ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Inorganic Chemistry  (5,142)
  • Elasticity
  • GEOPHYSICS
  • 1995-1999  (2,121)
  • 1935-1939  (3,373)
Collection
Keywords
Publisher
Language
Years
Year
  • 1
    Unknown
    Mathematical elasticity (1997)
    Amsterdam ; New York : North-Holland
    Details
    Keywords: DDC 531/.381 ; LC QA931 ; Elasticity
    Pages: Online-Ressource (3 v)
    ISBN: 9780444825704
    URL: http://www.sciencedirect.com/science/publication?issn=01682024&volume=27
    Language: English
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    E-BOOK
  • 2
    Electronic Resource
    Electronic Resource
    Thermoelastic Equilibrium of Bodies in Generalized Cylindrical Coordinates (1998)
    Springer
    Georgian mathematical journal 5 (1998), S. 521-544 
    Details
    ISSN: 1572-9176
    Keywords: Elasticity ; thermoelasticity ; transversally isotropic body ; thermoelastic equilibrium
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract Using the method of separation of variables, an exact solution is constructed for some boundary value and boundary-contact problems of thermoelastic equilibrium of one- and multilayer bodies bounded by the coordinate surfaces of generalized cylindrical coordinates ρ, α, z. ρ, α are the orthogonal coordinates on the plane and z is the linear coordinate. The body, occupying the domain Ω = {ρ0 〈 ρ 〈 ρ1, α0 〈 α 〈 α1, 0 〈 z 〈 z 1}, is subjected to the action of a stationary thermal field and surface disturbances (such as stresses, displacements, or their combinations) for z = 0 and z = z 1. Special type homogeneous conditions are given on the remainder of the surface. The elastic body is assumed to be transversally isotropic with the plane of isotropy z = const and nonhomogeneous along z. The same assumption is made for the layers of the multilayer body which contact along z = const.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/B:GEOR.0000008130.94207.f5
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 3
    Electronic Resource
    Electronic Resource
    A Contact Problem of the Interaction of a Semi-Finite Inclusion with a Plate (1999)
    Springer
    Georgian mathematical journal 6 (1999), S. 489-500 
    Details
    ISSN: 1572-9176
    Keywords: Elasticity ; elastic mixtures ; general representations ; integral Fredholm equations ; boundary value problems ; splitted boundary value problems
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract A piece wise-homogeneous plane made up of twodifferent materials and reinforced by an elastic unclusion is considered on a semi-finite section where the different materials join. Vertical and horizontal forces are applied to the inclusion which haz a variable thichness and a variable elasticity modulus. Under certain conditions the problem is reduced to integrodifferential equations of third order. The solution is constructed effectively by applying the methods of theory of analytic functions to a boundary value problem of the Carleman type for a strip. Asymptotic estimates of normal contact stress are obtained.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1022932902050
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 4
    Electronic Resource
    Electronic Resource
    Application of Analogues of General Kolosov–Muskhelishvili Representations in the Theory of Elastic Mixtures (1999)
    Springer
    Georgian mathematical journal 6 (1999), S. 1-18 
    Details
    ISSN: 1572-9176
    Keywords: Elasticity ; elastic mixtures ; general representations ; Fredholm integral equations ; boundary value problems ; splitted boundary value problems
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract The existence and uniqueness of a solution of the first, the second and the third plane boundary value problem are considered for the basic homogeneous equations of statics in the theory of elastic mixtures. Applying the general Kolosov–Muskhelishvili representations from [1], these problems can be split and reduced to the first and the second boundary value problem for an elliptic equation which structurally coincides with the equation of statics of an isotropic elastic body.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1022904308409
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 5
    Electronic Resource
    Electronic Resource
    Point force and edge dislocation in a two-phase anisotropic medium (1996)
    Springer
    Zeitschrift für angewandte Mathematik und Physik 47 (1996), S. 617-630 
    Details
    ISSN: 1420-9039
    Keywords: Elasticity ; composite material ; Green's function ; plane problem ; anisotropy ; point force ; dislocation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics , Physics
    Notes: Abstract Green's functions are derived for the in-plane deformation due to an in-plane point force and edge dislocation acting at a point in a plane of two joined semi-infinite anisotropic plates. The Lekhnitskii's complex potential approach is used, and a general expression of the solutions is obtained in closed-form. Including the case of an isotropic-anisotropic two-phase medium and the case of an isotropic-isotropic two-phase medium, the solutions are given for all possible combinations of materials with either s1 ≠ s2 or S1=s2, where si and s2 are the roots of the characteristic equation of the material.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00914875
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 6
    Electronic Resource
    Electronic Resource
    Green's functions for a point force and dislocation outside an elliptic inclusion in plane elasticity (1996)
    Springer
    Zeitschrift für angewandte Mathematik und Physik 47 (1996), S. 894-905 
    Details
    ISSN: 1420-9039
    Keywords: Elasticity ; Green's function ; inclusion ; plane problem ; point force ; dislocation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics , Physics
    Notes: Abstract The plane elasticity problem of an infinite plate containing an elliptic inclusion is considered. The Green's functions for a point force and/or a dislocation located outside the inclusion are derived. By using the complex potential approach of Muskhelishvili, the general solutions are obtained in a form of carefully selected functions plus an infinite series. The numerical convergence of the solutions is better than that of Stagni-Lizzio's solutions. The proposed solutions can also be applied to the case of a point force and dislocation acting at a point right on the interface.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00920040
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 7
    Electronic Resource
    Electronic Resource
    Elasticity and movements of the cockroach tarsus in walking (1999)
    Springer
    Journal of comparative physiology 185 (1999), S. 157-172 
    Details
    ISSN: 1432-1351
    Keywords: Key words Insect ; Walking ; Elasticity ; Tarsus ; Joints
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Abstract Anatomical, kinematic and ablation studies were performed to evaluate the contribution of elasticity in use of the cockroach tarsus (foot) in walking. The distal tarsus (claws and arolium) engages the substrate during the stance phase of walking by the action of a single muscle, the retractor unguis. Kinematic and ablation studies demonstrated that tarsal disengagement occurs at the end of stance, in part via the action of elastic elements at the penultimate tarsal joint. In isolated legs, this joint exhibits very rapid (less than 20 ms duration) recoil to extension when released from the engaged position, and recoil is even more rapid (less than 10 ms) after removal of the retractor tendon (apodeme). The joint also possesses an enlarged cuticular condyle which is the attachment for ligaments and articular membranes, some of which fulfill morphological criteria consistent with the presence of the elastic protein resilin. Measurements of restoring forces generated by joint displacement indicate that they are graded but could readily lift the mass of the distal tarsus. This biomechanical design can facilitate efficient use of the tarsus in walking while under active control by only a single muscle and may also be highly advantageous when cockroaches very rapidly traverse irregular terrain.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s003590050374
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 8
    Electronic Resource
    Electronic Resource
    Dynamic contour: A texture approach and contour operations (1995)
    Springer
    The visual computer 11 (1995), S. 277-289 
    Details
    ISSN: 1432-2315
    Keywords: Elasticity ; Active contour methods ; Segmentation ; Image processing
    Source: Springer Online Journal Archives 1860-2000
    Topics: Computer Science
    Notes: Abstract The large morphometric variability in biomedical organs requires an accurate fitting method for a pregenerated contour model. We propose a physically based approach to fitting 2D shapes using texture feature vectors and contour operations that allow even automatic contour splitting. To support shrinkage of the contour and obtain a better fit for the concave parts an area force is introduced. When two parts of the active contour approach each other, it divides. The contour undergoing elastic deformation is considered as a set of masses linked by springs with their natural lengths set to zero. We also propose a method for automatic estimation of some model parameters based on a histogram of image forces along a contour.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01898405
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 9
    Electronic Resource
    Electronic Resource
    Three-dimensional shapes of looped DNA (1996)
    Springer
    Meccanica 31 (1996), S. 235-271 
    Details
    ISSN: 1572-9648
    Keywords: DNA double helix ; Thin rod ; Equilibrium ; Kirchhoff's analogy ; Elasticity ; Bifurcation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario Si analizzano le configurazioni di equilibrio di una molecola chiusa di DNA per mezzo di un modello di trave sottile, omogenea, isotropa e linearmente elastica, con sezione circolare. La configurazione di equilibrio di una tale trave, inizialmente rettilinea e poi ritorta, soggetta a forze esterne e momenti solo alle sue estremità, è descritta dalla soluzione di equazioni identiche a quelle che governano il moto di un girostato simmetrico in rotazione intorno ad un punto fisso in un campo gravitazionale (l'analogie di Kirchhoff). Per poter rappresentare l'equilibrio del cappio di DNA, il modello di trave deve essere racchiuso in un anello, Il corrispondente problema al contorno consiste in un sistema di quattro equazioni nonlineari rispetto a quattro parametri. Le soluzioni del problema fuori del piano vengono ottenute tramite l'analisi perturbativa ed una procedura di continuazione al variare di un parametro. Si discutono le modifiche di configurazione del sistema per diversi valori dei parametri.
    Notes: Abstract The equilibrium shapes of a closed DNA are investigated by employing a model of a thin, homogeneous, isotropic, linearly elastic rod of circular cross section. An equilibrium configuration of such an initially straight and twisted rod, submitted to external forces and moments at its ends only, obeys equations identical to those governing the rotation of a symmetric gyrostat spinning about a fixed point in a gravitational field (the Kirchhoff analogy). To represent the equilibrium of the looped DNA, the model rod must be smoothly closed into a ring. The corresponding BVP results in a system of four nonlinear equations with respect to four parameters. The perturbation analysis and the parameter continuation approach are used to find nonplanar solutions. The conformation change is discussed for various values of parameters.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00426990
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 10
    Electronic Resource
    Electronic Resource
    On Variational Approaches to Plate Modes (1997)
    Springer
    Meccanica 32 (1997), S. 143-156 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; Reissner–Mindlin plate theory ; Solid mechanics.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract The three basic functionals of potential energy, complementary energy and Hellinger–Prange–Reissner are usedto obtain a rational derivation of Reissner–Mindlinplate models, starting from the three-dimensional theory.We show that the models so obtained are instances of the same plate theory; nevertheless, due to the different constitutive relations governing their response, they mimic the three-dimensional behaviour in three different manners.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004271405217
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 11
    Electronic Resource
    Electronic Resource
    Equal Curvature and Equal Constraint Cantilevers: Extensions of Euler and Clebsch Formulas (1997)
    Springer
    Meccanica 32 (1997), S. 493-503 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; Equal curvature ; Equal constraint ; Structural mechanics
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract The flexure of cantilevers is one of the early problems, if not the first, to have been studied by the elasticity theoreticians. One considers axisymmetrical rods and rectangular section beams. This investigation concerns the case where the maximum stress is constant (Galilei-Euler-Clebsch problem) as well as the case where the curvature of the medium fiber is constant. For both cases, it is shown that the equations to solve belong to the same class. The research was into thickness distributions replying to those conditions under various loading cases. At the free end, the distributions obtained degenerate into a family for which the thickness is null, but contrary to a widely held opinion, they also and naturally give forms showing a finite thickness at this end. The proposed distributions have a general form which has not been found in the literature treating elasticity theory or strength of materials [1-9]. They are extensions of Euler and Clebsch formulas.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004278131928
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 12
    Electronic Resource
    Electronic Resource
    Two instructive instabilities in non-linear elasticity: Biaxially loaded membrane, and rubber balloons (1996)
    Springer
    Meccanica 31 (1996), S. 387-395 
    Details
    ISSN: 1572-9648
    Keywords: Stability ; Elasticity ; Solid Mechanics
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario I solidi elastici si ‘svergolano’ sotto carichi di compressione, cioè le soluzioni diventano non-univoche e biforcano, e il solido diventa instabile. Fenomeni simili possono avvenire anche in trazione, come qui si mette in evidenza esaminando una membrana quadrata tesa simmetricamente secondo due direzioni: la rottura della simmetria fa perdere unicità alla soluzione. Sotto carico non-simmetrico, le curve carico-deformazione divengono non-monotone, e quindi compare una isteresi che riflette una catastrofe di piegatura, come segnalato per primo da Kearsley [1]. I palloni sottili hanno relazioni raggio-pressione non monotone, il che suggerisce proprietà di stabilità non banali. Si presenta un'analisi di stabilità per due pallon interconnessi, che parte da quelle di Dreyer et al. [2] e Kitsche et al. [3] e le sviluppa.
    Notes: Abstract Elastic bodies buckle under compressive loads, i.e. solutions become non-unique, they bifurcate and the body becomes unstable. Similar phenomena occur in tension as is evidenced here by the symmetric biaxial loading of a square membrane. Symmetry breaking removes the non-uniqueness. Under non-symmetric loading the load-deformation curves become non-monotone, consequently a hysteresis occurs which is the reflection of a fold-type catastrophy. This instructive instability was discovered by Kearsley [1]. Here we investigate it more fully and present some additional aspects. Balloons have non-monotone pressure-radius relations which suggest non-trivial stability properties. A stability analysis is presented for two interconnected balloons. In this we follow — and expand on — the analyses presented by Dreyer et al. [2] and Kitsche et al. [3].
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00429927
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 13
    Electronic Resource
    Electronic Resource
    A note on the optimal state of a binary solid mixture in a stressed elastic bar (1996)
    Springer
    Meccanica 31 (1996), S. 519-525 
    Details
    ISSN: 1572-9648
    Keywords: Bar ; Elasticity ; Phase equilibrium ; Thermomechanics of continua
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario Si considerano le possibili configurazioni di equilibrio di una sbarra composta da una miscela solida di due materiali elastici, posta in posizione verticale e soggetta, oltre al campo gravitazionale, ad una azione, forza o spostamento applicato, in corrispondenza di una estremità. Si suppone che, in ogni sezione trasversale, il modulo di Young della sbarra dipenda solo dal rapporto locale fra i due componenti della miscela in quella sezione e che questa dipendenza soddisfi la diseguaglianza di Paul [2]. Viene mostrato che fra tutte le possibili disposizioni dei due materiali base presenti all'interno del corpo in quantità assegnata, quella che corrisponde ad un minimo per l'energia potenziale prevede che uno dei due componenti si separi dall'altro, concentrandosi in un singolo strato orizzontale. Questo risultato suggerisce che quando un cilindro composito è sottoposto a queste sollecitazioni, i suoi materiali costituenti tenderanno a diffondersi e, alla fine, a separarsi.
