiety.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reiman, E M -- Fusselman, M J -- Fox, P T -- Raichle, M E -- MH-00615/MH/NIMH NIH HHS/ -- NS-00904/NS/NINDS NIH HHS/ -- NS-06833/NS/NINDS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Feb 24;243(4894 Pt 1):1071-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychiatry, Washington University School of Medicine, St. Louis, MO 63110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2784226" target="_blank"〉PubMed〈/a〉
    Keywords: Anxiety/*physiology ; Brain/anatomy & histology/blood supply/*physiology ; Electroshock ; Humans ; Neurons/physiology ; Regional Blood Flow ; Tomography, Emission-Computed
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 145
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):10-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781296" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; DNA, Single-Stranded/genetics ; Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Multiple Sclerosis/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 146
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: Hematogenous metastasis requires the arrest and extravasation of blood-borne tumor cells, possibly involving direct adhesive interactions with vascular endothelium. Cytokine activation of cultured human endothelium increases adhesion of melanoma and carcinoma cell lines. An inducible 110-kD endothelial cell surface glycoprotein, designated INCAM-110, appears to mediate adhesion of melanoma cells. In addition, an inducible endothelial receptor for neutrophils, ELAM-1, supports the adhesion of a human colon carcinoma cell line. Thus, activation of vascular endothelium in vivo that results in increased expression of INCAM-110 and ELAM-1 may promote tumor cell adhesion and affect the incidence and distribution of metastases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rice, G E -- Bevilacqua, M P -- HL 07727/HL/NHLBI NIH HHS/ -- P01 HL36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1303-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588007" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Cell Adhesion/physiology ; Cell Adhesion Molecules/analysis/*physiology ; Colonic Neoplasms/pathology ; Endothelium, Vascular/analysis/*cytology/physiology ; Humans ; Melanoma/*pathology ; Melanoma, Experimental/pathology ; Molecular Weight ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 147
    Publication Date: 1989-01-13
    Description: Salivary gland lysates of the sand fly Lutzomyia longipalpis contain a potent vasodilator that aids the fly to feed on the blood of its vertebrate hosts. Chromatographic analysis, antibody reactivity, and data obtained from bioassays of the salivary erythema-inducing factor indicate striking similarity with human calcitonin gene-related peptide. The erythema-inducing factor is, however, at least one order of magnitude more potent than calcitonin gene-related peptide.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ribeiro, J M -- Vachereau, A -- Modi, G B -- Tesh, R B -- AI18694-0481/AI/NIAID NIH HHS/ -- AI21049/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):212-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Tropical Public Health, Harvard School of Public Health, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2783496" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Aorta/drug effects/physiology ; Calcitonin/pharmacology ; Calcitonin Gene-Related Peptide ; Chromatography, High Pressure Liquid ; Diptera ; Erythema ; Humans ; In Vitro Techniques ; Muscle, Smooth, Vascular/drug effects/*physiology ; Neuropeptides/pharmacology ; Rabbits ; Salivary Proteins and Peptides/*isolation & purification/pharmacology ; Vasodilation ; *Vasodilator Agents
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 148
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Expression of the c-myc oncogene is deregulated in a variety of malignancies. Rearrangement and mutation of the c-myc locus is a characteristic feature of human Burkitt's lymphoma. Whether deregulation is solely a result of mutation of c-myc or whether it is influenced by the transformed B cell context has not been determined. A translocated and mutated allele of c-myc was stably transfected into fibroblasts. The rearranged allele was expressed indistinguishably from a normal c-myc gene: it had serum-regulated expression, was transcribed with normal promoter preference, and was strongly attenuated. Thus mutations by themselves are insufficient to deregulate c-myc transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richman, A -- Hayday, A -- 40364/PHS HHS/ -- GM 07499/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):494-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Burkitt Lymphoma/genetics ; Cell Line ; Fibroblasts/metabolism ; Gene Expression Regulation, Neoplastic ; Humans ; Mutation ; Oncogenes/*genetics ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-myc ; *Transfection ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 149
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ridgway, S H -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):875.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2919278" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dolphins ; Humans ; *Military Science ; *Pinnipedia ; *Seals, Earless ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 150
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-14
    Description: A procedure has been developed for introducing exogenous DNA into mouse eggs by injection of chromosome fragments. Chromosome fragments were dissected from human metaphase spreads and microinjected into the pronuclei of fertilized mouse eggs. Many of the injected eggs subsequently exhibited normal pre- and postimplantation development. Embryos obtained from eggs injected with centromeric fragments retained human centromeric DNA as demonstrated by in situ hybridization analysis. From eggs injected with noncentromeric fragments, a mouse was obtained whose tail tissue exhibited the presence of human DNA. This procedure should facilitate incorporation of very large (more than 10 megabases) DNA fragments into cells and embryos without the need for cloned sequences.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richa, J -- Lo, C W -- New York, N.Y. -- Science. 1989 Jul 14;245(4914):175-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, University of Pennsylvania, Philadelphia 19104.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2749254" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blastocyst ; Cell Line ; Centromere ; *Chromosomes, Human ; DNA/*genetics ; Humans ; Metaphase ; Mice ; *Mice, Transgenic ; Microinjections ; Nucleic Acid Hybridization ; Ovum ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 151