    Notes: Abstract We consider the potential energy of the equlibrium configuration under gravity and prescribed vertical forces or displacement of a vertical bar which is composed of a mixture of two elastic materials. It is supposed that in each horizontal cross section the mixture has an effective Young's modulus which depends only on the ratio of the two materials in that cross section, and that the dependence satisfies the bound of Paul [2]. It is shown that among all arrangements of the constituents with a given volume fraction, the smallest potential energy is attained when one of the materials is segregated in a single horizontal layer. This result suggests that when a composite cylinder is kept in such a state of strain, its constituent material will eventually diffuse into this segregated state.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00420823
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 14
    Electronic Resource
    Electronic Resource
    On Small-Displacement Waves in Prestressed Bodies with Isotropic Incremental Elasticity Tensor (1997)
    Springer
    Meccanica 32 (1997), S. 505-514 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; Linear theory ; Residual stresses ; Waves motions in solids ; Mechanics of solids.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract We consider a body at rest in a prestressed configurationκwhich responds elastically to small incremental displacements fromκthe incremental elasticity tensor is supposed isotropic. On the basis of the paper [1] we characterize the conditions for the propagation of longitudinal, transverse, and oblique small-displacement waves superimposed toκFormulae for the propagation speeds of these waves are written in terms of the prestress components and Lamparameters. The amplitudes of longitudinal and transverse waves are eigenvectors for the prestress.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004238416907
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 15
    Electronic Resource
    Electronic Resource
    Transverse Decay of Solutions in an Elastic Cylinder (1998)
    Springer
    Meccanica 33 (1998), S. 577-585 
    Details
    ISSN: 1572-9648
    Keywords: Circular cylinder ; Transverse decay ; Elasticity
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract In a semi‐infinite cylinder composed of anisotropic linearised elastic material, loaded on the base and clamped along the lateral surface, it is known that the solution as measured, for example, by the strain‐energy flux through a plane cross‐ection decays longitudinally at most exponentially with respect to the axial distance from the base. There is, however, also a transverse radial decay of the solution, again measured for example by the strain‐energy, occurring from the region close to the cylinder's axis to the region near the lateral surface, where the energy vanishes. This problem is considered in the present paper which discusses a circular semi‐infinite cylinder and derives an estimate for the strain‐energy contained in a cylindrical annulus at a given distance from the base and of variable height, and whose outer surface coincides with the lateral surface of the cylinder. It is shown that the strain‐energy decays at most algebraically to zero as the inner radius of the annulus increases to that of the cylinder. Sommario. E'noto che in un cilindro semi‐infinito composto da materiale elastico lineare anisotropo, caricato sulla base ed incastrato lungo la superficie laterale, la soluzione elastica, misurata, per esempio, dal flusso di energia di deformazione attraverso una sezione trasversale piana, decade con legge al più esponenziale con la distanza dalla base. C'è tuttavia, anche un decadimento radiale della soluzione, misurato, per esempio, dall'energia di deformazione che passa dalla regione vicina all'asse del cilindro a quella vicin alla superficie laterale dove l'energia si annulla Questo problema è qui studiato. Si discute in particolare un cilindro circolare semi‐infinito e si deduce una stima per l'energia di deformazione contenuta in un anello cilindrico ad una distanza assegnata dalla base e di altezza variabile, e la cui superficie esterna coincide con la superficie laterale del cilindro. Si dimostra che l'energia di deformazione decade al più con legge algebrica a zero quando il raggio interno del cilindro si avvicina a quello esterno.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004343004833
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 16
    Electronic Resource
    Electronic Resource
    On the first stationary boundary-value problem of elasticity in weighted Sobolev spaces in exterior domains of R3 (1996)
    Springer
    Applied mathematics & optimization 34 (1996), S. 183-190 
    Details
    ISSN: 1432-0606
    Keywords: Elasticity ; Exterior domains ; First boundary-value problem ; Weighted Sobolev spaces ; Stokes problem ; 35 ; 73 ; 76
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract This paper solves the first boundary-value problem of elasticity both in interior and exterior domains ofR 3. The equations are set in weighted Sobolev spaces for exterior domains that describe the decay of the functions at infinity. The results established include existence, regularity, and convergence of iterations of the solution.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01182623
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 17
    Electronic Resource
    Electronic Resource
    Modeling elastic properties of microtubule tips and walls (1998)
    Springer
    European biophysics journal 27 (1998), S. 501-513 
    Details
    ISSN: 1432-1017
    Keywords: Key words Microtubule ; Elasticity ; Competing curvatures
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Physics
    Notes: Abstract Electron micrographs of tips of growing and shrinking microtubules are analyzed and interpreted. The many shapes observed are all consistent with a simple mechanical model, a flexible tube with competing intrinsic curvatures. Observations are also consistent with growing and shrinking microtubules having the same intrinsic curvature for protofilaments, the one observed in oligomers peeling off shrinking microtubules. If this is so, the lateral bonds between protofilaments are responsible for the difference between shapes of tips on growing and shrinking microtubules.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002490050160
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 18
    Electronic Resource
    Electronic Resource
    Structural mechanics of carbon nanotubes: From continuum elasticity to atomistic fracture (1996)
    Springer
    Journal of computer-aided materials design 3 (1996), S. 173-182 
    Details
    ISSN: 1573-4900
    Keywords: Nanotechnology ; Fullerenes ; Fibers ; Elasticity ; Fracture ; Simulations
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Summary Motivated by recent observations of bent, collapsed and twisted carbon nanotubes, we investigate their behavior at large deformations. These hollow molecules behave remarkably similar to their macroscopic homologs. They reversibly switch into different morphological patterns, and each shape change corresponds to an abrupt release of energy and a singularity in the stress-strain curve. These transformations, simulated using a realistic many-body potential, are accurately described by a continuum-shell model. In contrast, a response to axial tension proceeds smoothly up to a fracture threshold, beyond which a monoatomic carbon chain unravels between the tube fragments.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01185652
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 19
    Electronic Resource
    Electronic Resource
    A method based on singularity theory to predict edge delamination of laminates (1999)
    Springer
    International journal of fracture 100 (1999), S. 105-120 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; composite materials ; delamination.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract Delamination starting from a stress free edge is the main mode of failure of cross-ply laminates. The analysis of singularities and resulting stress concentrations at interfaces along these edges are not sufficient to provide a satisfying model of onset mechanisms. In particular, the model is by far less sensitive to the layers thickness than observed in traction experiments. A refined asymptotic process is proposed which takes into account the existence of surface flaws (micro-cracks or notches). Numerical results prove that this model is much more in agreement with the experiments. Moreover, the knowledge of the interface toughness, in addition with the experiments, allows to estimate a characteristic fracture length, a kind of process zone. It is a material property and in a first approximation it arises to be of the same order of magnitude than the characteristic inhomogeneity length of the components, i.e. the fibers diameter.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1018382422833
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 20
    Electronic Resource
    Electronic Resource
    Elasticity of an upper mantle clinopyroxene (1998)
    Springer
    Physics and chemistry of minerals 26 (1998), S. 7-13 
    Details
    ISSN: 1432-2021
    Keywords: Key words Pyroxene ; Elasticity ; Monoclinic ; Systematics ; ISS
    Source: Springer Online Journal Archives 1860-2000
    Topics: Chemistry and Pharmacology , Geosciences , Physics
    Notes: Abstract  The ambient pressure elastic properties of a natural clinopyroxene (C2/c symmetry) from Kilbourne Hole, NM have been determined. In terms of end-members, diopside (CaMgSi2O6), hedenbergite (CaFeSi2O6), jadeite (NaAlSi2O6), cosmochlor (NaCrSi2O6), and Mg-Tschermak (MgAl(AlSi)O6), its composition is Di72He9Jd3Cr3Ts12. The analytic density, based on chemistry and cell parameters is 3.327 (0.003) g/cm3. The elastic constants [c11, c12, c13, c15, c22, c23, c25, c33, c35, c44, c46, c55, c66] are [273.8 (0.9), 83.5 (1.3), 80.0 (1.1), 9.0 (0.6), 183.6 (0.9), 59.9 (1.6), 9.5 (1.0), 229.5 (0.9), 48.1 (0.6), 76.5 (0.9), 8.4 (0.8), 73.0 (0.4), 81.6 (1.0)] GPa where uncertainties are reported at the 95% confidence level. The aggregate (mean of Hashin-Strikman bounds) adiabatic bulk modulus is 117.2 (0.7) GPa, and the shear modulus is 72.2 (0.2) GPa. Although measured moduli are broadly consistent with trends in elasticity versus atomic volume, deviations from the systematics would produce significant (percent level) changes in calculated velocities for candidate mantle mineral assemblages. The compositional dependence of elasticity for several clinopyroxenes is explored on the basis of just the Di+He and Jd+Ts mole fractions. The bulk modulus lies within experimental uncertainties of the linear mixture of end-member properties while the shear modulus deviates by 3%.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002690050156
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 21
    Electronic Resource
    Electronic Resource
    Anisotropic elastic bending models of DNA (1996)
    Springer
    Journal of biological physics 22 (1996), S. 227-243 
    Details
    ISSN: 1573-0689
    Keywords: Anisotropy ; DNA bending ; DNA curvature ; Elasticity ; Finite element methods ; Sequence dependent stiffness
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Physics
    Notes: Abstract Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)n, (tctctaaaaaatatataaaaa)n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)n, (atctaatctaacacaacaca)n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00401875
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 22
    Electronic Resource
    Electronic Resource
    Masthead (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995) 
    Details
    ISSN: 0009-2940
    Keywords: Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280101
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 23
    Electronic Resource
    Electronic Resource
    Tripodal Triamidostannates as Building Blocks in the Generation of Sn - M-Bonded Heterobimetallics (M = Fe, Ru) (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 29-34 
    Details
    ISSN: 0009-2940
    Keywords: Tripodal ligands ; Triamidostannates ; Metal-metal bonds ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: By in situ lithiation of the trifunctional amines H3CC(CH2NHSiMe3)3, PhC(CH2NHSiMe3)3, and HC{SiMe2NH(p-Tolyl)}3 and subsequent reaction with SnCl2 the corresponding triamidostannates were obtained. These were coupled with CpM(CO)2Cl (M = Fe, Ru) to yield the M - Sn-bonded heterobimetallics 9-14 of which H3CC(CH2NSiMe3)3SnFe(CO)2Cp (9) was characterized by a single-crystal X-ray structure analysis. Of the in situ-generated amidostannates only [HC{SiMe2N(p-Tolyl)}3Sn][Li(THF)3] (8) could be isolated as a uniform product and characterized analytically and spectroscopically.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280105
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 24
    Electronic Resource
    Electronic Resource
    The Structures of [X2Y—N—YX2]+ Cations (X = F, Cl; Y = S, Se). A Comparison of X-ray and ab Initio Studies[1] (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 35-40 
    Details
    ISSN: 0009-2940
    Keywords: Selenium-nitrogen compounds ; Sulfur-nitrogen compounds ; Calculations, ab initio ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The structures of cationic species of the series [X2Y—N—YX2]+ (X = F, Cl; Y = S, Se) have been computed ab initio using all electron treatments for first-row elements and sulfur and quasi-relativistic pseudopotentials for Se and Cl. Splitvalence basis sets with polarization and diffuse functions were employed. The MP2 results for the (non-isostructural!) cations [Cl2Se—N—SeCl2]+ (1: Cs) and [F2S—N—SF2]+ (2: C2v) are in excellent agreement with the experimental (X-ray) observations. Both structures represent local minima. A deeper minimum for either of the cations is represented by another C2v isomer which for crystal lattice energy reasons is stable in the isolated state only. The geometries of the hitherto unknown species [Cl2S—N—SCl2]+ (3) and [F2Se—N—SeF2]+ (4) have been assessed by ab initio HF calculations. In analogy to 2, cations 3 and 4 are predicted to prefer C2v symmetry. Therefore, 1 exhibits unusual structural features. According to strictly localized natural bond orbital analysis (NBO), the central nitrogen atoms in 1 and 2 possess two lone pairs of electrons (LP: one sp hybrid and one p orbital). The relatively short Se—N and S—N bond distances in 1 (1.741-1.760 Å) and 2 (1.551 Å) can best be attributed to LP(N)→s̰*(Y—X) negative hyperconjugation (1: Y = Se, X = Cl; 2: Y = S, X = F).
    Additional Material: 8 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280106
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 25
    Electronic Resource
    Electronic Resource
    Die fördernde Rolle von Phosphinoester-Liganden bei der Synthese neutraler Carben-, Vinyliden- und Allenyliden-Ruthenium(II)-KomplexeHerrn Professor Hubert Schmidbaur zum 60. Geburtstag gewidmet. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 49-62 
    Details
    ISSN: 0009-2940
    Keywords: Ruthenium(II) complexes, octahedral ; Phosphino esters as mono- and bidentate ligands ; Fluxional behaviour ; Carbene complexes ; Vinylidene complexes ; Allenylidene complexes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Vinylidene Transition-Metal Complexes, XXXV[1].  -  The Supporting Role of Phosphino Ester Ligands for the Synthesis of Neutral Carbene, Vinylidene and Allenylidene Ruthenium(II) ComplexesThe reaction of [RuCl2(PPh3)3] (1) with the phosphino esters iPr2P(CH2)nCO2R (2-4) leads to complete (n = 1; R = CH3, C2H5) or partial (n = 2; R =CH3) displacement of the PPh3 ligands and formation of the octahedral ruthenium(II) complexes [RuCl2{k2(P,O)-iPr2PCH2CO2R}2] (5, 6) and [RuCl2(PPh3){k(P)-iPr2PCH2CH2CO2Me}{k2(P,O)-iPr2PCH2CH2CO2Me}] (7). Treatment of 5 with LiBr and LiI affords the dibromo- and diiodoruthenium derivatives 8 and 9. While compound 5 reacts with CO and SO2 by cleavage of one Ru - O bond to yield the 1:1 adducts [RuCl2(L){k(P)-iPr2PCH2CO2Me}{k2(P,O)-iPr2PCH2CO2Me}] (10, 11), the reaction of the dibromo derivative 8 with CO in solution gives the dicarbonyl complex [RuBr2(CO)2{k(P)-iPr2PCH2CO2Me}2](13). If CO is passed over 8 in the solid state, the corresponding monocarbonyl compound 14 is formed. The hydridoruthenium(II) complex 16, which is obtained from equimolar amounts of [RuHCl(CO)(PiPr3)2] (15) and 2, reacts with HC≡CMe by insertion to give the vinyl derivative [RuCl{E - CH=CHMe}(CO)(PiPr3){k2(P,O)-iPr2CH2CO2Me}] (17). Treatment of 5 with HC̊' (R' = H, Me, tBu, Ph) and of 6, 8, 9 with HC≡CPh affords upon photochemical activation the octahedral vinylidene complexes [RuX2-(=C=CHR){k(P)-iPr2PCH2CO2R}{k2(P,O)-iPr2PCH2CO2R}] (18-21 and 23-25) in good to excellent yield. At room temperature, these compounds (with the exception of 25) are highly fluxional in solution. From 31P-NMR measurements, the free energies of activation ΔG
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280108
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 26
    Electronic Resource
    Electronic Resource
    Reaktionen von R2Al—AlR2 (R = CH(SiMe3)2) mit Trimethylsilylazid  -  Insertion in die Al—Al-Bindung und Abbau zum trimeren Dialkylaluminiumazid (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 81-85 
    Details
    ISSN: 0009-2940
    Keywords: Aluminium-aluminium bond ; Insertion of trimethylsilyl azide ; Trimeric dialkylaluminium azide ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Reactions of R2Al—AlR2 (R = CH(SiMe3)2) with Trimethylsilyl Azide  -  Insertion into the Al—Al Bond and Formation of a Trimeric Dialkylaluminium AzideTetrakis[bis(trimethylsilyl)methyl]dialuminium(4) (1) reacts with trimethylsilyl azide under insertion of one nitrogen atom into the Al—Al bond. As shown by NMR spectra and crystal structure the product contains three and four coordinated Al atoms due to the coordination of the α-nitrogen atom of the azide group to one of the Al atoms. An electronically delocalized N3-system is formed with a N—N bond length of 132.0 pm and a bond order of 1.5 for both N—N bonds. With an excess of trimethylsilyl azide further reaction is observed only under mild irradiation conditions with an exchange of the azide group between Si and Al and formation of Me6Si2 and the dialkylaluminium azide 3, which is better synthesized by the reaction of Me3Si—N3 with Cl—Al[CH(SiMe3)2]2. The sterically highly shielded aluminium azide 3 is a trimer in the solid state showing a non-planar 12-membered Al3N9 heterocycle with short N—N bonds (114 pm).
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280112
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 27
    Electronic Resource
    Electronic Resource
    Transition-Metal Complexes with the Novel Scorpionate Ligand Dihydrobis-(tetrazolyl)borate: Synthesis and Characterization of Infinite Two-Dimensional Metal-Ligand Frameworks and One-Dimensional Water SubstructuresDedicated to Professor Dr. Herbert Schumann on the occassion of his 60th birthday. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 323-328 
    Details
    ISSN: 0009-2940
    Keywords: Poly(azolyl)borates, metal complexes of ; Bis(tetrazolyl)borate, metal complexes of ; Metal-nitrogen coordination ; Coordination polymers ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Dihydrobis(tetrazolyl)borate metal compounds of the composition [M(L)2{μ-H2B(CHN4)2}2]n for M = Mn, Fe, Co, Zn, Cd with L = H2O and for M = Cu with L = NH3 are obtained from metal salts and K[H2B(CHN4)2]. Single-crystal X-ray studies reveal the formation of two-dimensional rhombic grid sheets through the bridging action of the bis(tetrazolyl)borate ligands. Each metal atom is octahedrally coordinated with two trans L ligands and four H2B(CHN4)-2 nitrogen donors. Two additional, hydrogen-bonded water molecules occupy the rhombic openings in the compounds with M = Mn, Fe, Co, Zn, and Cd. The water of crystallization is held in place through hydrogen bonding from the water ligands and to the nitrogen atoms to give a substructure of parallel kinked water chains. Temperature-variable magnetic measurements show a Curie-Weiss behavior for the paramagnetic complexes with M = Mn, Fe, Co, and Cu.
    Additional Material: 8 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280402
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 28
    Electronic Resource
    Electronic Resource
    New Organophosphorus Ligands: Cyclopropanation and Other Reactions of Cumulenes Bearing Diphenylphosphanyl Substituents (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 365-371 
    Details
    ISSN: 0009-2940
    Keywords: Cumulenes ; Butadienes ; Vinylcyclopropane ; Vinylidenecyclopropane ; Bicyclopropyl, phosphanyl-substituted ; Cyclopropanation ; Phosphane ligands ; Phosphane chalcogenides ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Hydrophosphorylation of 1,4-bis(diphenylphosphanyl)butadiyne with diphenylphosphane leads to the butadiene (Ph2P)2C=CH—CH=C(PPh2)2 (1). Treatment of 1 with dimethylsulfonium methylide gives the vinylcyclopropane (Ph2P)2C=CH—CH(CH2)C(PPh2)2 (2). Compound 2 reacts with aqueous hydrogen peroxide, elemental sulfur, or selenium to afford the tetrachalcogenides (Ph2XP)2C=CH—CH(CH2)C(PXPh2)2 with X = O (3), X = S (4), X = Se (5), respectively. While the tetraphosphane 1 and the vinyl-cyclopropane compound 2 cannot be converted into a bis-(cyclopropyl) compound with an excess of Me2S=CH2, the tetrasulfide 4 readily affords a mixture of (1R,1′R)-/(1S,1′S)-and meso-2,2,2′,2′-tetrakis(diphenylthiophosphinyl)-1,1′-bicyclopropyl (6, 7) in good yield. Treatment of 1,1,4,4-tetrakis-(diphenylphosphanyl)butatriene with dimethylsulfonium methylide leads to the vinylidenecyclopropane (Ph2P)2C=C=C(CH2)C(PPh2)2 (8). Compound 8 is converted into its tetrasulfide (Ph2SP)2C=C=C(CH2)C(PSPh2)2 (9) by treatment with elemental sulfur. The crystal structures of 1, 2, 4, 7, and 8 have been determined by single-crystal X-ray diffraction.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280408
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 29
    Electronic Resource
    Electronic Resource
    Mono- und Diferriophosphane und -thioxophosphoraneHerrn Professor Dr. Ekkehard Lindner zum 60. Geburtstag gewidmet. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 413-416 
    Details
    ISSN: 0009-2940
    Keywords: Ferriophosphanes ; Ferriophosphoranes ; Thioxophosphane ligand ; Decarbonylation reaction ; Sulfurization ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Mono- and Diferriophosphanes and -thioxophosphoranesHerrn Professor Dr. Ekkehard Lindner zum 60. Geburtstag gewidmet.The substitution of organic substituents in phosphanes or thioxophosphoranes by the 17-electron fragments CpFe-(CO)2 (—Fp) leads to isolobal ferriophosphanes or -thioxophosphoranes. The mono- and diferriophosphanes FpnPPh3-n [n = 1 (3), 2 (4)] are obtained by deprotonation of the mono- and diferriophosphonium salts [FpnPPh3-nH]X [n = 1 (1), 2 (2)] with DBU. They are oxidized by sulfur giving the mono- and diferriothioxophosphoranes FpnPPh3-n(S) [n = 1 (5), 2 (6)]. Sulfide 5 arises also from the reaction of CpFe(CO)2Cl and Ph2PH(S)/DBU. The one-sided decarbonylation reaction of 6 leads to FpFp′PPh(S) (7, Fp′ = CpFeCO). The Fp substituents (17 electrons) in 3-7 coordinate as one-electron donors to the PhnP- or PhnP(S) units (n = 1, 2). The bridging functions in 4 and 6 are hitherto unknown. The molecular structures of the complexes 5-7 were determined by X-ray structure analyses.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280413
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 30
    Electronic Resource
    Electronic Resource
    About some Electrophilic Substitution Reactions with [(CF3S)3C+][AsF-6] (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 435-436 
    Details
    ISSN: 0009-2940
    Keywords: Trifluoromethylthio group ; Carbenium ions ; Diphenylmethane ; Dyes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Tris(trifluoromethylthio)carbenium hexafluoroarsenate (1) reacts with N,N-dimethylaniline and anisole to form the corresponding diphenylmethanes 2, 3 with the SCF3 group at the methine carbon atom. During the reaction of 1 with benzene, compounds such as C6H5C(SCF3)3 and C6H5SCF3 are formed along with benzophenone, a product of hydrolysis of the diphenylmethane compound.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280417
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 31
    Electronic Resource
    Electronic Resource
    Synthesis and Structure of the First Dimetalated Diphosphane Disulfide [(η5-C5Me5)(CO)2FeP(H)(S)]2 (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 441-442 
    Details
    ISSN: 0009-2940
    Keywords: Diphosphane disulfides ; Metallophosphoranes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The first transition metal derivative meso-[(η5-C5Me5)(CO)2FeP(H)(S)]2 (2) of the unknown diphosphane disulfide [PH2(S)]2 results from treatment of (η5-C5Me5)(CO)2FePH2 (1) with 1.5 equivalents of elemental sulfur. Compound 2 was characterized by means of spectroscopy (IR, 31P, 31P{1H}, 13C{1H}, 1H NMR) as well as X-ray diffraction analysis.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280419
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 32
    Electronic Resource
    Electronic Resource
    Preparation and Molecular Structures of Tetrahydrofuran, Diethylene Diglycol Dimethyl Ether and 18-Crown-6 Complexes of Strontium and Barium TetrahydridoborateDedicated to Prof. Dr. Nils Wiberg on the occasion of his 60th birthday. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 455-460 
    Details
    ISSN: 0009-2940
    Keywords: Strontium bis(tetrahydridoborate)-2 tetrahydrofuran, chain polymer of ; Strontium bis(tetrahydridoborate)-bis(diglyme) ; Barium bis(tetrahydridoborate)-bis(diglyme) ; Strontium bis(tetrahydridoborate)-1,4,7,13,16-hexaoxacyclooctadecane ; Metal-hydrogen-boron bridges ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The strontium and barium tetrahydridoborate complexes M(BH4)2 · 2 diglyme and M(BH4)2 · 18-crown-6 (M = Sr, Ba) have been prepared from the solvates M(BH4)2 · 2 THF by ligand displacement. 11B-NMR and IR data reveal strongly polar bonding of the BH4 groups to the metal centers, and X-ray structural analyses of the diglyme and crown ether compounds show molecular units in which the BH4 group is in contact via three H atoms with the metal center. In contrast, M(BH4)2 · 2 THF compounds are chain polymers in the solid state, and each metal center is surrounded by 2 THF molecules in trans position and four BH4- groups each of which forms bridges with two metal centers. Estimations of the effective radius for the BH4 group indicate a high polarity for the M-BH4 interaction.
    Additional Material: 4 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280504
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 33
    Electronic Resource
    Electronic Resource
    Photochemische Reaktionen von Übergangsmetall-Organyl-Komplexen mit Olefinen, 1312. Mitteilung: Lit.Photochemisch induzierte [5+2],homo[5+21-Cycloaddition von 3-Hexin an Tricarbonyl(η5-2,4-cycloheptadien-l-yl)mangan (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 515-518 
    Details
    ISSN: 0009-2940
    Keywords: Manganese ; Cycloheptadienyl ; Alkyne ; [5+2],homo[5+2] Cycloadditions ; Tricyclo[5.3.1.04,10]undeca-2,5-dien-11-yl ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Photochemical Reactions of Transition Metal Organyl Complexes with Olefins, 1312. Mitteilung: Lit. . - Photochemically Induced [5+2], homo[5+2] Cycloaddition of 3-Hexyne to Tricarbonyl(η 5-2,4-cycloheptadien-1-yl)manganeseTricarbonyl(η5-2,4-cycloheptadien-1-yl)manganese (1) reacts upon UV irradiation in hexane at 243 K with two equivalents of 3-hexyne (2) in successive [5+2],homo[5+2] cycloadditions to give tricarbonyl(η2:2:1-1,2,3,11-tetraethyltricyclo-[5.3.1.04,10]undeca-2,5-dien-11-yl)manganese (3). Its crystal and molecular structure was determined by an X-ray diffraction analysis, in solution it was studied also by IR and NMR spectroscopy.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280513
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 34
    Electronic Resource
    Electronic Resource
    Masthead (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995) 
    Details
    ISSN: 0009-2940
    Keywords: Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280601
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 35
    Electronic Resource
    Electronic Resource
    1,4,2-Diazaphospholothiazoles and -pyridines by a Hantzsch-Type Condensation Using Chloromethyldichlorophosphane (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 581-587 
    Details
    ISSN: 0009-2940
    Keywords: Anellated azaphospholes ; Hantzsch-type [3 + 2] cyclocondensation ; Chloromethyldichlorophosphane ; Regioselectivity ; 31P-, 1H-, 13C-NMR spectra ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The [3 + 2] cyclocondensation of 2-amino-1,3-thiazoline, 2-aminopyridines, 2- and 4-aminopyrimidines, 2-aminopyrazine, and 2-aminoquinoline with chloromethyldichlorophosphane in the presence of triethylamine yields regiospecifically 5,6-dihydrothiazolo[2,3-e][1,4,2]diazaphosphole (3), 1,4,2-diazaphospholo[4,5-α]pyridines (12), 1,4,2-diazaphospholo[4,5-α]pyrimidines (15), 1,4,2-diazaphospholo[4,5-e]pyrimidine (17), 1,4,2-diazaphospholo[4,5-α]pyrazine (19), and [1,4,2]diazaphospholo[4,5-α]quinoline (22), respectively. Using 2-amino-1,3-thiazole (4) and 2-aminobenzothiazoles 8, we obtained mixtures of the 1,5- and 4,5-anellated 1,4,2-diazaphospholes 5/6, 9a/10a and 9b/10b, while in the case of the methyl derivative 8c only the [1,4,2]diazaphospholo[5,4-b][1,3]benzothiazole 10c was formed. In the reaction of 2-aminothiazole and 2-aminopyrazine with Chloromethyldichlorophosphane the bis(diazaphospholo)-substituted chloromethylphosphanes 7 and 20 could be detected. The new anellated 1,4,2-diazaphospholes are colorless to pale yellow crystalline moisture-sensitive solids.
    Additional Material: 6 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280610
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 36
    Electronic Resource
    Electronic Resource
    Reactions at Silicon-Silicon Bonds, V. Selective Trichlorosilylation of Alkyl(diorganylamino)chlorophosphanes with Hexachlorodisilane or with Trichlorosilane/Triethylamine. - Two Routes to New Functional Trichlorosilylphosphanes (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 615-619 
    Details
    ISSN: 0009-2940
    Keywords: Reductive silylation ; Aminochlorophosphanes ; Silylphosphanes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The reaction of alkyl(diorganylamino)chlorophosphanes R(R2′N)PCl 1 (1a: R = tBu, R′ = Et, 1b: R = iPr, R′ = iPr; 1c: R = iPr, R′ = Ph) with hexachlorodisilane, afforded alkyl(diorganylamino)trichlorosilylphosphanes R(R2′N)PSiCl3 2 (2a: R = tBu, R′ = Et; 2b: R = iPr, R′ = iPr; 2c: R = iPr, R′ = Ph) and silicon tetrachloride. An intermediate formed in the reaction of 1b with hexachlorodisilane, the adduct iPr(iPr2N)(Cl)P-Si(Cl)3-SiCl3 (3b = 1b · Si2Cl6), was detected by 31P- and 29Si-NMR spectra that indicate pentacoordinated silicon bound to tetracoordinated phosphorus and tetracoordinated silicon. Trichlorosilylphosphanes 2 are also available from 1 under very mild conditions by reductive trichlorosilylation with trichlorosilane in the presence of triethylamine. Compounds 2 were identified analytically, by mass spectroscopy, multinuclear NMR, and an X-ray structure determination of 2c.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280614
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 37
    Electronic Resource
    Electronic Resource
    Reactions of Complex Ligands, LXIVPart LXIII: Ref.. Synthesis of 5,5′-Diphenyl-2,2′-bifuran, a Biaryl Compound with Remarkable Fluorescence Properties (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 641-643 
    Details
    ISSN: 0009-2940
    Keywords: Carbene ligands ; Tungsten complexes ; 2,2′-Bifuran ; Copper coupling reaction ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The 2-oxacyclic α,β-unsaturated carbene complex 1 reacts with an excess of dimethylamine to give the diphenylbifuran 2. The structure of 2 was established by independent synthesis from 2-phenylfuran (4) via regioselective lithiation and transmetalation to zinc and tin organometallics 6a-c and final oxidative copper coupling reactions.
    Additional Material: 1 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280618
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 38
    Electronic Resource
    Electronic Resource
    Synthesis of 2- and 3-Stannolenes via Addition of Trimethyltin Alkoxides to 3-Diethylboryl-4-ethyl-1,1-dimethylstannole (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 679-687 
    Details
    ISSN: 0009-2940
    Keywords: Stannole, diethylboryl-substituted ; Trimethyltin alkoxides ; 2-, 3-Stannolenes, organometallic-substituted ; NMR, coupling constants, 2J(Sn,Sn), sign determination ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Trimethyltin alkoxides (2) react stereoselectively with 3-diethylboryl-4-ethyl-1,1-dimethylstannole (1) via addition of the Me3Sn group to C(2) to the C(2) = C(3) bond and a 1,2 shift of an ethyl group from boron to C(3) to give the 2-stannolenes 3. The molecular structure of 3f' [R = (S)-2-Bu] was determined by single-crystal X-ray analysis, confirming the cis positions of the Et(RO)B and the Me3Sn group. These 2-stannolenes 3 undergo, upon heating to ca. 80°C, facile rearrangement by irreversible allylic migration of the Et(RO)B group to the 3-stannolenes 4 in which the cis positions of the boryl and the stannyl group are retained. All 2-stannolenes (in contrast to the 3-stannolenes) are readily deprotoborylated to give the 3-stannolene 5. The structures of 3, 4, and 5 follow conclusively from 1H-, 11B-, 13C-, and 119Sn-NMR spectra. The negative sign of the geminal coupling constants 2J(SnSn) was determined in the case of 3, 4, and 5 by 2D 119Sn/1H heteronuclear shift correlations.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280705
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 39
    Electronic Resource
    Electronic Resource
    Synthesis of Structures of (Acyloxy)boranesDedicated to Prof. Dr. A. Schmidpeter on the occasion of his 65th birthday.Synthesis of Structures of (Acyloxy)boranes (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 751-762 
    Details
    ISSN: 0009-2940
    Keywords: Trifluoroacyloxy-9-borabicyclo[3.3.1]nonane ; Pivaloyloxy-9-borabicyclo[3.3.1]nonane dimer ; Bis(9-borabicyclo[3.3.1]nonyl]oxalate ; Tetrakis(9-borabicyclo[3.3.1]nonyl)-dihydroxyoxalate ; Bis(9-borabicyclo[3.3.1]nonyl)-2,2-dimethylmalonate tetramer ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: 9-Borabicyclo[3.3.1]nonane (9-BBNH) reacts with monocarboxylic acids to afford 9-(acyloxy)-9-borabicyclo[3.3.1]nonanes which are dimers in the solid state as shown by X-ray crystal structures of the benzoate and pivalate. More complex reactions were observed by allowing 9-BBNH to react with dicarboxylic acids in THF or monoglyme. Thus, (9-BBN)2 oxalate 3 contains a fully delocalized oxalate unit with equal C-O and B-O bond lengths. Traces of water convert it into the tetrakis(9-BBN) oxalate 5. A rather unusual structure is veryfied by 9-BBN 2,2-dimethylmalonate 7 which according to its molecular structure is a tetramer featuring a 32-membered ring system. In contrast, reactions of oxalic acid with thexylborane leads to reduction of the acid and formation of a bicyclic dioxaborolo-dioxaborolane 10. Several intermediates were detected by 11B-NMR spectroscopy as well as in reactions of BH3 · THF or BH3 · SMe2 with oxalic acid.  -  It follows from the present study that (acyloxy)boranes derived from dicarboxylic acids are strong Lewis acids with an unexpected variety of structural features.