    Publication Date: 1989-09-08
    Description: Overlapping complementary DNA clones were isolated from epithelial cell libraries with a genomic DNA segment containing a portion of the putative cystic fibrosis (CF) locus, which is on chromosome 7. Transcripts, approximately 6500 nucleotides in size, were detectable in the tissues affected in patients with CF. The predicted protein consists of two similar motifs, each with (i) a domain having properties consistent with membrane association and (ii) a domain believed to be involved in ATP (adenosine triphosphate) binding. A deletion of three base pairs that results in the omission of a phenylalanine residue at the center of the first predicted nucleotide-binding domain was detected in CF patients.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Riordan, J R -- Rommens, J M -- Kerem, B -- Alon, N -- Rozmahel, R -- Grzelczak, Z -- Zielenski, J -- Lok, S -- Plavsic, N -- Chou, J L -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1066-73.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2475911" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Biological Transport ; Cloning, Molecular/methods ; Cystic Fibrosis/*genetics/metabolism/pathology ; Cystic Fibrosis Transmembrane Conductance Regulator ; DNA/*isolation & purification ; *Genes ; *Genes, Recessive ; Humans ; Ion Channels/pathology ; Membrane Proteins/*genetics/isolation & purification ; Molecular Sequence Data ; Peptides/*genetics/isolation & purification ; Sequence Homology, Nucleic Acid ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 152
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1245-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479984" target="_blank"〉PubMed〈/a〉
    Keywords: Americas/epidemiology ; Disease Outbreaks/*history ; History, 15th Century ; History, 16th Century ; History, 17th Century ; Humans ; Indians, North American/*history ; Indians, South American/*history ; Population
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 153
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):576, 578.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814484" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Costs and Cost Analysis ; DNA/*genetics ; Human Genome Project/*economics ; Humans ; *Information Systems ; *Internationality ; Japan ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 154
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1438-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781288" target="_blank"〉PubMed〈/a〉
    Keywords: *Base Sequence ; *Chromosome Mapping ; *Chromosomes, Human ; Federal Government ; Humans ; Research Design/standards
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 155
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-04-28
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Apr 28;244(4903):424-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2717935" target="_blank"〉PubMed〈/a〉
    Keywords: *Base Sequence ; *Chromosome Mapping ; *Chromosomes, Human ; DNA/radiation effects ; DNA Probes ; Fluorescent Dyes ; Humans ; Nucleic Acid Hybridization
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 156
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-12
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 May 12;244(4905):655-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2717944" target="_blank"〉PubMed〈/a〉
    Keywords: *Base Sequence ; *Chromosome Mapping ; *Chromosomes, Human ; *Computers ; Dna ; Humans ; Information Systems
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 157
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):734.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2916123" target="_blank"〉PubMed〈/a〉
    Keywords: *Genetic Engineering ; Humans ; Jurisprudence ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 158
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):481-2.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911754" target="_blank"〉PubMed〈/a〉
    Keywords: Brain/*physiology ; *Computer Simulation ; *Computers ; Humans ; Neurons/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 159
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Jan 27;243(4890):473.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911753" target="_blank"〉PubMed〈/a〉
    Keywords: Humans ; *Legislation, Medical ; National Institutes of Health (U.S.) ; *Transfection ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 160
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Mar 10;243(4896):1280-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922610" target="_blank"〉PubMed〈/a〉
    Keywords: Child ; *Fruit ; Humans ; Pesticide Residues/*adverse effects ; United States ; *Vegetables
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 161
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Mar 3;243(4895):1134-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2922602" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Induced ; *Advisory Committees ; DNA, Recombinant ; *Ethics, Medical ; Federal Government ; Genetic Engineering ; Genetic Markers ; *Genetic Therapy ; Humans ; Legislation, Medical ; National Institutes of Health (U.S.) ; Transfection ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 162
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Mar 17;243(4897):1430.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928776" target="_blank"〉PubMed〈/a〉
    Keywords: Humans ; Pesticide Residues/*toxicity ; Risk Factors ; Succinates/*toxicity ; United States ; United States Environmental Protection Agency
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 163
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-20
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Jan 20;243(4889):306-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911742" target="_blank"〉PubMed〈/a〉
    Keywords: California ; *Carcinogens ; Environmental Exposure ; Environmental Pollutants/*toxicity ; Ethanol ; Humans ; Legislation as Topic ; Plants, Toxic ; Tobacco
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 164
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Jan 13;243(4888):167-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911730" target="_blank"〉PubMed〈/a〉
    Keywords: *Chromosome Mapping ; *Chromosomes, Human ; *Genes ; Humans ; National Institutes of Health (U.S.) ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 165
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-18