    Additional Material: 7 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280803
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 40
    Electronic Resource
    Electronic Resource
    A T-Shaped Selenenyl Halide: Synthesis and Characterisation of a Proposed Reaction Intermediate (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 741-742 
    Details
    ISSN: 0009-2940
    Keywords: Selenenyl halides ; Nucleophilic substitution ; Complex intermediate ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The T-shaped selenenyl halide (1), which may be regarded as a model substance for the transition state in nucleophilic displacement at divalent chalcogen atoms, has been isolated and subjected to X-ray structure determination.
    Additional Material: 1 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280715
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 41
    Electronic Resource
    Electronic Resource
    Zinc Complexes of Drugs Containing Nitrogen Heterocycles (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 779-785 
    Details
    ISSN: 0009-2940
    Keywords: Zinc complexes ; Drug ligands ; Captopril ; Isoniazid ; Nalidixic acid ; Mercaptopurine ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Four drugs whose actions have a relation to the status of zinccontaining species in the human body were used as ligands in zinc complexes. Captopril (H2Cap) forms the compound [ZnCap] (1) presumed to be a coordination polymer with O and S coordination. Isoniazid, in the presence of zinc salts, is converted to 1,2-diisonicotinoyl hydrazide (H2Nih) which forms polymeric [Zn(Nih)NH3] (2) with trigonal-bipyramidal ZnO2N3 coordination. Nalidixic acid (HNal) and zinc perchlorate yield [Zn(HNal)2(H2O)2](ClO4)2 · 2 H2O (3) containing zinc in an octahedral ZnO6 environment. Mercaptopurine (H2Mer), in the presence of ammonia, forms [Zn(Mer)(NH3)2] . H2O (4) which is a coordination polymer containing tetrahedral ZnN4 units. The structures of [Zn(Nih)NH3], [Zn(HNal)2(H2O)2](ClO4)2 . 2 H2O, and [Zn(Mer)(NH3)2] . 2 H2O were determined diffractometrically.
    Additional Material: 4 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280807
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 42
    Electronic Resource
    Electronic Resource
    Enantioselective Deprotonation of Benzyl Phosphates by Homochiral Lithium Amide Bases  -  Configurational Stability of Benzyl Carbanions with a Dialkoxyphosphoryloxy Substituent and Their Rearrangement to Optically Active α-Hydroxy Phosphonates (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 823-830 
    Details
    ISSN: 0009-2940
    Keywords: Phosphate-phosphonate rearrangement ; Carbanions, benzylic, configurational stability of ; Phosphonaes Lithium amides, homochiral ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Benzyl dialkyl phosphates are deprotonated enantioselectively by homochiral lithium amides of isopropyl(1-phenylethyl)amine or bis(1-phenylethyl)amine. The short-lived benzylic carbanions formed are virtually configurationally stable relative to the rearrangement to optically active phenyl-hydroxymethylphosphonates. The enantiomeric excesses are up to 50%. The pro-(S) hydrogen is removed by amides having (S) configuration. Homochiral diethyl (S)-phenyl[D1]-methyl phosphate [(S)-16c] is deprotonated by both LDA and n-BuLi with a high primary kinetic isotope effect (kH/D ≍ 50) and isomerizes to the corresponding α-hydroxy phosphonate with an enantiomeric excess of up to 85%.
    Additional Material: 1 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280814
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 43
    Electronic Resource
    Electronic Resource
    Tris(1,10-phenanthroline)iron(II) Complexes  -  Broad Variation of the Redox Potential by 4,7-Substitution at the Phenanthroline Ligands[1] (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 845-850 
    Details
    ISSN: 0009-2940
    Keywords: Phenanthroline synthesis ; Tris(phenanthroline)iron(II) complexes ; Redox potential ; Cyclic voltammetry ; Electron transfer, outer-sphere ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The new 4,7-donor-substituted phenanthrolines 2a-h were synthesized and the corresponding tris(1,10-phenanthroline)iron(II) complexes 3a-h studied by cyclic voltammetry. In more detail three novel aza-crown ether-linked (phenanthroline)iron complexes were investigated, the redox potentials of which could be fine-tuned by the addition of group-Ia,IIa metal cations. All iron(II) complexes showed reversible waves at scan rates between 50 and 500 mV · s-1 and could be reversibly oxidized and reduced by chemical means.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280816
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 44
    Electronic Resource
    Electronic Resource
    Bis(cyclopentadienyl)methane-Bridged Dinuclear Complexes, 10Part 9: B. Stempfle, H. Werner, Gazz. Chim. Ital., 1995, 125, in press. The Bis(cyclopentadienyl)methane Link between Lewis Basic and Lewis Acidic Metal CentersDedicated to Prof. Dr. Herbert Schumann on the occasion of his 60th birthday. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 877-881 
    Details
    ISSN: 0009-2940
    Keywords: Bis(cyclopentadienyl)methane ; Heterobimetallic complexes ; Imido complexes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The mononuclear rhodium complexes [(C5H5CH2C5H4)-Rh(CO)2] (1) and [(C5H5CH2C5H4)Rh(PhC≡CPh)(PiPr3)] (2) readily react with nBuLi or TlOEt to yield the corresponding lithium salts 3 and 4 or thallium salts 5 and 6. The reaction of these salts with [(C5H5)Nb(NtBu)Cl2] (7) leads to the formation of the heterodinuclear compounds [{CH2(C5H4)2}-{Rh(CO)2}{(C5H5)Nb(NtBu)Cl}] (8) and [{CH2(C5H4)2}-{Rh(PhC≡CPh)(PiPr3)}{(C5H5)Nb(NtBu)Cl}] (9), respectively. Treatment of 3-6 with [Mo(NtBu)2Cl2] (10) gives the heterodinuclear Rh/Mo complexes [{CH2(C5H4)2}{Rh(CO)2}-{Mo(NtBu)2Cl}] (11) and [{CH2(C5H4)2}{Rh(PhC≡CPh)-(PiPr3)}{Mo(NtBu)2Cl}] (12). The analogous reaction of [Mo(NMes)2Cl2(DME)] (13) with 3-6 yields the corresponding complexes [{CH2(C5H4)2}{Rh(CO)2}{Mo(NMes)2Cl}] (14) and [{CH2(C5H4)2}{Rh(PhC≡CPh)(PiPr3)}{Mo(NMes)2Cl}] (15). From the monometallated ligand [(C5H5CH2C5H4)M] (M = Li: 16; M = Tl: 17) and the imidometal compounds 7, 10 and 13, the mononuclear complexes [(C5H5CH2C5H4)(C5H5)Nb-(NtBu)Cl] (18) and [(C5H5CH2C5H4)Mo(NR)2Cl] (R = tBu: 19; R = Mes: 20) have been obtained.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280905
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 45
    Electronic Resource
    Electronic Resource
    Addition von Hydrofullerid [C60H]- an koordinierte, ungesättigte Kohlenwasserstoffe: Bindung von Fulleren an Metallkomplexe über KohlenwasserstoffbrückenHerrn Professor Herbert Walter Roesky zum 60. Geburtstag gewidmet (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1059-1060 
    Details
    ISSN: 0009-2940
    Keywords: Fullerene ; Hydrofulleride ; Manganese complex ; Rhenium complex ; Iron complexes ; Ruthenium complex ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Addition of Hydrofulleride [C60H]- to Coordinated, Unsaturated Hydrocarbons: Binding of Fullerene to Metal Complexes through Hydrocarbon BridgesHerrn Professor Herbert Walter Roesky zum 60. Geburtstag gewidmet.Hydrofulleride [C60H]- is added to the hydrocarbon ligands of the cationic complexes [(OC)5Re(η2-C2H4)]+, [(OC)3Mn-(η6-C6H6)]+, [(OC)3M(η5-C6H7)]+ (M = Fe, Ru), [(OC)3Fe(η5-C7H9)]+, and [(η5-C5H5)Fe(η6-C5H4CH2)]+.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281017
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 46
    Electronic Resource
    Electronic Resource
    Controlled Conversion of the Transient 2-Mesityl-1,1-bis(trimethylsilyl)silene into a Tetrahydro-2,3-disilanaphthalene, a 1,2-Disilacyclobutane, or a 1,3-Disilacyclobutane (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1083-1088 
    Details
    ISSN: 0009-2940
    Keywords: Silenes ; Silene dimerization ; 1,2-Disilacyclobutanes ; 1,3-Disilacyclobutanes ; 2,3-Disilanaphthalene, tetrahydro- ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Mesityl[tris(trimethylsilyl)silyl]methanol (1) reacts with strong bases with elimination of trimethylsilanolate according to a Peterson-type mechanism, the outcome of the reaction being dependent on solvent, temperature, and nature of the organometallic base applied. Thus, 1 was converted by treatment with MeLi in ether at -78°C to (E)-1,2,3,8a-tetra -hydro-1-mesityl-5,7,8a-trimethyl-2,2,3,3-tetrakis (trimethylsi-lyl)-2,3-disilanaphthalene (3), formally a [2 + 4] cyclodimer of the transient silene (Me3Si)2Si=CHMes (2). The reaction of 1 with PhMgBr in THF after some days resulted in the formation of (Z)-3,4-dimesityl-1,1,2,2-tetrakis(trimethylsilyl) -1,2-disilacyclobutane (6) as the main product besides small quantities of 3, the polysilane (Me3SiSi(SiMe3)2CH2Mes (10), and the alkoxysilane (Me3Si)3SiCH(Mes)OSi(Si-Me3)2CH2Mes (7). Compound 6, the formal [2 + 2] cycloadduct of 2, can also be obtained by thermal treatment of 3 and is considered to be the thermodynamically more stable silene dimer whereas 3 is the kinetically preferred product. At high LiBr concentrations in the reaction mixture 1 was converted by PhMgBr in THF to (E)-2,4-dimesityl-1,1,3,3-tetrakis(tri- methylsilyl)-1,3-disilacyclobutane (13) besides 6 and [bis(tri-methylsilyl)silyl]mesityl(trimethylsiloxy)methane (11). The unforeseen formation of 13 is discussed as proceeding via the silene-lithium bromide adduct (Me3Si)2Si(Br)CH(Li)Mes (12). In the absence of LiBr 1 was converted by MeLi in THF at -78°C to 11 and the trisilane (Me3Si)2Si(Me)CH2Mes (4b). Probable pathways of the formation of all new compounds are discussed. For 6 and 13 the results of the X-ray structural analyses are given.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281105
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 47
    Electronic Resource
    Electronic Resource
    Metallkomplexe mit biologisch wichtigen Lisganden, LXXXLXXIX. Mitteilung: Lit.. (η3:η3-C10H16)Ru(IV)-Komplexe mit α-Aminocarboxylaten, α-Aminosäureestern und Peptidestern als Liganden (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1117-1125 
    Details
    ISSN: 0009-2940
    Keywords: 1,7-Dimethylocta-2,6-diene-1,8-diyl ; Ruthenium complexes ; α-Amino carboxylates ; α-Amino acid esters ; Peptide esters ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Metal Complexes Containing Biologically Important Ligands, LXXXLXXIX. Mitteilung: Lit. .  -  (η3:η3-C10H16)Ru(IV) Complexes with α-Amino Carboxylates, α-Amino Acid Esters, and Peptide Esters as LigandsReactions of the chloro-bridged bis(allyl) complex [(η3:η3-C10H16)Ru(Cl)(μ-Cl)]2 with α-amino carboxylates and α-amino acid esters afford the complexes (η3:η3-C10H16)(Cl)RuNH2CHRCO2 (2) and (η3:η3-C10H16)(Cl)2-RuNH2CHRCO2R′ (3). Abstraction of chloride from 3 by Ag+ gives the N,O-chelates [(η3:η3-C10H16)(Cl)RuNH2CHRCO2R′]+BF4 (4). Cysteine methyl ester forms the N,S-chelate complex (η3:η3-C10H16)(Cl)RuNH2CH(CO2CH3)CH2S (5), and with histidine methyl ester a dinuclear complex 6 with N,N-histidine bridge is obtained. Compound 3d with L-PheOEt as ligand was characterized by X-ray diffraction.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281110
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 48
    Electronic Resource
    Electronic Resource
    [MeO(CH2CH2O)3(CH2)3C5Me4]FeCl: A Halfsandwich Iron (II) Chloride Complex of Remarkable Stability (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1135-1136 
    Details
    ISSN: 0009-2940
    Keywords: Hemilabile ligands ; Cyclopentadienyl ligands, functionalised ; Iron compounds ; Halfsandwich complex ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Reaction of iron(II) chloride with one equivalent of [MeO-(CH2CH2O)3(CH2)3C5Me4]Li in THF yields the title halfsand-wich complex 1, which is stable in solution up to room temperature. Compound 1 reacts with C5H5Li and CO to give [MeO(CH2CH2O)3(CH2)3C5Me4]Fe(C5H5) (2) and [MeO-(CH2CH2O)3(CH2)3C5Me4]Fe(CO)2CI (3), respectively, in high yields.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281113
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 49
    Electronic Resource
    Electronic Resource
    [Cp4Fe4(E2)2] Clusters with Triangulated Dodecahedral Fe4E4 Skeletons (E = P, As)Dedicated to Professor Herbert Schumann on the occasion of his 60th birthday. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1145-1148 
    Details
    ISSN: 0009-2940
    Keywords: P2, As2, P2S2, and P2Se2 ligands ; Iron complexes ; Triangulated dodecahedra ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The thermolysis of [CpFe(CO)2]2 (1) and P4 or As4 affords the iron clusters [Cp4Fe4(E2)2], E = As (2a), P (2b), the Fe4E4 skeleton of which consists of a triangulated dodecahedron. S8 and gray Se oxidize the P2 ligands of 2b with formation of [Cp4Fe4(P2X2)2], X = S (3a), Se (3b), complexes with the hitherto unknown P2X2 ligands, 2a, b and 3a, b have been characterized by X-ray crystallography.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281202
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 50
    Electronic Resource
    Electronic Resource
    Functionalized Diorganozinc Compounds: Key Reagents for the Synthesis of Enantiomerically Pure 2,5-Disubstituted cis- and trans-Tetrahydrofurans (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1021-1028 
    Details
    ISSN: 0009-2940
    Keywords: Synthesis, stereoselective ; Catalysis ; Tetrahydrofurans ; Dialkylzinc reagents ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: 1,4-Diol derivatives 4a-i were synthesized stereoselectively by either reagent- or catalyst-controlled routes using the addition of functionalized diorganozinc reagents to aldehydes. The stereoselectivities along the reagent-controlled synthetic path were in the range between 80:20 and 95:5. The stereoselectivities along the catalyst route exceeded 95:5. The 1,4-diol derivatives 4 thus obtained were transformed into enantiomerically pure cis- and trans-2,5-disubstituted tetrahydrofurans (16-20) by means of an intramolecular Williamson reaction.
    Additional Material: 1 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281010
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 51
    Electronic Resource
    Electronic Resource
    Contributions to the Chemistry of Boron, 231Part 230: Ref.. Synthesis and Structures of Borylated HydrazinesDedicated to Professor H. P. Fritz on the occasion of his 65th birthday. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1187-1194 
    Details
    ISSN: 0009-2940
    Keywords: Hydrazines ; N,N'-bis(diphenylboryl)-N,N'-dimethyl- ; N,N'-bis(diphenylboryl)-N',N'-dimethyl- ; N,N'-bis(dimethylphenylsilyl)- ; N,N'-bis(chloromesitylboryl)-N'-phenyl-N'-(trimethylsilyl)- ; 1,2,4,5,3,6-Tetrazadiborinane, 1,2,4,5-tetrakis(tert-butyldimethylsilyl)-3,6-difluoro- ; Triazadiborolidine, dihydro-, derivative ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The diboration of the diazene PhN = NSiMe3 (15) by diborane(4) derivatives provides a new synthetic route to N,N'-diborylated hydrazines. The product formed depends on the type of the diborane(4) compound. Thus, addition of dimesityldiboron dichloride to 15 in a 1:1 ratio afforded (mesCIB)PhN-N(SiMe3)(BClmes) (16) while bis(dimethyl-amino)diboron dichloride was found to react in a 1:2 ratio to give a triazadiborolidine derivative 17. In addition, it was demonstrated that in the solid state Me2N-N(BPh2)2 (8) is a derivative of a three-membered dihydroazadiboriridine C while its isomer, (Ph2B)MeN-NMe(BPh2) (7), forms no BN coordinative bond. The new 3,6-difluoro-1,2,4,5-tetraza-3,6-diborine 13 shows a twist conformation. The molecular structures of all these compounds were determined by X-ray crystal structure analysis, and the influence of the B substituent on the conformation is discussed.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281209
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 52
    Electronic Resource
    Electronic Resource
    Metal Complexes of Functional Isocyanides, XXV. Amino(hydrazino)carbene Complexes (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1061-1068 
    Details
    ISSN: 0009-2940
    Keywords: N-Isocyanides ; N-Isocyanodialkylamine complexes ; Carbene complexes ; Imaging-Plate data collection ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The N-isocyanodialkylamine metal complexes [M(CO)5CN-NR2] (M = Cr, W), trans-[MI2(CNNR2)2] (M = Pd, Pt), trans-[Pt(Cl)(CNNR2)(PPh3)2]BF4, and cis-[PtCl2(CNNR2)(PPh3)] [R = Et, iPr; 2 R = -{CHMe(CH2)3CHMe}-] react with primary amines to give the amino(hydrazino)carbene metal complexes [M(CO)5(C(NHR′)NHNR2}] (R′ = Me, nPr, Cy) (1-9), trans-[PtI2{C(NHMe)NHNR2}2] (10-12) and trans, and the amine adducts cis-[PtCl2{C(NHMe)NHNC(H)(Me) (CH2)3CHMe}(PPh3)] H2NMe (14), and trans-[PdI2{C (NHMe)NHNC(H)(Me)(CH2)3CHMe}2] 2 H2NMe (15). With secondary amines the amino(hydrazino)carbene metal complexes trans (18) and trans-[PtCl{C(NEt2)NHNEt2} (PPh3)2]BF4 (19) Were isolated. The complexes trans-[PtI2{C(NHCy)NHNiPr2}CNNiPr 2] (20) and trans-[PdI2 (NH2Cy){C(NHCy)NHNiPr2}] (21) were obtained by reaction of trans-[MI2(CNNiPr2)2] (M = Pd, Pt) with cyclohexylamine. The structures were assigned on the basis of IR, NMR- (1H, 13C, 31P), and mass spectroscopy as well as an X-ray structural analysis of 21.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281102
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 53
    Electronic Resource
    Electronic Resource
    Metallocenophanes, VIIPart VI: Ref.. Preparation and Characterisation of the Disilver(I) Complexes of Conjugated Polyenes with [2.2.2]Paracyclophanyl End Groups (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1079-1082 
    Details
    ISSN: 0009-2940
    Keywords: [2.2.2]Paracyclophanes ; Polyenes ; Silver complexes ; X-Ray structural analysis ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The preparation of the disilver(I) complexes 3 and 4, polyene metal complexes that are terminally substituted with [2.2.2]paracyclophanyl units, is described. NMR spectro-scopic studies on the disilver perchlorate complex 3b showed that (a) the sites of complexation are the cyclophane groups and (b) the olefinic spacers do not overly perturb the overall complexation properties of the individual [2.2.2]paracyclo-phanyl groups. The crystal structures of the disilver hexafluo-roantimonate complexes 4a-b were determined. The use of the hexafluoroantimonate counterion and solvent mixtures containing toluene both proved crucial in obtaining single crystals; toluene is incorportated into the crystal lattices.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281104
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 54
    Electronic Resource
    Electronic Resource
    Highly Substituted Tris(pyrazolyl)methane Ligands and Some Zinc Complexes Thereof (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1095-1103 
    Details
    ISSN: 0009-2940
    Keywords: Zinc complexes ; Tridentate ligands ; Tris(pyrazolyl)methane ; Reactivity ; Structure ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Tris(pyrazolyl)methane ligands in which two or three of the pyrazole carbon atoms bear organic substituents (L1-L7) were synthesized from chloroform and the corresponding pyrazole under phase transfer conditions. Their behavior towards zinc salts was found to span the range from no reaction at all to hydrolytic destruction. One hydrolysis product isolated and structurally characterized was the perchlorate complex [(HPz5)3Zn-OClO3]ClO4 (1), other ones were the 2:1 complexes (HPz3)2ZnBr2 (2) and (HPz6)2Zn(NO3)2 (3, HPzn = substituted pyrazole). Zinc perchlorate and tris(trimethylpy-razolyl)methane (L2) formed the octahedral binary complex [L22Zn](ClO4)2 (4) as evidenced by a structure determination. Zinc halides produced the 1:1 complexes L1 · ZnBr2 (5), L4 · ZnCl2 (6), and L4 · ZnBr2 (7), which according to the structure determinations of 6 and 7 contain tetrahedral ZnN2Hal2 units with only bidentate tris(pyrazolyl)methane ligands. In contrast, the zinc nitrate complex L4 · Zn(NO3)2 (8) was found to have an octahedral structure with mono- and bidentate nitrate and tridentate L4. The bromide complex 7 was converted by silver perchlorate hydrate into the labile compound [L4 · ZnBr]ClO4 (9) and then into the unstable product [L4 · Zn-OH2](ClO4)2 (10), both presumed to contain zinc in a tetrahedral ZnN3Br or ZnN3O environment, respectively. The ease of hydrolytic self-destruction prevented the exploitation of the reactivity of 9 and 10 in analogy to that of the corresponding tris(pyrazolyl)borate zinc complexes.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281107
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 55
    Electronic Resource
    Electronic Resource
    Unusual Complexation Behavior of Metallomacrocycles Based on Isothiosemicarbazides with Respect to Alkali and Alkaline Earth Metal Ions: Novel 2:1 Associates (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1089-1093 
    Details
    ISSN: 0009-2940
    Keywords: Metallomacrocycles ; Nickel complexes ; Complexation reactions ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The reactions between alkali and alkaline earth metal ions and nickel(II) macrocycles based on S-alkylated isothiosemi-carbazides with different crown ether cavity size were studied in propylene carbonate by spectrophotometric and calorimetric titrations. Metallomacrocycles 1 and 2 exhibit normal behavior on 1:1 complexation with alkali- and alkaline earth metal ions and resemble in this respect 15C5 and 18C6, respectively. The most stable complexes are formed by these “ligands” when the diameter of the cation and the crown ether hole have approximately the same size. The most striking feature of the complexation processes studied is the formation of 1:2 metal-ligand associates even in the case of the smallest cations. These associates are very different from “normal” crown ether sandwich complexes. In reality, the particle formed is an associate between a 1:1 complex, in which the corresponding metal ion is well accommdated inside the ligand cavity, and a second metallomacrocyclic ligand. Their formation is disfavored by enthalpic contributions. A special kind of “switch” from these associates to normal sandwich complexes takes place in the case of 1, when the cation diameter compared to hole size increases. The macrocycle 2 forms this kind of associates with all akali and alkaline earth ions.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281106
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 56
    Electronic Resource
    Electronic Resource
    Synthesis and Reactivity of Silicon Transition Metal Complexes, 3433. Mitteilung: Lit.. Pentachlordisilanyl- und Disilanyl-Komplexe von Molybdän und Wolfram: Darstellung, Struktur und spektroskopische CharakterisierungHerrn Professor Hubert Schmidbaur zum 60. Geburtstag gewidmet. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1109-1115 
    Details
    ISSN: 0009-2940
    Keywords: Silicon transition metal complexes ; Metallodisilanes ; Nucleophilic metallation ; Cl/H exchange at silicon ; Raman spectroscopy ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Synthesis and Reactivity of Silicon Transition Metal Complexes, 34[*].  -  Pentachlorodisilanyl and Disilanyl Complexes of Molybdenum and Tungsten: Synthesis, Structure, and Spectroscopic CharacterizationReaction of the lithium metallates Li[M(PMe3)(CO)2C5R5] [M = Mo, W; R = H (1a, b), Me (1c, d)] with Si2Cl6 (2) leads to the formation of the pentachloro(metallo)disilanes 5R5(OC)2(Me3P)M - SiCl2 - SiCl3 (3a - d), which are transformed into the metallo disilanes C5R5(OC)2(Me3P)M - SiH2 - SiH3 (4a - d) on treatment with LiAlH4. The disilanes 4a - d are reconverted into 3a - d in the presence of tetrachloromethane. Extensive spectroscopic investigations (NMR, Raman, and IR spectroscopy) were performed to establish the transition-metal effect especially with respect to the H5Si2 ligand. The molecular structure of C5Me5(OC)2(Me3P)W - SiCl2 - SiCl3 (3d) was determined by single-crystal X-ray diffraction.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281109
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 57
    Electronic Resource
    Electronic Resource
    Octacarbonylbis {μ-(tris(trimethylsilyl)methyl]indany l} dimanganese with Two Monoalkyl Indium Groups Bridging the Mn-Mn Bond (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1137-1139 
    Details
    ISSN: 0009-2940
    Keywords: Tetraindane(4) ; Indium(I) ; Mn-Mn bond ; Indium alkyl bridge ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Tetrahedra-tetrakis[tris(trimethylsilyl)methyl]tetraindane(4) (1) reacts with decacarbonyldimanganese(0) to yield the bright red crystalline title compound 2, in which two carbonyl ligands are replaced by two InR fragments. The crystal structure determination of 2 shows two Mn(CO)4 groups (Mn-Mn 313.7 pm) bridged by two monoalkylindium units and a planar Mn2In2 molecular center.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281114
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 58
    Electronic Resource
    Electronic Resource
    Thioselonocarboxylic Ester, Selenetane, and Dihydrodiselenine Complexes Prepared from Pentacarbonyl(selenobenzaldehyde)tungsten with π-Donor-Substituted Alkynes (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1149-1156 
    Details
    ISSN: 0009-2940
    Keywords: Selenoaldehyde complex ; Thioselonocarboxylic ester complexes ; Selenetane complex ; Dihydrodiselenine complex ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Pentacarbonyltungsten-coordinated selenobenzaldehyde, [(CO)5W{Se=C(Ph)H}] (1), reacts with tBu-C≡C-SMe (2) by insertion of the C≡C into the Se=C bond to form in a highly regio- and stereoselective manner the α,β-unsaturated thioselonocarboxylic ester complex (Z)(C=C)-[(CO)5W{≡1-Se=C(SMe)C(tBu)=C(Ph)H}] (3). The thioselonocarboxylic ester ligand is cleaved intact from the metal by treatment of 3 with [NEt4]Br. Three complexes are formed in the reaction of 1 with Me-C≡C-SMe (5): the thioselonocarboxylic ester complex [(CO)5W{≡1-Se=C(SMe)C(Me)=C(Ph)H}] (6) as a mixture of the (E) and (Z)(C=C) isomers, a selenetane complex (7) and a dihydrodiselenine complex (8). The product distribution depends on the ratio 1:5 and on the solvent. The reaction of 1 with the bis(organylthio)alkynes RS-C≡C-SR (9) [R = Me (a), iPr (b), 2,6-C6H3Me2 (c)] yields mixtures of the (E) and (Z)(C=C) isomers of the α,β-unsaturated α-organylthio thioselonocarboxylic ester complexes [(CO)5W{≡1-Se=C(SR)C(SR)=C(Ph)H)] (10a-c). In contrast, the reaction of 1 with tert-butoxyethyne, H-C≡C-OtBu (11), affords a bis(pentacarbonyltungsten) 5,6-dihydro-1,2-diselenine complex (12). Compound 12 is probably formed by consecutive reaction of 1 with 11 to give the selonocarboxylic ester complex [(CO)5W{≡1-Se=C(OtBu)C(H)=C(Ph)H}] which then further reacts as a heterodiene by highly regioselective [4 + 2] cycloaddition with the Se=C bond of a second molecule of 1 to give 12. In the reaction of 1 with 5 and 9a the isomer with a trans arrangement of C(=Se)SMe and Ph is the kinetically controlled reaction product [(E)-6 and (Z)-10a, respectively]. The formation of (E)-6 and (Z)-10a is followed by isomerization until an (E)/(Z) equilibrium is reached. Complexes 3 and 7 were characterized by X-ray structural analyses.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281203
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 59
    Electronic Resource
    Electronic Resource
    Tin for Organic Synthesis, 13Part 12: Ref.. A New and Regioselective Method for the Synthesis of Aromatic, Heteroaromatic, and Olefinic Sulfonamides by Electrophilic Destannylation (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1195-1198 
    Details
    ISSN: 0009-2940
    Keywords: Electrophilic aromatic substitution ; Electrophilic vinylic substitution ; Trialkylstannanes, application of ; Sulfonamides, synthesis of ; Sulfodestannylation, application of ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: A mild and effective method for the preparation of aromatic and olefinic sulfonamides is described. The reaction of trialkylaryl- (4a-f), heteroaryl- (4g), and vinylic stannanes (4h) with sulfuryl chloride and secondary amines provides the corresponding sulfonamides in an ipso-specific manner.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281210
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 60
    Electronic Resource
    Electronic Resource
    Ylidylphosphorsulfide, -selenide, -disulfide, -sulfidselenide und -diselenide (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1207-1219 
    Details
    ISSN: 0009-2940
    Keywords: Ylide-substituted phosphorus ; Phosphorus sulfides ; Phosphorus selenides ; Thioxophosphanes ; Selenoxo-phosphanes ; Dithioxophosphoranes ; Diselenoxophosphoranes ; Alkylation reactions ; Selenadiphosphirane ; 2,5,7-Triselena-1,3,4,6-tetraphosphanorbornane ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Ylidylphosphorus Sulfides, Selenides, Disulfides, Sulfide Selenides, and DiselenidesWe report on the first stable monomeric phosphorus mono-chalcogenides 2, 8 and the first stable dichalcogenides 4, 10 without bulky or intramolecularly coordinating substituents. They are stabilized by a high contribution of the zwitterionic resonance formula, which follows both from the NMR spectra and from an X-ray structure determination. Their preparation starts from triphenylphosphoniumylidyl-dichlorophosphanes 1. For the monochalcogenides they are treated with sodium sulfide or selenide or better with bis(trimethylsilyl) sulfide or selenide. In case of the C-phenyl and C-meta-tolyl representatives and also of the C-trimethylsilyl compound a number of secondary, partly novel products are obtained. - The dichalcogenides result from the reaction with sodium disulfide and diselenide, respectively, or from the oxidation of the monochalcogenides. - Alkylation of the monochalcogenides results in ylidylalkylchalcogenophosphenium salts 13, 15. In solution they are in equilibrium with more or less of the covalent form 14, 16, depending on the anion and on the solvent. Alkylation is often accompanied by secondary reactions. A diselenide loses selenium on alkylation.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281212
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 61
    Electronic Resource
    Electronic Resource
    Synthesis and Reactivity of Silicon Transition Metal Complexes, 3332. Mitteilung: Lit.. Metallo Silanols and Metallo Siloxanes, 87. Mitteilung: Lit.. Metallo-silanole vom Typ C5R5(OC)2(Me3P)M - SiPh2OH (M = Cr, Mo, W): Darstellung nach der Dimethyldioxiran-Methode und Überführung in funktionalisierte Metallo-disiloxaneHerrn Professor Max Schmidt zum 70. Geburtstag gewidmet. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 1251-1255 
    Details
    ISSN: 0009-2940