    Description: Polarized epithelial cells play fundamental roles in the ontogeny and function of a variety of tissues and organs in mammals. The morphogenesis of a sheet of polarized epithelial cells (the trophectoderm) is the first overt sign of cellular differentiation in early embryonic development. In the adult, polarized epithelial cells line all body cavities and occur in tissues that carry out specialized vectorial transport functions of absorption and secretion. The generation of this phenotype is a multistage process requiring extracellular cues and the reorganization of proteins in the cytoplasm and on the plasma membrane; once established, the phenotype is maintained by the segregation and retention of specific proteins and lipids in distinct apical and basal-lateral plasma membrane domains.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rodriguez-Boulan, E -- Nelson, W J -- GM 35527/GM/NIGMS NIH HHS/ -- GM-34107/GM/NIGMS NIH HHS/ -- HL-37675/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Aug 18;245(4919):718-25.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology and Anatomy, Cornell University Medical College, New York, NY 10021.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672330" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Membrane/physiology ; Embryo, Mammalian ; Epithelial Cells ; Epithelium/*physiology/ultrastructure ; Humans ; Membrane Lipids/physiology ; Membrane Proteins/physiology ; Morphogenesis ; Organelles/physiology ; *Phenotype
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 166
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roe, K E -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):563.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814480" target="_blank"〉PubMed〈/a〉
    Keywords: Accidents ; Humans ; *Information Systems ; Nuclear Reactors ; Pennsylvania ; Risk Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 167
    Publication Date: 1989-09-01
    Description: Phenotypic heterogeneity in the repetitive portion of a human malaria circumsporozoite (CS) protein, a major target of candidate vaccines, has been found. Over 14% of clinical cases of uncomplicated Plasmodium vivax malaria at two sites in western Thailand produced sporozoites immunologically distinct from previously characterized examples of the species. Monoclonal antibodies to the CS protein of other P. vivax isolates and to other species of human and simian malarias did not bind to these nonreactive sporozoites, nor did antibodies from monkeys immunized with a candidate vaccine made from the repeat portion of a New World CS protein. The section of the CS protein gene between the conserved regions I and II of a nonreactive isolate contained a nonapeptide repeat, Ala-Asn-Gly-Ala-Gly-Asn-Gln-Pro-Gly, identical at only three amino acid positions with published nonapeptide sequences. This heterogeneity implies that a P. vivax vaccine based on the CS protein repeat of one isolate will not be universally protective.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosenberg, R -- Wirtz, R A -- Lanar, D E -- Sattabongkot, J -- Hall, T -- Waters, A P -- Prasittisuk, C -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):973-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Entomology, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2672336" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, Surface/*genetics ; Base Sequence ; Gene Amplification ; *Genes ; Humans ; Malaria/parasitology ; Molecular Sequence Data ; Phenotype ; Plasmodium vivax/*genetics/growth & development ; *Protozoan Proteins ; Repetitive Sequences, Nucleic Acid ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 168
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roth, E Jr -- Kaul, D K -- Nagel, R L -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1051.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686026" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Adhesion ; Erythrocytes/cytology/*parasitology ; Humans ; Malaria/*blood ; Plasmodium falciparum/pathogenicity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 169
    Publication Date: 1989-06-23
    Description: Adipsin is a serine protease that is secreted by adipocytes into the bloodstream; it is deficient in several animal models of obesity, representing a striking example of defective gene expression in this disorder. Recombinant mouse adipsin was purified and its biochemical and enzymatic properties were studied in order to elucidate the function of this protein. Activated adipsin has little or no proteolytic activity toward most substrates but has the same activity as human complement factor D, cleaving complement factor B when it is complexed with activated complement component C3. Like authentic factor D, adipsin can activate the alternative pathway of complement, resulting in red blood cell lysis. Decreased (58 to 80 percent) complement factor D activity, relative to lean controls, was observed as a common feature of several experimental models of obesity, including the ob/ob, db/db, and monosodium glutamate (MSG)-injected mouse and the fa/fa rat. These results suggest that adipsin and the alternative pathway of complement may play an unexpected but important role in the regulation of systemic energy balance in vivo.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rosen, B S -- Cook, K S -- Yaglom, J -- Groves, D L -- Volanakis, J E -- Damm, D -- White, T -- Spiegelman, B M -- DK31403/DK/NIDDK NIH HHS/ -- DK34605/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 23;244(4911):1483-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2734615" target="_blank"〉PubMed〈/a〉
    Keywords: Adipose Tissue/metabolism ; Amino Acid Sequence ; Animals ; Cell Line ; Complement Activating Enzymes/*metabolism ; Complement Factor D/*metabolism ; Complement Pathway, Alternative ; Cricetinae ; DNA/genetics ; Gene Expression Regulation ; Humans ; Immunoblotting ; Mice ; Molecular Sequence Data ; Obesity/genetics/*immunology/metabolism ; RNA, Messenger/metabolism ; Recombinant Proteins ; Serine Endopeptidases/genetics/isolation & purification/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 170
    Publication Date: 1989-09-08