    Keywords: Oxofunctionalization ; Dimethyldioxirane ; Metallo silanes ; Metallo silanols ; Metallo siloxanes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Synthesis and Reactivity of Silicon Transition Metal Complexes, 3332. Mitteilung: Lit. .  -  Metallo Silanols and Metallo Siloxanes, 8 7. Mitteilung: Lit. .  -  Metallo Silanols of the Type C5R5(OC)2(Me3P)M-SiPh2OH (M = Cr, Mo, W): Preparation According to the Dimethyldioxirane Route and Conversion into Metallo Disiloxanes Herrn Professor Max Schmidt zum 70. Geburtstag gewidmet.The metallo silanes C5R5(OC)2(Me3P)M-SiPh2H (4a-c), are converted into the corresponding metallo silanols C5R5(OC)2-(Me3P)M-SiPh2OH [R = H, M = Cr (6a); R = Me, M = Mo (6b); M = W (6c)] by oxofunctionalization with dimethyldioxirane (5). Treatment of 6b, c with the chlorosilanes Me2Si(R)Cl [R = H (3b), [R = Cl (3c)] in the presence of triethylamine gives access to the metallo disiloxanes C5Me5(OC)2(Me3P)M-SiPh2OSiMe2R (M = Mo, R = H (7a); M = W, R = Cl (7b)]. The structure of tungsten silanol 6c is determined by X-ray diffraction analysis.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951281217
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 62
    Electronic Resource
    Electronic Resource
    Masthead (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996) 
    Details
    ISSN: 0009-2940
    Keywords: Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290101
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 63
    Electronic Resource
    Electronic Resource
    Triferriothioxophosphoranes: First Structural Characterization of a μ3-P=S ComplexDedicated to Prof. Dr. M. Herberhold on the occasion of his 60th birthday. (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 11-13 
    Details
    ISSN: 0009-2940
    Keywords: Triferriophosphane sulfide ; Metallothioxophosphorane ; PS complex ; Spiro compounds ; Decarbonylation ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The P-H-functional triferriophosphonium salts [{CpFe-(CO)2}3PH]2FeCl4 (1) and [{μ-CO(CpFeCO)2}{CpFe-(CO)2}PH]2FeCl4 (4) are easily deprotonated by DBU to the corresponding unstable triferriophosphanes 2, 5, which subsequently are oxidized by sulfur to the triferriophosphane sulfides {CpFe(CO)2}3P=S (3) and {μ-CO(CpFeCO)2}{CpFe-(CO)2}P=S (6), respectively. The photolysis of 3 results only in its decomposition by elimination of [CpFe(CO)2]2, whereas the photolysis of 6 cleaves off one CO ligand to give the new spiro compound (CpFeCO)(μ-η2-PS){μ-CO(CpFeCO)2} (7), where the P=S unit is η2-bonded to the 15-electron CpFeCO fragment, and the phosphorus atom bridges two 17-electron fragments. Compound 7 shows a new coordination mode of the PS unit where sulfur is also bound to one of the metal atoms. Compounds 6 and 7 can be regarded as first examples of a new class of PS complexes of transition metals. All compounds were characterized by IR, 31P{1H}- and 13C{1H}-NMR spectroscopy as well as mass spectrometry; for 6 the X-ray analytical data are given.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290104
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 64
    Electronic Resource
    Electronic Resource
    The Chemistry of 1,3,5-Triazacyclohexane Complexes, 3Part 2: Ref.. High Yield Synthesis of [Cr{N(SiMe3)2}3] and Accurate Structure Determination by Cocrystallization with Me6Si2 (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 25-27 
    Details
    ISSN: 0009-2940
    Keywords: Triazacyclohexanes ; Chromium complexes ; Amides ; Hexamethyldisilane ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The reaction of N,N′,N′′-trimethyl-1,3,5-triazacyclohexane chromium trichloride ((Me3TAC)CrCl3, 1) with LiN(SiMe3)2 or NaN(SiMe3)2 in petroleum ether yields nearly quantitatively [Cr{N(SiMe3)2}3] (2) with loss of the Me3TAC ligand. Compound 2 could be crystallized from hexamethyldisilane as [Cr{N(SiMe3)2}3] · (Me6Si2)0,5 which allowed the refinement of the X-ray crystal structure in the trigonal space group P-31c (no. 163) (a = 16.012(3) Å, c = 8.4796(12) Å, V = 1882.8(6) Å3, Z = 2) without severe disorder.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290107
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 65
    Electronic Resource
    Electronic Resource
    Synthesis of Novel Tridentate N,O,S and N,N,O Ligands of the Tripod Type in Racemic and Enantiomerically Pure Form (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 59-68 
    Details
    ISSN: 0009-2940
    Keywords: Glyceraldehyde ; Ligands, tridentate ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: A series of seven chiral, tripodal N,O,S and N,N,O ligands were prepared in which N stands for a secondary amine or imidazole donor, O for a phenol, and S for a thioether or thiol metal-binding group. Key steps are (1) the construction of ortho-hydroxyacetophenones bearing the phenolic binding group and either a thioether, a protected thiol or an imidazole substituent in the α-position, and (2) subsequent reductive amination with a primary amine. The modular synthesis allows a rapid construction of a variety of structurally related ligands. In three cases, the enantiomers of the racemic products could be separated after condensation with (R)-glyceraldehyde acetonide as chiral auxiliary. The relative configurations of the cyclic N,O- and N,N-acetals thus obtained were established by NOE spectroscopy. X-ray structural analysis of two crystalline N,O- and N,N-acetals allowed the assignment of absolute configurations. Hydrolysis of the dia-stereomerically pure acetals afforded the enantiomerically pure ligands in high yield. By comparison of their CD spectra, absolute configuration could also be assigned to the third pair of enantiomerically pure ligands.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290113
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 66
    Electronic Resource
    Electronic Resource
    Kinetic Investigations of the Hydrogenation of Diolefin Ligands in Catalyst Precursors for the Asymmetric Reduction of Prochiral Olefins, II[1] (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 85-89 
    Details
    ISSN: 0009-2940
    Keywords: Rhodium complexes, chiral ; Hydrogenation ; Bisolefins ; Thermodynamic stability ; Kinetic control ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Asymmetric hydrogenations of prochiral olefines by means of chiral rhodium(I) complexes of the type [Rh(L)(PP*)]A (L = COD, [(Z,Z)-cycloocta-1,5-diene], or NBD (norborna-2;5-diene), PP* = chiral bisphosphane forming seven-membered chelate rings, A = anion like BF4-) are often associated with induction periods caused by partial blocking of the catalyst. NBD complexes are hydrogenated faster than the corresponding COD complexes. Catalytic hydrogenation of COD/NBD mixtures and the determination of the ratio of the Michaelis constants showed that the steady-state concentration of the COD complex under hydrogen is higher than that of the NBD complex. However, under argon the NBD complex predominates owing to its higher thermodynamic stability compared with that of the COD complex as determined by 31P-NMR spectoscopy. This complete reversion of the ther-modynamically determined ratios of COD to NBD complex concentration under hydrogenation conditions was proven by means of UV/Vis spectroscopy.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290117
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 67
    Electronic Resource
    Electronic Resource
    1-Bromo-3,5-bis(trifluoromethyl)benzene: A Versatile Starting Material for Organometallic Synthesis (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 233-235 
    Details
    ISSN: 0009-2940
    Keywords: Positional selectivity ; Bromination ; Halogen/lithium exchange ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: 1-Bromo-3,5-bis(trifluoromethyl)benzene (1) can be selectively prepared by treatment of 1,3-bis(fluoromethyl)benzene with N,N'-dibromo-5,5-dimethylhydantoin in strongly acidic media. A number of synthetically useful reactions via 3,5-bis(trifluoromethyl)phenylmagnesium, -lithium, and -copper intermediates were accomplished.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290219
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 68
    Electronic Resource
    Electronic Resource
    Lithiierte Phosphanimine. Synthese und Kristallstrukturen von [LiCH2PMe2NSiMe3]4 und [LiCMe2P(iPr)2NSiMe3]2 (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 253-257 
    Details
    ISSN: 0009-2940
    Keywords: Lithiated phosphane imines ; Phosphane imines, lithiated ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Lithiated Phosphane Imines. Synthesis and Crystal Structures of [LiCH2PMe2NSiMe3]4 and [LiCMe2P(iPr)2NSiMe3]2The title compounds were prepared by the reaction of Me3-SiNPMe3 and Me3SiNP(iPr)3, respectively, with n-Butylli-thium at 20°C in n-hexane solution. They form white, moisture- and oxygen-sensitive crystals, which were characterized by IR spectroscopy and by crystal structure determinations. - [LiCH2PMe2NSiMe3]4 (1) forms a Li4 tetrahedron, the faces of which are capped with CH2 groups with average Li-C distances of 233 and 251 pm, while the nitrogen atoms occupy the corners of the Li4 tetrahedron. - [LiCMe2P(iPr)2N-SiMe3]2 (2) forms molecules of symmetry C2 in which the lithium atoms have coordination number three by two carbon atoms and one nitrogen atom with Li-C distances of 215.2 and 237.9 pm and Li-N of 192.8 pm.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290223
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 69
    Electronic Resource
    Electronic Resource
    Synthesis and Characterization of a Novel Cyclobutadiene-octatetrayne Polymer (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 269-273 
    Details
    ISSN: 0009-2940
    Keywords: Organometallic polymers ; Coupling reactions ; Butadiynyl complexes ; Cobalt compounds ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The synthesis of 3a starting from compound 1 is described. Copper-catalyzed oxidative coupling of 3b under Hay conditions gives the novel polymer 9 with octatetrayne-cyclobutadiene units.
    Additional Material: 4 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290304
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 70
    Electronic Resource
    Electronic Resource
    A Study on Electronic Interaction Between two [2.2]Metacyclophane Systems Connected with a C=C Bond: Preparation, Structure and Complexation of (E)- and (Z)-8,8′-(Ethene-1,2-diyl)bis(5-tert-butyl[2.2]metacyclophane) (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 289-296 
    Details
    ISSN: 0009-2940
    Keywords: Bis[2.2]metacyclophanes ; Stilbenes ; π-π Interaction ; Tricarbonylchromium complexes ; Charge-transfer ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: (E)-8,8′-(Ethene-1,2-diyl)bis(5-tert-butyl[2.2]metacyclo-phane) (2) was obtained from a McMurry reaction of 5-tert-butyl-8-formyl[2.2]metacyclophane (1). Irradiation of 2 with a high-pressure mercury lamp gave the corresponding (Z) isomer 3. X-ray crystallographic analyses of 2 and 3 show a certain degree of twisting of the bond connecting the meta-cyclophane unit and the central π system due to steric crowding. UV spectra of 2 and 3 and of the charge-transfer complexes [2/TCNE] and [3/TCNE] allow for a discussion of π-π interaction between the central stilbene subunit and the outer benzene rings of the metacyclophane units. Bis[2.2]meta-cyclophanes 2 and 3 reacted regioselectively with hexacar-bonylchromium on the outer benzene rings giving 1:1 and 1:2 complexes 9-14 with tricarbonylchromium. No 1:3 and 1:4 complexes formed due to steric restrictions. Analysis of UV spectral data of the complexed [2.2]metacyclophanes was performed for an indication of π-π interactions in the complexes.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290308
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 71
    Electronic Resource
    Electronic Resource
    Thermally Stable Self-assembling Open-Frameworks: Isostructural Cs+ and (CH3)4N+ Iron Germanium Sulfides (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 283-287 
    Details
    ISSN: 0009-2940
    Keywords: Self-assembling frameworks ; Thermal stability ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Here we report on investigations that have revealed for the first time that the Cs+ ion templates the same metal germanium sulfide open-framework as (CH3)4N+ (TMA+), and that metal complexing agents enhance crystal size by at least two orders of magnitude. The synthesis, structures and thermal properties of Cs2FeGe4S10 ·× H2O and TMA2FeGe4S10 are also described. Both have 3D zinc blende-type open-framework structures. These materials have the same connectivity as TMA2MnGe4S10. The tetrahedral sites in the lattice are alternately substituted by pseudo-tetrahedral Fe2+ and adamantanoid Ge4S104- building blocks, covalently linked together by Fe(μ-S)Ge bridge bonds, to give a tetragonal unit cell. The charge-balance of the anionic framework [Fe-Ge4S10]2- is maintained by either Cs+ or TMA+ ions in the cavity spaces. Synthesis of these materials demonstrates an interesting example of a self-assembly process in which a 3D framework is built from molecular precursors. Water adsorption-desorption cycling from room temperature to 200 °C reveals framework flexibility between larger and smaller tetragonal unit cell 14 isotypes. The compound TMA2FeGe4S10 is stable in nitrogen at 350 °C and under vacuum at 450 °C. The corresponding temperatures for Cs2FeGe4S10 are 530 °C and 630°C; it is stable on cooling to room temperature under vacuum, and after subsequent exposure to air. Six hundred thirty degrees celsius is the highest recorded temperature at which the integrity of a non-oxide framework has been maintained. The framework stability and flexibility of “all-inorganic” Cs2FeGe4S10 provides an encouraging example for researchers interested in developing sulfide-based framework materials with practical applications.
    Additional Material: 6 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290307
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 72
    Electronic Resource
    Electronic Resource
    Complexes with S-Donor Ligands, 4Part 3: J. Vicente, M. T. Chicote, P. González-Herrero, P. G. Jones, J. Chem. Soc., Chem. Commun. 1995, 745.. Mono- and Di-Homo- and -Hetero-Nuclear Gold(I), Silver(I), and Palladium(II) Complexes with 2-(Methylthio)pyridine, Pyridine-2(1H)-thione, and Benzoxazole-2(3H)-thione. Some Examples of the Use of Complexes as Ligands (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 327-330 
    Details
    ISSN: 0009-2940
    Keywords: Gold complexes ; Silver complexes ; Palladium complexes ; S-Donor ; Thiones ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: AgClO4 reacts with bidentate ligands 2-(methylthio)pyridine (SMepy) or complexes PPN[Au(Spy)2] [PPN = N(PPh3)2, HSpy = pyridine-2(1H)-thione) or PPN[Au(Sbz)2] (HSbz = benzoxazole-2(3H)-thione), themselves acting as ligands, to give dinuclear complexes [Ag2(μ-SMepy)2](ClO4)2 (1), [AgAu(μ-Spy)2] (2), or [AgAu(μ-Sbz)2] (3), respectively. By treating 1 with [AuCl(tht)] (tht = tetrahydrothiophene), [Au(SMepy)(tht)]ClO4 (4) is obtained which, in turn, reacts with SMepy to give [Au(SMepy)2]ClO4 (5). Similarly, [PdCl2(NCPh)2] reacts with SMepy in 1:1 molar ratio to give [Pd2Cl2(μ-Cl)2(SMepy)2] (6) which reacts with SMepy in 1:2 molar ratio to give [PdCl2(SMepy)2] (7). On the other hand, HSpy reacts with Ag2CO3 to give [Ag2(μ-Spy)2] (8), and (SMepyH)ClO4 reacts with [Au(acac)PPh3] (acacH = acetyl-acetone) to give [Au(SMepy)PPh3]ClO4 (9).
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290313
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 73
    Electronic Resource
    Electronic Resource
    Zinc Complexes of Amino Acids and Peptides, 6. Zinc Complexes of Oligopeptides Containing Histidine at Both Termini (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 347-353 
    Details
    ISSN: 0009-2940
    Keywords: Histidine peptides ; Zinc complexes ; EXAFS analysis ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: One tripeptide, five tetrapeptides, and one pentapeptide, all containing His-Xn-His sequences and being blocked at the N and C termini with acyl and amide functions, respectively, were synthesized by solid-phase methods. With one exception their reaction with various zinc salts led to the precipitation of 1:1 (zinc/peptide) complexes. Analytically pure compounds were obtained from zinc tetrafluoroborate and His-Gly-His (1), from zinc chloride (resp. bromide) and His-Gly -Gly-His (2), His-Ala-Gly-His (3), His-Leu-Gly-His (4), His-Pro-Gly-His (5), and His-Pro-Asn-His (6) as well as from zinc sulfate and His-Leu-Gly-His (4) and His-Ala-Pro-Gly-His (7). 1H-NMR data, when available, indicate the coordination of both histidine units to zinc in all cases. The low solubility of the complexes points to their polymeric nature. The only 1:2 (zinc/peptide) complex in this series was obtained from zinc perchlorate and His-Gly-Gly-His (2). An EXAFS study revealed that it contains zinc symmetrically coordinated by four histidine imidazole ligands. Based on the available information it is proposed that all complexes are one-dimensional polymers containg [-Zn-His-Xn-His-Zn-]x backbones.
    Additional Material: 4 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290316
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 74
    Electronic Resource
    Electronic Resource
    Masthead (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996) 
    Details
    ISSN: 0009-2940
    Keywords: Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290401
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 75
    Electronic Resource
    Electronic Resource
    Silanediols Derived from Silanetriols. X-ray Crystal Structures of (2,4,6-Me3C6H2)N(SiMe3)Si(OSiMe3)(OH)2 and (2,4,6-Me3C6H2)N(SiMe3)Si(OSiMe2R)(OH)2 [R = CH2 (2-NH2-3,5-Me2C6H2)] (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 391-395 
    Details
    ISSN: 0009-2940
    Keywords: Silanediols ; Silanetriols ; Siloxanes ; Hydrogen bonding ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The silanediols RN(SiMe3)Si(OSiMe3)(OH)2 (R = 2,4,6-Me3C6H2 4, 2,6-Me2C6H3 5, and 2,6-iPr2C6H3 6) were prepared by the reactions of the respective silanetriols RN(SiMe3)-Si(OH)3 1 - 3 with SiMe3Cl in THF/hexane. Silanetriol 1 in CH2Cl2/hexane solution converts over a period of 4 weeks into the silanediol (2,4,6-Me3C6H2)N(SiMe3)Si(OSiMe2 R)-(OH)2 [R = CH2(2-NH2-3,5-Me2C6H2)] (7). Compounds 4 - 7 were characterized by means of mass, IR and NMR (1H and 29Si) spectroscopy. Additionally, the molecular structures of 4 and 7 were determined by single-crystal X-ray diffraction studies. Compound 4 forms O — H…O hydrogen-bonded tetramers in the solid state. A nine-membered ring formed by an intermolecular O—H…N hydrogen bond is found in the solid-state structure of 7.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290405
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 76
    Electronic Resource
    Electronic Resource
    Novel trialkylstibane iridium(I) and iridium(III) complexes including the x-ray crystal structure of five-Coordinate [IrCl(C2H4)2(SbiPr3)2]Dedicated to Professor Erwin Weiss on the occasion of his 70th birthday. (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 411-417 
    Details
    ISSN: 0009-2940
    Keywords: Iridium complexes ; Stibane complexes ; Hydrido complexes ; Ethene complexes ; Ligand displacement reactions ; Alkyne-to-vinylidene rearrangement ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The reaction of [IrCl(C8H14)2]2 (2) with SbiPr3 in the presence of H2 yields the dihydridoiridium(III) complex cis,mer-[IrH2Cl(SbiPr3)3] (3) which on treatment with CO and with HC≡CR (R = Ph, CO2Me) affords the octahedral derivatives [IrH2Cl(CO)(SbiPr3)2] (4) and [IrHCl(C≡CR)(SbiPr3)3] (5, 6), respectively. The stibane ligand trans to hydride in 5 and 6 is rather labile and, therefore, 5 and 6 react with pyridine to give [IrHCl(C≡CR)(py)(SbiPr3)2] (7, 8). Five-coordinate bis-(stibane)iridium(I) complexes [IrCl(C2H4)2(SbR3)2] (10-12) were prepared from [IrCl(C2H4)2]2 (9) and four equiv. of SbR3 (R = iPr, Me, Ph). The X-ray crystal structural analysis of 10 reveals a distorted trigonal-bipyramidal geometry around the metal center with one stibane ligand and the two olefinic ligands in the equatorial plane. Compound 10 reacts with NaC5H5 to yield [C5H5Ir(C2H4)(SbiPr3)] (13) and with different alkynes by partial or complete displacement of the ethene ligands to give trans-[IrCl(PhC≡CPh)(SbiPr3)2] (14), [IrHCl(C≡CTol)(C2H4)(SbiPr3)2] (15), and trans-[IrCl-{=C=C(SiMe3)R}(SbiPr3)2] (16, 17), respectively.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290409
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 77
    Electronic Resource
    Electronic Resource
    Azolylborane adducts. Structural and conformational analysis by x-ray diffraction and NMR. Protic-hydric (C=Hδ+-δ-H=B) and Protic-Fluoride (C=Hδ+-δ-F=B) interactions (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 441-449 
    Details
    ISSN: 0009-2940
    Keywords: Azolylborane adducts ; Boron-imidazole adducts ; Boron-pyridine adducts ; Protic-hydric interactions ; Protic-fluoride interactions ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The preparation, NMR and X-ray diffraction studies of a series of azolylboron hydrides derived from pyrrole, indole, and carbazole coordinated with tetrahydrofuran, pyridine, and imidazole are reported. The azolyl substituents are very electroattractive leading to an acidic boron atom which strongly coordinates with the Lewis bases. The stabilization of the =BH2=groups against disproportionation could be explained in terms of the interactions found between the acidic hydrogen atoms of the heterocycles (C=Hδ+ acceptor) and the hydrides (B=Hδ- donors).
    Additional Material: 8 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290413
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 78
    Electronic Resource
    Electronic Resource
    Masthead (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996) 
    Details
    ISSN: 0009-2940
    Keywords: Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290501
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 79
    Electronic Resource
    Electronic Resource
    The Synthesis of Stabilized Dimetallated Thioimidate Complexes by the Insertion of Ethoxycarbonylisothiocyanate into a Rhenium-Rhenium Bond (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 485-487 
    Details
    ISSN: 0009-2940
    Keywords: Dimetallations ; Insertions ; Rhenium ; Isothiocyanates ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Molecules containing dimetallated hydrocarbyl groupings are of great chemical interest[1-3]. These groupings often represent intermediates in important catalytic processes[4]. Recently, we have shown that substituted dimetallated olefins can be formed by alkyne insertion into the metal-metal bonds of certain dinuclear complexes[2,5]. Complexes having dimetallated hydrocarbyl groups combined with heteroatoms are quite rare[6]. Herein is described the formation of a dimetallathioimidate grouping by the insertion of an organic isothiocyanates into an unsupported metal-metal bond. Organic isothiocyanates are useful reagents in organic synthesis[7], but the organometallic chemistry of these molecules is not yet well developed[8].
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290503
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 80
    Electronic Resource
    Electronic Resource
    Supermolecules Containing a Tetrahedral Core: A New Class of Liquid-Crystalline Siloxanes (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 521-525 
    Details
    ISSN: 0009-2940
    Keywords: Liquid crystals ; Siloxanes ; Phase behaviors ; Defined topology ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: It is shown that supermolecules with a tetrahedral symmetry and appropriate side-chains exhibit liquid-crystalline phase behaviour. The use of an optimised hydrosylation reaction allows for the synthesis of materials that have four mesogenic groups attached to a siloxane core, where the conformation and the configuration are unambiguous. The materials show low glass transition temperatures and, depending on the spacer length, complex liquid-crystalline morphologies.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290508
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 81
    Electronic Resource
    Electronic Resource
    Transition Metal Complexes with Sulfur Ligands, Part 119Part 118: D. Sellmann, H.-J. Kremitzl, F. Knoch, M. Moll, J. Biol. Anorg. Chem., in press.. Synthesis of Water Soluble Fe and Ru Complexes with Novel Multidentate Thioether Thiolate Ligands Containing Carboxylate Substituents (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 509-519 
    Details
    ISSN: 0009-2940
    Keywords: Iron and ruthenium complexes ; Water soluble complexes ; Sulfur ligands ; X-ray structure analyses ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: In search of water soluble transition metal complexes with sulfur dominated coordination spheres that model key reactions of nitrogenases, the benzenedithiol derivatives ‘CO2HS2’-H2 (1) and ‘CO2Me-S2’-H2 (2) were synthesized as precursors for multidentate sulfur ligands. The template alkylation of 2 by C2H4Br2 at [Fe(CO)2] fragments yielded a mixture of two diastereomeric C2 symmetrical [Fe(CO)2(‘CO2Me-S4’)] complexes (4a and 4b), which were separated by crystallization. The hydrolysis of the mixture of the diastereomers 4a and 4b led to the isomerically pure tetradentate thioether thiol ligand ‘CO2Me-S4’-H2 (5) proving the regioselectivity of the template alkylation of the asymmetrical dithiol 2. The C1 symmetrical [Fe(‘CO2Me-S2’)2]2- anion is an intermediate of the template alkylation and was isolated as (AsPh4)2 [Fe(‘CO2Me-S2’2] (11), 4a, 5 and 11 were characterized by X-ray structural analysis. Saponification of the methyl ester groups of 5 yielded ‘CO2H-S4’-H2 (7). Treatment of 7 with FeCl2 · 4 H2O in the presence of CO and LiOMe gave a mixture of two C2 symmetrical and water soluble diastereomers of Li2[Fe(CO)2(‘CO2-S4’)] (8). Upon treatment with [RuCl2 (PPh3)3] 7 yielded isomerically pure [Ru(PPh3)2-(‘CO2H-S4’)] (9). 9 also exhibits C2 symmetry and could be reversibly deprotonated to form the water soluble complex K2[Ru(PPh3)2 (‘CO2-S4’)] (10). Treatment of (NBu4)2 (‘CO2MeS2’) with “Ru(NO)Cl3” led to isomerically pure (NBu4)[Ru(NO)(‘CO2Me-S2’)2] (12).
    Additional Material: 6 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290507
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 82
    Electronic Resource
    Electronic Resource
    Syntheses and Photochemistry of Fluorinated and Chlorinated Titanium Porphyrinates: Crystal Structure of Oxotitanium meso-Tetrakis(2,3,4,5,6-pentafluorophenyl)porphyrinate (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 833-836 
    Details
    ISSN: 0009-2940
    Keywords: Oxotitanium(IV) porphyrinate ; Peroxotitanium(IV) porphyrinate ; Photochemistry ; Singlet oxygen ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The syntheses of oxotitanium(IV) meso-tetrakis(2,3,4,5,6-pentafluorophenyl)porphyrinate O=Ti(TPPF20) (1), oxotitanium(IV) meso-tetrakis(2,6-difluorophenyl)porphyrinate O=Ti-(TPPF8) (3), and oxotitanium(IV) meso-tetrakis(2,6-dichlorophenyl)porphyrinate O=Ti(TPPCl8) (5) from titanium tetrachloride and the corresponding porphine are described. The structure of 1 was determined by single-crystal X-ray diffraction. The reaction of oxotitanium porphyrinates with aqueous hydrogen peroxide leads to the corresponding light-sensitive peroxotitanium(IV) complexes: Ti(O2)(TPPF20) (2), Ti(O2)-(TPPF8) (4), Ti(O2)(TPPCl8) (6). All complexes are efficient and stable photosensitizers for the generation of singlet oxygen.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290715
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 83
    Electronic Resource
    Electronic Resource
    Syntheses of Hetero-sila-closo-boranes (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 837-839 
    Details
    ISSN: 0009-2940
    Keywords: Boron compounds ; Silaboranes ; Dihetero-closo-borane ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Addition of 3 equivalents of KH · BEt3 to [Me3NH][Me-SiB10H12] followed by addition of one equivalent of SnCl2 or SbI3 affords the stanna-sila-closo-borate(1-) 3 and stiba-sila-closo-borane 4, respectively. [MePh3P] · 3 crystallizes in the orthorhombic space group P212121.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290716
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 84
    Electronic Resource
    Electronic Resource
    Intramolekular stabilisierte Übergangsmetallamide: 2-(Dimethylaminomethyl)pyrrolyl-Komplexe des Titan(III), Vanadium(III), Chrom(III), Cobalt(II) und Nickel(II) (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 853-857 
    Details
    ISSN: 0009-2940
    Keywords: Amides ; Pyrrolyl complexes ; Chelate complexes ; Transition-metal complexes ; Metallacycles ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Intramolecularly Stabilized Metal Amides: 2-(Dimethylaminomethyl)pyrrolyl Complexes of Titanium(III), Vanadium(III), Chromium(III), Cobalt(II) and Nickel(II)By the metallation of 2-(dimethylaminomethyl)pyrrol (HL) with butyllithium the lithium pyrrolide LiL (1) was obtained. The reactions of 1 with TiBr3 · 3 THF, VBr3 · 3 THF, CrBr3 · 3 THF, CoBr2 · 2 THF, and NiBr2 · 1.67 THF result in the formation of the 2-(dimethylaminomethyl)pyrrolyl complexes of type ML3 (2-4), and ML2 (5, 6), respectively. The structures of these new compounds are discussed on the basis of magnetic and visible absorption measurements. An X-ray crystal structure determination of 4 reveals a strongly distorted octahedral environment of the chromium atom with facial arrangement of the ligands.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290719
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 85
    Electronic Resource
    Electronic Resource
    Stepwise Insertion of Alkylisocyanides into the Metal-Alkyne Bond of Half-Sandwich Type Rhodium Complexes: Synthesis and Structural Characterization of Metallacyclobutenes and MetallacyclopentenesDedicated to Professor Gerhard E. Herberich on the occasion of his 60th birthday. (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 903-910 
    Details
    ISSN: 0009-2940
    Keywords: Rhodium complexes ; Alkyne complexes ; Insertion reactions ; Alkyl isocyanides ; Metallacycles ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The cyclopentadienyl complexes [C5H5Rh(RC≡CR′)(SbiPr3)] (5-8), which were prepared from trans-[RhCl-(RC≡CR′)(SbiPr3)2] (1-4) and NaC5H5 and which contain a labile Rh-SbiPr3 bond, reacted with CO and CNR″ (R″ = Me, tBu) to give the carbonyl and isocyanide derivatives [C5H5Rh(RC≡CR′)(CO)] (9-11) and [C5H5Rh(RC≡CR′)-(CNR″)] (12-16), respectively. On treatment of 12 (R = R′ = Ph; R″ = Me) with SbiPr3, the metallacyclobutene complex [C5H5Rh{κ2(C,C}-C( = NMe)CPh=CPh}(SbiPr3)] (17) was formed; it reacts with excess CNMe or CNtBu to yield the metallacyclopentenes [C5H5Rh{κ2(C,C)-C(=NMe)CPh=CPhC-(=NR)}(CNR)] (18, 19). Similar compounds 20-23 containing a five-membered RhC4 metallacycle were prepared either from [C5H5Rh(RC≡CR′)(SbiPr3)] (7, 8) or [C5H5Rh-(PhC≡CPh)(CNtBu)] (14) and excess isocyanide. The crystal and molecular structures of 17 and 18 (R = Me) have been determined.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290805
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 86
    Electronic Resource
    Electronic Resource
    Isolation and Spectroscopic Characterization of Heteroleptic, Anionic and Neutral (Phthalocyaninato)(tetra-4-pyridylporphyrinato)lanthanide(III) Double-DeckersDedicated to Professor Shang-Wai Tam on the occasion of his retirement from The Chinese University of Hong Kong. (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 933-936 
    Details
    ISSN: 0009-2940
    Keywords: Phthalocyanines ; Porphyrins ; Lanthanide(III) compounds ; Macrocyclic ligands ; Double-decker complexes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Treatment of 5,10,15,20-tetra-4-pyridylporphyrin [(TPyP)H2] with europium(III) or gadolinium(III) acetylacetonate [Ln(acac)3 · nH2O] (Ln = Eu, Gd) in 1,2,4-trichlorobenzene produced Ln(acac)(TPyP), which reacted with dilithium phthalocyaninate [Li2(Pc)] to give Li[Ln(Pc)(TPyP)] in moderate yields. Upon exposure to air, solutions of these compounds converted slowly to the corresponding neutral complexes Ln(Pc)(TPyP). The new compounds were spectroscopically characterized.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290809
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 87
    Electronic Resource
    Electronic Resource
    Synthesis, Spectroscopic Characterization, and Crystal Structure Determination of Cationic [(Cyclopentadienyl)dicarbonyliron](alkynyl)-aminocarbene Complexes (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 937-944 
    Details
    ISSN: 0009-2940
    Keywords: Iron acyl complexes ; (Alkynyl)carbene ligand ; Cationic aminocarbene complexes ; Iron (2-methoxyvinyl)aminocarbene complexes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: (Alkynoyl)iron complexes 1, Cp(CO)2Fe(O=CC≡CR) (R = CH3, Ph, SiMe3), were synthesized by applying a mixed anhydride procedure and transformed into the cationic methoxycarbene complexes 2, [Cp(CO)2 Fe(C(OMe)C≡CR)+]-[PF6-]. Primary amines H2NR′ react with the methoxycarbene complexes to furnish exclusively cationic aminocarbene complexes 3, [Cp(CO)2 Fe(C(NHR′)C≡CR)+][PF6-], or (2-methoxyvinyl)aminocarbene complexes 5. The spectroscopic properties of the new complexes are discussed. The (alkynyl)-aminocarbene complexes 3e and 3f were characterized by X-ray crystal structure analysis.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290810
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 88
    Electronic Resource
    Electronic Resource
    Synthesis and Characterization of Novel Phthalocyanines with Four 16-Membered Diazadithia Macrocycles (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 967-971 
    Details
    ISSN: 0009-2940
    Keywords: Phthalocyanines, sulphonated ; Diazadithiamacrocycles ; Pentanuclear complex ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Metal phthalocyanines (M = Cu, Ni, Co) 3-5 bearing four 16-membered diazadithia macrocycles at the peripheral positions were prepared. Detosylation with concentrated sulfuric acid afforded products containing both sulfonated groups on the aromatic rings of the macrocyclic substituents which are excellently soluble in water and donor sites for binding four CuII ions to give a pentanuclear complex.