    Description: An understanding of the basic defect in the inherited disorder cystic fibrosis requires cloning of the cystic fibrosis gene and definition of its protein product. In the absence of direct functional information, chromosomal map position is a guide for locating the gene. Chromosome walking and jumping and complementary DNA hybridization were used to isolate DNA sequences, encompassing more than 500,000 base pairs, from the cystic fibrosis region on the long arm of human chromosome 7. Several transcribed sequences and conserved segments were identified in this cloned region. One of these corresponds to the cystic fibrosis gene and spans approximately 250,000 base pairs of genomic DNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rommens, J M -- Iannuzzi, M C -- Kerem, B -- Drumm, M L -- Melmer, G -- Dean, M -- Rozmahel, R -- Cole, J L -- Kennedy, D -- Hidaka, N -- DK34944/DK/NIDDK NIH HHS/ -- DK39690/DK/NIDDK NIH HHS/ -- N01-CO-74102/CO/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 8;245(4922):1059-65.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772657" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cattle ; Chickens ; *Chromosome Mapping ; *Chromosomes, Human, Pair 7 ; Cloning, Molecular/methods ; Cricetinae ; Cystic Fibrosis/*genetics ; DNA Probes ; Genes, Overlapping ; *Genes, Recessive ; Genetic Markers ; Humans ; Mice ; Nucleic Acid Hybridization ; Restriction Mapping/methods
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 171
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: The goals of providing coverage for everyone in the United States and controlling the growth in national health expenditures require difficult decisions about what medical services to provide. Currently accepted practices vary enormously in the amount of health they produce for a given expenditure. Studies of the health effects of several major interventions in relation to their costs--Pap smears, mammography, coronary care units, bypass surgery, and cholesterol reduction--indicate the kinds of choices to be made.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Russell, L B -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):892-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Health Care Policy, and Aging Research, Rutgers University, New Brunswick, NJ 08903.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510299" target="_blank"〉PubMed〈/a〉
    Keywords: Cost-Benefit Analysis ; Costs and Cost Analysis ; Humans ; *National Health Insurance, United States/economics ; *Resource Allocation ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 172
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-08-11
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sagan, L A -- New York, N.Y. -- Science. 1989 Aug 11;245(4918):574, 621.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Electric Power Research Institute, Palo Alto, CA 94303.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2669125" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; DNA/radiation effects ; DNA Repair/radiation effects ; Dose-Response Relationship, Radiation ; Humans ; *Radiation Effects ; Radiation Injuries ; Risk Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 173
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: Tumor suppressor genes are wild-type alleles of genes that play regulatory roles in cell proliferation, differentiation, and other cellular and systemic processes. It is their loss or inactivation that is oncogenic. The first evidence of tumor suppressor genes appeared in the early 1970s, but only within the past few years has a wealth of new information illuminated the central importance of these genes. Two or more different suppressor genes may be inactivated in the same tumors, and the same suppressors may be inactive in different tumor types (for example, lung, breast, and colon). The suppressor genes already identified are involved in cell cycle control, signal transduction, angiogenesis, and development, indicating that they contribute to a broad array of normal and tumor-related functions. It is proposed that tumor suppressor genes provide a vast untapped resource for anticancer therapy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sager, R -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1406-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Cancer Genetics, Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2574499" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; Cell Differentiation ; Cell Division ; Cell Transformation, Neoplastic/genetics ; Chromosome Aberrations ; Cloning, Molecular ; Eye Neoplasms/genetics ; Heterozygote ; Humans ; Hybrid Cells ; Kidney Neoplasms/genetics ; Mutation ; Neoplasms/*genetics ; Oncogene Proteins/genetics ; Phosphoproteins/genetics ; Polymorphism, Restriction Fragment Length ; Retinoblastoma/genetics ; Suppression, Genetic/*genetics ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53 ; Wilms Tumor/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 174
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-26
    Description: T cell receptors are the antigen-recognizing elements found on the effector cells of the immune system. Two isotypes have been discovered, TCR-gamma delta and TCR-alpha beta, which appear in that order during ontogeny. The maturation of prothymocytes that colonize the thymic rudiment at defined gestational stages occurs principally within the thymus, although some evidence for extrathymic maturation also exists. The maturation process includes the rearrangement and expression of the T cell receptor genes. Determination of these mechanisms, the lineages of the cells, and the subsequent thymic selection that results in self-tolerance is the central problem in developmental immunology and is important for the understanding of autoimmune diseases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Strominger, J L -- New York, N.Y. -- Science. 1989 May 26;244(4907):943-50.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biology, Harvard University, Cambridge, MA 02138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658058" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, T-Lymphocyte/analysis ; Gene Expression Regulation ; Humans ; Receptors, Antigen, T-Cell/genetics/immunology/*physiology ; T-Lymphocytes/*immunology ; Thymus Gland/embryology/*growth & development/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 175
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-31
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, M -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1656-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928799" target="_blank"〉PubMed〈/a〉
    Keywords: Autoanalysis ; *Base Sequence ; *Chromosome Mapping ; *Chromosomes, Human ; Humans ; Japan ; Research Support as Topic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 176
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-09
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, M -- New York, N.Y. -- Science. 1989 Jun 9;244(4909):1134.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2727698" target="_blank"〉PubMed〈/a〉
    Keywords: *Decompression Sickness ; Humans ; *International Cooperation ; Seychelles ; Ussr ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 177
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fischer, R -- New York, N.Y. -- Science. 1989 Mar 24;243(4898):1536.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928786" target="_blank"〉PubMed〈/a〉
    Keywords: Body Composition ; *Energy Metabolism ; Female ; Humans ; Male ; *Sex Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 178
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-17
    Description: Changes in social behavior were a key aspect of human evolution, and yet it is notoriously difficult for paleobiologists to determine patterns of social evolution. By defining the limited number of distributional strategies available to members of each sex of any species and investigating the conditions under which they may occur and change, the social behavior of different hominid taxa may be reconstructed.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foley, R A -- Lee, P C -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):901-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Cambridge, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2493158" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Behavior ; *Biological Evolution ; Female ; Haplorhini/genetics ; Hominidae/*genetics ; Humans ; Male ; Models, Genetic ; *Social Behavior
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 179
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foster, K R -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):431.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814470" target="_blank"〉PubMed〈/a〉
    Keywords: Electricity/*adverse effects ; Humans ; *Magnetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 180
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Franklin, N C -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):11-2.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911712" target="_blank"〉PubMed〈/a〉
    Keywords: Aerosols ; *Biological Warfare ; *Ethics, Professional ; Genetic Engineering ; Government Agencies ; Humans ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 181
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-06-16
    Description: Current therapies for most human genetic diseases are inadequate. In response to the need for effective treatments, modern molecular genetics is providing tools for an unprecedented new approach to disease treatment through an attack directly on mutant genes. Recent results with several target organs and gene transfer techniques have led to broad medical and scientific acceptance of the feasibility of this "gene therapy" concept for disorders of the bone marrow, liver, and central nervous system; some kinds of cancer; and deficiencies of circulating enzymes, hormones, and coagulation factors. The most well-developed models involve alteration of mutant target genes by gene transfer with recombinant pathogenic viruses in order to express new genetic information and to correct disease phenotypes--the conversion of the swords of pathology into the plowshares of therapy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Friedmann, T -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2660259" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bone Marrow/physiology ; Brain/physiology ; Ethics, Medical ; Gene Expression Regulation ; Genetic Diseases, Inborn ; Genetic Therapy/*methods/trends ; Genetic Vectors ; Humans ; Liver/physiology ; Neoplasms/genetics ; Risk Assessment ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 182
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Frisch, R E -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):432.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814472" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Animals ; Body Weight/*physiology ; Cricetinae ; Female ; Fertility/*physiology ; Humans ; Mesocricetus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 183
    Publication Date: 1989-11-24
    Description: Drug development is needed to improve chemotherapy of patients with locally advanced or metastatic colon carcinoma, who otherwise have an unfavorable prognosis. DNA topoisomerase I, a nuclear enzyme important for solving topological problems arising during DNA replication and for other cellular functions, has been identified as a principal target of a plant alkaloid 20(S)-camptothecin. Significantly increased concentrations of this enzyme, compared to that in normal colonic mucosa, were found in advanced stages of human colon adenocarcinoma and in xenografts of colon cancer carried by immunodeficient mice. Several synthetic analogs of camptothecin, selected by tests with the purified enzyme and tissue-culture screens, were evaluated in the xenograft model. Unlike other anticancer drugs tested, 20(RS)-9-amino-camptothecin (9-AC) induced disease-free remissions. The overall drug toxicity was low and allowed for repeated courses of treatment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Giovanella, B C -- Stehlin, J S -- Wall, M E -- Wani, M C -- Nicholas, A W -- Liu, L F -- Silber, R -- Potmesil, M -- CA-11655/CA/NCI NIH HHS/ -- CA-16087/CA/NCI NIH HHS/ -- CA-349636/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1046-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Stehlin Foundation for Cancer Research, St. Joseph Hospital, Houston, TX 77002.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555920" target="_blank"〉PubMed〈/a〉
    Keywords: Adenocarcinoma/analysis/*drug therapy/enzymology ; Animals ; Antineoplastic Agents/*therapeutic use ; Biomarkers, Tumor/analysis ; Camptothecin/*analogs & derivatives/*therapeutic use/toxicity ; Colonic Neoplasms/analysis/*drug therapy/enzymology ; DNA Topoisomerases, Type I/analysis ; DNA, Neoplasm/analysis ; Drug Design ; Humans ; Intestinal Mucosa/enzymology ; Mice ; Mice, Inbred Strains ; Neoplasm Transplantation ; *Topoisomerase I Inhibitors ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 184
    Publication Date: 1989-09-22