    Additional Material: 2 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290815
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 89
    Electronic Resource
    Electronic Resource
    A Search for Thionitrosyl Chloride (Cl-N=S) in the Gas Phase (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 1379-1381 
    Details
    ISSN: 0009-2940
    Keywords: Thionitrosyl chloride ; Thiazyl chloride ; Neutralization-reionization mass spectrometry ; Calculations, ab initio ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Ab initio MO calculations at the QCISD(T)/6-311++G(3df,2p) + ZPE level show that the thionitrosyl chloride ion, ClNS+•, is 36 kJ/mol more stable than the thiazyl chloride ion, NSCl+•, whereas neutral NSCl is 77 kJ/mol more stable than ClNS [IEa (ClNS) = 9.2 ± 0.3 eV, IEa (NSCl) = 10.5 ± 0.3 eV]. Mild flash-vacuum pyrolysis of the thiazyl chloride trimer (NSCl)3 followed by electron impact ionization resulted in the formation of [N,S,Cl]+• ions (m/z 81). The fragments observed in the CA spectrum of these ions indicate the formation of both NSCl+• and ClNS+• ions. A very weak recovery signal is observed in a neutralizationreionization experiment. This signal is tentatively assigned to the neutral thionitrosyl chloride.
    Additional Material: 4 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961291111
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 90
    Electronic Resource
    Electronic Resource
    Synthesis and Reactivity of Some Nitroaryl Complexes of HgII and AuIII  -  Synthesis of a Substituted Biphenyl by C-C Coupling - Crystal Structure of [Hg(C6H4NO2-3, OnBu-6)2] (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 1395-1399 
    Details
    ISSN: 0009-2940
    Keywords: Gold ; Mercury ; Nitroaryl ; Transmetallation ; Biaryl ; C-C Coupling ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: 4-Butoxynitrobenzene reacts with [Hg(O2CCF3)2] and LiCl to give [Hg(R)Cl] [R = C6H3NO2-3, OnBu-6 (1)] which is symmetrized by Me4NCl to give [HgR2] (2), the crystal structure of which has been determined. The reaction of 2 with Me4N[AuCl4] affords Me4N[Au(R)Cl3] (3) by a facile transmetallation process. Complex 3 reacts with PPh3 (1:1) to give cis-[Au(R)(PPh3)Cl2] (4). The diaryl complex [-Ph-2)(R)Cl] (5) is obtained by reaction of 3 with [Hg-(C6H4N=NPh-2)2] through a second transmetallation reaction. Complex 5 and PPh3 (1:1) give [AuClPPh3] and the C-C coupling biphenyl RC6H4N=NPh-2 (6).
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961291114
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 91
    Electronic Resource
    Electronic Resource
    Sulfenato, Thiosulfinato, and Thiosulfonato Transition Metal ComplexesDedicated to Professor M. Herberhold on the occasion of his 60th birthday. (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 1409-1419 
    Details
    ISSN: 0009-2940
    Keywords: Sulfenic acid anions ; Thiosulfinic acid anions ; Thiosulfonic acid anions ; Transition metal complexes ; Stereochemistry ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The synthesis and coordination chemistry of sulfenic, thiosulfinic, and thiosulfonic acid anions are reviewed. Different approaches, which yield the platinum(II) and ruthenium(II) complexes containing the anionic sulfur(0), sulfur(II), and sulfur(IV) oxid ligands, are described. The oxidative addition of thiosulfinates or N-sulfinyl phthalimides to platinum(0) complexes L2Pt(C2H4) [L = PPh3, 1/2 PPh2CH2CH2PPh2, 1/2 (R,R)-(-)-DIOP, 1/2 (C5H4PPh2)Fe(C5H4PPh2) leads to sulfenato complexes; those of N-thiosulfinyl phthalimidies or trisulfid 1-oxides afford the thiosulfinato complexes. Moreover, the reactions of CpRu(PPh3)(L)(SH) (L = CO, PPh3) with N-sulfinyl phthalimides forming the thiosulfinato moiety, are reported. The spectroscopic, structural and chemical properties of these complexes are discussed.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961291202
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 92
    Electronic Resource
    Electronic Resource
    Cationic Iron Aminocarbene Complexes as Dienophiles in Diels-Alder Reaction with Cyclopentadiene (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 1057-1059 
    Details
    ISSN: 0009-2940
    Keywords: (Alkynyl)carbene ligands ; Iron acyl complexes ; Cationic iron aminocarbene complexes ; Diels-Alder reactions ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The cationic iron (alkynyl)aminocarbene complexes [Cp(CO)2Fe(C(NHR)C≡CSiMe3][PF6], (R = C6H5, p-CH3C6H4) 1 derived from aromatic amines smoothly react with cyclopentadiene in dichloromethane to yield the cycloadducts 2. No reaction was observed for complexes derived from sterically demanding aliphatic amines, like L-alanine tert-butyl ester. For comparison, the alkynyl-substituted acyl iron compounds Cp(CO)2Fe(C=O)C≡C̊ (R = SiMe3, C6H5) 3 were investigated, requiring TiCl4 catalysis to undergo the cycloaddition reaction. The structures of the cycloadducts 4 were determined by X-ray crystallography.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290913
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 93
    Electronic Resource
    Electronic Resource
    Synthesis, Structure and Reactions of the Homoleptic Alkyne Nickel(0) Complex (Alkyne)4Ni3 (Alkyne: 2-methyl-4-trimethylsilyl-3-butyn-2-ol)Dedicated to Professor Walter Siebert on the occasion of his 60th birthday. (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 1457-1461 
    Details
    ISSN: 0009-2940
    Keywords: Nickel(0) ; Alkyne complexes ; Hydrogen bonds ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Treatment of (cdt)Ni (cdt: cyclododeca-1,5,9-triene) with 2 equivalents of 2-methyl-4-trimethylsilyl-3-butyn-2-ol leads to the selective formation of the homoleptic complex (alkyne)4Ni3 (compound 3), which can be isolated in excellent yields. The solid-state structure of 3 exhibits three Ni centers, forming a bent Ni3 chain connected by two bridging alkynes. The other two alkynes are terminally coordinated. Additionally, the trimeric units are stabilized by three intramolecular hydrogen bonds. Two intermolecular hydrogen bonds connect the trimeric units to form a polymer rope. According to the 13C- and 1H-NMR spectra in THF the structure of the complex 3 in solution is very similar to that in the solid state. The reaction of 3 with some alkynediols and with 2,5,5-trimethylhex-3-yn-2-ol affords compounds of the type (alkyne)2Ni. Cot (cot: 1,3,5,7-cyclooctatetraene) converts 3 into [(cot)Ni]2, which in turn reacts with 2,5-dimethylhex-3-yne-2,5-diol to form the dimeric complex (alkyne)2Ni2(cot) 6. X-ray analysis of 6 reveals a very symmetrical structure in which cot connects both Ni(0) centers at opposite sides of the ring system.
    Additional Material: 4 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961291210
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 94
    Electronic Resource
    Electronic Resource
    Control of the SO2 Coordination Mode at the (Monochelate)rhodium Complex ClRh(P∼O) with the Hemilabile Ligand Cy2PCH2CH2OCH3Dedicated to Professor Michael Hanack on the occasion of his 65th birthday. (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996), S. 1103-1105 
    Details
    ISSN: 0009-2940
    Keywords: Sulfur dioxide ; Rhodium complexes ; Ether-phosphanes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The SO2 coordination mode at the rhodium complex [ClRh(P∼O)()] (1) [ = η2(O,P)-chelated Cy2PCH2CH2OCH3 ligand; P∼O = =1(P)-coordinated] is controlled by the hemilabile ligand Cy2PCH2CH2OCH3 and shows a dependence on the polarity of the solvent. In polar organic solvents (e.g. acetone) the addition of sulfur dioxide results in the formation of a trigonal-pyramidal oriented SO2 group in [ClRh(η1-SO2)(P∼O)()] (2a). However, in nonpolar media (e.g. n-hexane) a trigonal-coplanar geometry of the SO2 unit in [ClRh(η1-SO2)(P∼O)2] (2b) is favored.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961290920
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 95
    Electronic Resource
    Electronic Resource
    Masthead (1996)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 129 (1996) 
    Details
    ISSN: 0009-2940
    Keywords: Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19961291001
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 96
    Electronic Resource
    Electronic Resource
    Synthesis and Characterization of β-Phosphaenones An Investigation on the Conjugative Properties of the P=C Bond (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 465-476 
    Details
    ISSN: 0009-2940
    Keywords: Phosphaalkenes, C-halo, C-metal ; Phosphaacrylic acid ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Thermally and air-stable β-phosphaenones were synthesized by functionalization of Mes*P=CCl2 (1; Mes* = supermesityl = 2,4,6-tri-tert-butylphenyl). At low temperature, 1 was lithiated by halogen-metal exchange with n-butyllithium to give the phosphanylidene carbenoid (Z)-Mes*P=C(Cl)Li [(Z)-2] which reacted with acid chlorides to furnish the C-carbonyl-substituted phosphaalkenes (Z)-Mes*P=C(Cl)R (3: P = COtBu; 4: R = COPh; 5: R = COOEt). The reaction of (Z)-2 with carbon dioxide furnished the carboxylate 6, which was converted by treatment with pivaloyl chloride or trimethylsilyl chloride into the phosphaalkenes 7 and 8 functionalized at the carbon atom by an anhydride or a trimethylsilyl ester function, respectively. Acidification of 6 or hydrolysis of 8 with water in chloroform solution afforded the novel carboxylic acid (Z)-Mes*P=C(Cl)COOH (9). Spectroscopic investigations (NMR, UV, IR) of 3-9 and the X-ray structures of 3 and 4 are presented. Based on these properties and on theoretical calculations, the occurrence of conjugation in the β-phosphaenone system is discussed and compared with the well-known conjugation in normal enones.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280506
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 97
    Electronic Resource
    Electronic Resource
    Reactions of Phosphaalkenes with HexafluoroacetoneDedicated to Professor H. M. R. Hoffmann on the occasion of his 60th birthday. (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 499-502 
    Details
    ISSN: 0009-2940
    Keywords: Phosphaalkenes ; Cycloadditions ; Insertion reactions ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The dimethylamino-substituted phosphaalkene 1 reacts with hexafluoroacetone (HFA) with addition at the P=C bond to form the 1,5,2-dioxaphosphorinane 2. The structure of 2 was confirmed by an X-ray crystal structure analysis. The six-membered ring displays an envelope conformation with the phosphorus atom out of the plane, but the phosphorus is disordered over two sites. Reaction of P-trimethylsilyl-substituted phosphaalkenes with HFA proceeds with retention of the P=C double bond and insertion of HFA into the P—Si bond. Two isomeric products are obtained and are characterized by 1H-, 13C-, 19F-, and 31P-NMR spectroscopy, IR spectroscopy, mass spectrometry, and elemental analysis.
    Additional Material: 1 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280511
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 98
    Electronic Resource
    Electronic Resource
    Monomere (Acetylacetonato)kupfer(I)-Komplexe von Alkinen und 1,4-Diinen (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 525-529 
    Details
    ISSN: 0009-2940
    Keywords: Copper complexes ; Acetylacetonate ; Alkynes ; 1,4-Diynes ; Titanocenes ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Monomeric (Acetylacetonato)copper(I) Complexes of Alkynes and 1,4-DiynesMonomeric (η2-Me3SiC≡CSiMe3)Cu(acac) (3) is formed by the reaction of dimeric [(η2-Me3SiC≡CSiMe3)CuBr]2 (1) with two equivalents of Na(acac) (2). In a similar manner Me2-Si(C≡CSiMe3)2 (4) reacts with CuCl (5) and 2 to afford Me2Si[(η2-C≡CSiMe3)Cu(acac)]2 (6). In compounds 3 and 6 an alkyne unit is η2-coordinated to a monomeric Cu(acac) moiety with a copper atom in a planar environment. With the organometallic 1,4-diyne (η5-C5H4SiMe3)2Ti(C≡CSiMe3)2 (7), compound [(η5-C5H4SiMe3)2Ti(C≡CSiMe3)2]Cu(acac) (8) is formed. In 8 both Me3SiC≡C ligands of the 3-titanapenta-1,4-diyne fragment are η2-coordinated to a monomeric Cu-(acac) building block. The copper atom in 8 possesses a pseudo-tetrahedral environment (shown by X-ray analysis), built by the two Me3SiC≡C ligands of the (η5-C5H4SiMe3)2-Ti(C≡CSiMe3)2 moiety and the two oxygen atoms of the acetylacetonato ligand. 8 is additionally formed by the reaction of 3 or 6 with 7, or by treatment of [(η5-C5H4SiMe3)2Ti(C≡C-SiMe3)2]CuCl (9) with Na(acac) (2). The application of 3, 6, and 8 as precursors for the preparation of copper films in the CVD process of copper(I) is discussed.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280515
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 99
    Electronic Resource
    Electronic Resource
    Chiral Organometallic Reagents, XIIIPart XII: Ref.. Structural Aspects of Differentially Solvated Benzyllithium Contact Ion Pairs (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 551-556 
    Details
    ISSN: 0009-2940
    Keywords: Benzyllithium compounds ; Ion pairs ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The solvation and ion pair nature of α-(phenylthio)benzyllithium (2d) in THF solution were investigated by NMR-spectroscopic methods. The effect of additives such as diethylene-glycol dimethyl ether or of 12-crown-4 was studied. The results were compared to those of benzyllithium compounds 4 and 6, containing a pentaoxapentadecane ansa chain. These compounds exist as contact ion pairs in which lithium is held at the anionic carbon. This is reflected in the 6Li,13C coupling and 1H,6Li-HOESY contacts in the NMR spectra.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280604
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 100
    Electronic Resource
    Electronic Resource
    Sulfur Compounds, Part 186Part 185: K. Bergemann, M. Kustos, P. Krüger, R. Steudel, Angew. Chem., in print.. The Synthesis of Cyclic Organosulfur Compounds from (C5H5)4Ti2C2S4 by Ligand Transfer Reactions (1995)
    Weinheim : Wiley-Blackwell
    Berichte der deutschen chemischen Gesellschaft 128 (1995), S. 561-564 
    Details
    ISSN: 0009-2940
    Keywords: Titanocene complexes ; Organosulfur ligands ; Ligand transfer ; Organosulfur heterocycles ; Sulfur-sulfur bonds ; Chemistry ; Inorganic Chemistry
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The tetrathiaoxalate complex Cp4Ti2C2S4 (1) reacts with an equimolar amount of COCl2 to give the blue-green mononuclear complex Cp2TiC2S4CO (4). This reaction is analogous to the known reactions of 1 with SCl2 or S2Cl2. However, when 1 was treated with equimolar amounts of the bifunctional sulfenyl chlorides 1,2-C2H4(SCl)2 (5), 1,3-C3H6(SCl)2 (6) or 1,2-C6H4(SCl)2 (7), the bi- or monocyclic tetrakisdisulfanes C6H8S8 (9b), C8H12S8 (10), and C14H8S8 (11), respectively, were obtained. The X-ray crystal structure analysis of 11 · CS2 showed that 11 possesses Ci symmetry with a central exocyclic CC double bond similar to tetrathiafulvalenes: C6H4(μ-S2)2C=C(μ-S2)2C6H4.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/cber.19951280606
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...