    Description: Sera from patients with autoimmune diseases often contain antibodies that bind ribonucleoproteins (RNPs). Sera from 30 such patients were found to immunoprecipitate ribonuclease P (RNase P), an RNP enzyme required to process the 5' termini of transfer RNA transcripts in nuclei and mitochondria of eukaryotic cells. All 30 sera also immunoprecipitated the nucleolar Th RNP, indicating that the two RNPs are structurally related. Nucleotide sequence analysis of the Th RNP revealed it was identical to the RNA component of the mitochondrial RNA processing enzyme known as RNase MRP. Antibodies that immunoprecipitated the Th RNP selectively depleted murine and human cell extracts of RNase MRP activity, indicating that the Th and RNase MRP RNPs are identical. Since RNase P and RNase MRP are not associated with each other during biochemical purification, we suggest that these two RNA processing enzymes share a common autoantigenic polypeptide.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gold, H A -- Topper, J N -- Clayton, D A -- Craft, J -- AI 26853/AI/NIAID NIH HHS/ -- GM 33088-19/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1377-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Yale University School of Medicine, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2476849" target="_blank"〉PubMed〈/a〉
    Keywords: *Autoantigens ; Base Sequence ; Cell Nucleus/enzymology ; *Endoribonucleases/analysis/immunology ; Humans ; Mitochondria/enzymology ; Molecular Sequence Data ; RNA/analysis ; *RNA Processing, Post-Transcriptional ; Ribonuclease P ; *Ribonucleoproteins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 185
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-07-07
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hartigan, J -- Wigdor, A -- New York, N.Y. -- Science. 1989 Jul 7;245(4913):14.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2740906" target="_blank"〉PubMed〈/a〉
    Keywords: *Aptitude Tests ; Civil Rights ; *Employment ; Humans ; Minority Groups ; *Personnel Management ; *Personnel Selection ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 186
    Publication Date: 1989-05-05
    Description: Interleukin-2 (IL-2) binds to two distinct receptor molecules, the IL-2 receptor alpha (IL-2R alpha, p55) chain and the newly identified IL-2 receptor beta (IL-2R beta, p70-75) chain. The cDNA encoding the human IL-2R beta chain has now been isolated. The overall primary structure of the IL-2R beta chain shows no apparent homology to other known receptors. Unlike the IL-2R alpha chain, the IL-2R beta chain has a large cytoplasmic region in which a functional domain (or domains) mediating an intracellular signal transduction pathway (or pathways) may be embodied. The cDNA-encoded beta chain binds and internalizes IL-2 when expressed on T lymphoid cells but not fibroblast cells. Furthermore, the cDNA gives rise to the generation of high-affinity IL-2 receptor when co-expressed with the IL-2R alpha chain cDNA.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hatakeyama, M -- Tsudo, M -- Minamoto, S -- Kono, T -- Doi, T -- Miyata, T -- Miyasaka, M -- Taniguchi, T -- New York, N.Y. -- Science. 1989 May 5;244(4904):551-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Molecular and Cellular Biology, Osaka University, Japan.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2785715" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; *Cloning, Molecular ; Cross-Linking Reagents ; DNA/*genetics/isolation & purification ; Fibroblasts/metabolism ; Gene Expression Regulation ; Humans ; Interleukin-2/metabolism ; Leukemia ; Molecular Sequence Data ; Nucleic Acid Hybridization ; RNA, Messenger/genetics ; Receptors, Interleukin-2/*genetics/metabolism ; Recombinant Proteins ; Sequence Homology, Nucleic Acid ; Signal Transduction ; Succinimides ; T-Lymphocytes/metabolism ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 187
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-03-31
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Mar 31;243(4899):1658-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2928801" target="_blank"〉PubMed〈/a〉
    Keywords: *Expert Testimony ; Hazardous Substances/*adverse effects ; Humans ; *Jurisprudence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 188
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-02-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):730-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2916120" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Induced/*psychology ; Behavioral Research ; Federal Government ; Female ; Humans ; *Pregnant Women
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 189
    Publication Date: 1989-06-16
    Description: Antibodies that enhance human immunodeficiency virus (HIV) infectivity have been found in the blood of infected individuals and in infected or immunized animals. These findings raise serious concern for the development of a safe vaccine against acquired immunodeficiency syndrome. To address the in vivo relevance and mechanism of this phenomenon, antibody-dependent enhancement of HIV infectivity in peripheral blood macrophages, lymphocytes, and human fibroblastoid cells was studied. Neither Leu3a, a monoclonal antibody directed against the CD4 receptor, nor soluble recombinant CD4 even at high concentrations prevented this enhancement. The addition of monoclonal antibody to the Fc receptor III (anti-FcRIII), but not of antibodies that react with FcRI or FcRII, inhibited HIV type 1 and HIV type 2 enhancement in peripheral blood macrophages. Although enhancement of HIV infection in CD4+ lymphocytes could not be blocked by anti-FcRIII, it was inhibited by the addition of human immunoglobulin G aggregates. The results indicate that the FcRIII receptor on human macrophages and possibly another Fc receptor on human CD4+ lymphocytes mediate antibody-dependent enhancement of HIV infectivity and that this phenomenon proceeds through a mechanism independent of the CD4 protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Homsy, J -- Meyer, M -- Tateno, M -- Clarkson, S -- Levy, J A -- AI-26471/AI/NIAID NIH HHS/ -- R01-AI-24499/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Jun 16;244(4910):1357-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, School of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2786647" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*immunology ; Animals ; Antibodies, Monoclonal ; Antibody-Dependent Cell Cytotoxicity ; Guinea Pigs ; HIV Antibodies/biosynthesis/*immunology ; HIV-1/*immunology ; HIV-2/*immunology ; Humans ; In Vitro Techniques ; Pan troglodytes ; Receptors, Fc/*physiology ; Receptors, HIV ; Receptors, Virus/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 190
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-01
    Description: It is argued that the need to improve science education should be a national priority. Ways are suggested by which the federal government and the scientific community, working together, can address this issue. It is recommended that scientists, engineers, and educators make a significant personal and institutional commitment to participate in science education activities, and that the President of the United States provide the personal leadership to generate a national commitment to the improvement of education at all levels.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Massey, W E -- New York, N.Y. -- Science. 1989 Sep 1;245(4921):915-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Argonne National Laboratory, University of Chicago, IL.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2772643" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Child ; *Education ; Educational Measurement ; Humans ; Schools ; *Science ; Students ; United States ; Universities
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 191
    Publication Date: 1989-02-10
    Description: A genomic sequence and cloned complementary DNA has been identified for a novel receptor-like gene of the PDGF receptor/CSF1 receptor subfamily (platelet-derived growth factor receptor/colony-stimulating factor type 1 receptor). The gene recognized a 6.4-kilobase transcript that was coexpressed in normal human tissues with the 5.3-kilobase PDGF receptor messenger RNA. Introduction of complementary DNA of the novel gene into COS-1 cells led to expression of proteins that were specifically detected with antiserum directed against a predicted peptide. When the new gene was transfected into COS-1 cells, a characteristic pattern of binding of the PDGF isoforms was observed, which was different from the pattern observed with the known PDGF receptor. Tyrosine phosphorylation of the receptor in response to the PDGF isoforms was also different from the known receptor. The new PDGF receptor gene was localized to chromosome 4q11-4q12. The existence of genes encoding two PDGF receptors that interact in a distinct manner with three different PDGF isoforms likely confers considerable regulatory flexibility in the functional responses to PDGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Matsui, T -- Heidaran, M -- Miki, T -- Popescu, N -- La Rochelle, W -- Kraus, M -- Pierce, J -- Aaronson, S -- New York, N.Y. -- Science. 1989 Feb 10;243(4892):800-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2536956" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Cells, Cultured ; *Chromosomes, Human, Pair 4 ; Cloning, Molecular ; DNA/genetics ; Gene Expression Regulation ; *Genes ; Humans ; Molecular Sequence Data ; Multigene Family ; Platelet-Derived Growth Factor/*physiology ; Protein-Tyrosine Kinases/genetics ; RNA, Messenger/genetics ; Receptors, Cell Surface/*genetics ; Receptors, Platelet-Derived Growth Factor ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 192
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McElfresh, K C -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):192.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799381" target="_blank"〉PubMed〈/a〉
    Keywords: Forensic Medicine/*methods ; Humans ; Nucleotide Mapping/*standards ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 193
    Publication Date: 1989-10-20
    Description: The gene (E2A) that codes for proteins with the properties of immunoglobulin enhancer binding factors E12/E47 was mapped to chromosome region 19p13.2-p13.3, a site associated with nonrandom translocations in acute lymphoblastic leukemias. The majority of t(1;19)(q23;p13)-carrying leukemias and cell lines studied contained rearrangements of E2A as determined by DNA blot analyses. The rearrangements altered the E2A transcriptional unit, resulting in the synthesis of a transcript larger than the normal-sized E2A mRNAs in one of the cell lines with this translocation. These observations indicate that the gene for a transcription factor is located at the breakpoint of a consistently recurring chromosomal translocation in many acute leukemias and suggest a direct role for alteration of such factors in the pathogenesis of some malignancies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mellentin, J D -- Murre, C -- Donlon, T A -- McCaw, P S -- Smith, S D -- Carroll, A J -- McDonald, M E -- Baltimore, D -- Cleary, M L -- CA30969/CA/NCI NIH HHS/ -- CA42106/CA/NCI NIH HHS/ -- CA42971/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):379-82.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94025.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799390" target="_blank"〉PubMed〈/a〉
    Keywords: Child ; Chromosome Mapping ; *Chromosomes, Human, Pair 1 ; *Chromosomes, Human, Pair 19 ; DNA-Binding Proteins/*genetics ; Humans ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/*genetics ; Transcription Factors/*genetics ; Translocation, Genetic/*physiology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 194
    Publication Date: 1989-02-17
    Description: Genes and operons that encode bacterial virulence factors are often subject to coordinate regulation. These regulatory systems are capable of responding to various environmental signals that may be encountered during the infectious cycle. For some pathogens, proteins that mediate sensory transduction and virulence control are similar to components of other bacterial information processing systems. Understanding the molecular mechanisms governing global regulation of pathogenicity is essential for understanding bacterial infectious diseases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, J F -- Mekalanos, J J -- Falkow, S -- AI23945/AI/NIAID NIH HHS/ -- AI26195/AI/NIAID NIH HHS/ -- AI26289/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Feb 17;243(4893):916-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology and Immunology, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2537530" target="_blank"〉PubMed〈/a〉
    Keywords: Bacteria/*pathogenicity ; Bacterial Infections/microbiology ; Bordetella pertussis/pathogenicity ; Humans ; Rhizobium/pathogenicity ; Vibrio cholerae/pathogenicity ; Virulence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 195
    Publication Date: 1989-12-08
    Description: The human retinoblastoma gene (RB1) encodes a protein (Rb) of 105 kilodaltons that can be phosphorylated. Analysis of Rb metabolism has shown that the protein has a half-life of more than 10 hours and is synthesized at all phases of the cell cycle. Newly synthesized Rb is not extensively phosphorylated (it is "underphosphorylated") in cells in the G0 and G1 phases but is phosphorylated at multiple sites at the G1/S boundary and in S phase. HL-60 cells that were induced to terminally differentiate by various chemicals lost their ability to phosphorylate newly synthesized Rb at multiple sites when cell growth was arrested. These findings suggest that underphosphorylated Rb may restrict cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mihara, K -- Cao, X R -- Yen, A -- Chandler, S -- Driscoll, B -- Murphree, A L -- T'Ang, A -- Fung, Y K -- 5P30CA14089/CA/NCI NIH HHS/ -- CA 44754/CA/NCI NIH HHS/ -- EY 07846/EY/NEI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1300-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology and Ophthalmology, Childrens Hospital of Los Angeles, CA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588006" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Cycle/*genetics ; Cell Division/drug effects/genetics ; Eye Neoplasms/genetics ; *Gene Expression Regulation, Neoplastic ; Humans ; Interphase/genetics ; Neoplasm Proteins/genetics/*metabolism ; Phosphorylation ; Protein Processing, Post-Translational/drug effects/*genetics ; Retinoblastoma/*genetics ; Tretinoin/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 196
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-05-26
    Description: To function effectively, individuals must voluntarily postpone immediate gratification and persist in goal-directed behavior for the sake of later outcomes. The present research program analyzed the nature of this type of future-oriented self-control and the psychological processes that underlie it. Enduring individual differences in self-control were found as early as the preschool years. Those 4-year-old children who delayed gratification longer in certain laboratory situations developed into more cognitively and socially competent adolescents, achieving higher scholastic performance and coping better with frustration and stress. Experiments in the same research program also identified specific cognitive and attentional processes that allow effective self-regulation early in the course of development. The experimental results, in turn, specified the particular types of preschool delay situations diagnostic for predicting aspects of cognitive and social competence later in life.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mischel, W -- Shoda, Y -- Rodriguez, M I -- New York, N.Y. -- Science. 1989 May 26;244(4907):933-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, Columbia University, New York 10027〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2658056" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptation, Psychological ; Attention ; Child ; *Child Development ; Child, Preschool ; *Cognition ; Female ; *Frustration ; Humans ; *Individuality ; Male ; Reward ; Social Adjustment
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 197
    Publication Date: 1989-09-22
    Description: The human immunodeficiency virus (HIV) binds to CD4-positive cells through interaction of its envelope glycoprotein (gp120) with the CD4 molecule. CD4 is a prominent immunoregulatory molecule, and chronic exposure to antibody against CD4 (anti-CD4) has been shown to cause immunodeficiency in mice. T cell-dependent in vitro immune responses can also be inhibited by anti-CD4. Experimental findings reported here indicate that CD4-bound gp120 attracts gp120-specific antibodies derived from the blood of HIV-seropositive individuals to form a trimolecular complex with itself and CD4. Thus targeted to CD4, the gp120-specific antibody functions as an antibody to CD4; it cross-links and modulates the CD4 molecules and suppresses the activation of T cells as measured by mobilization of intracellular calcium (Ca2i+). The synergism between gp120 and anti-gp120 in blocking T cell activation occurs at low concentrations of both components. Neither gp120 nor anti-gp120 inhibits T cell activation by itself in the concentrations tested.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mittler, R S -- Hoffmann, M K -- New York, N.Y. -- Science. 1989 Sep 22;245(4924):1380-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Bristol-Myers Company, Wallingford, CT 06492.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2571187" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*immunology ; Antigen-Antibody Reactions ; Antigens, Differentiation, T-Lymphocyte/*immunology ; CD4-Positive T-Lymphocytes/*immunology ; Calcium/physiology ; Dose-Response Relationship, Immunologic ; HIV/*immunology ; HIV Antibodies/*immunology ; HIV Antigens/*immunology ; HIV Envelope Protein gp120 ; Humans ; Immunologic Capping ; Lymphocyte Activation ; Receptors, Antigen, T-Cell/immunology ; Retroviridae Proteins/*immunology ; Viral Envelope Proteins/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 198
    Publication Date: 1989-04-21
    Description: The receptor with high affinity for immunoglobulin E (IgE) on mast cells and basophils is critical in initiating allergic reactions. It is composed of an IgE-binding alpha subunit, a beta subunit, and two gamma subunits. The human alpha subunit was expressed on transfected cells in the presence of rat beta and gamma subunits or in the presence of the gamma subunit alone. The IgE binding properties of the expressed human alpha were characteristic of receptors on normal human cells. These results now permit a systematic analysis of human IgE binding and a search for therapeutically useful inhibitors of that binding.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Miller, L -- Blank, U -- Metzger, H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Apr 21;244(4902):334-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Section on Chemical Immunology, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2523561" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, B-Lymphocyte/genetics/*metabolism ; Basophils/*immunology ; Cell Line ; Cloning, Molecular ; Cricetinae ; DNA/genetics ; Humans ; Immunoglobulin E/*metabolism ; Immunosorbent Techniques ; Mast Cells/*immunology ; Rats ; Receptors, Fc/genetics/*metabolism ; Receptors, IgE ; *Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 199
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-01-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Montagna, R A -- New York, N.Y. -- Science. 1989 Jan 6;243(4887):12.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2911713" target="_blank"〉PubMed〈/a〉
    Keywords: HIV Seropositivity ; HTLV-I Antibodies/*analysis ; HTLV-I Infections/*epidemiology ; Humans ; United States ; United States Food and Drug Administration
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 200
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...