ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Elasticity
  • Springer  (68)
  • American Institute of Physics (AIP)
  • Nature Publishing Group
  • Periodicals Archive Online (PAO)
  • 1
    Electronic Resource
    Electronic Resource
    Elasticity of the pyrope (Mg3Al2Si3O12)-majorite (MgSiO3) garnets solid solution (2000)
    Springer
    Physics and chemistry of minerals 27 (2000), S. 445-452 
    Details
    ISSN: 1432-2021
    Keywords: Keywords Garnets ; Polycrystals ; Hot-pressing ; Elasticity ; Interferometry
    Source: Springer Online Journal Archives 1860-2000
    Topics: Chemistry and Pharmacology , Geosciences , Physics
    Notes: Abstract Dense isotropic polycrystalline specimens of majorite-rich garnets (Py100, Py62Mj38, Py50Mj50, Py21Mj79 and Mj100) along the pyrope (Mg3Al2Si3O12 = Py100)-majorite (MgSiO3 = Mj100) join were fabricated in a 2000-ton uniaxial split-sphere anvil apparatus (USSA-2000) at pressures from 10 to 18.5 GPa and temperatures from 1200 to 1850 °C, within their stability fields in runs of 2–4-h duration, using hot-pressing techniques developed by Gwanmesia et al. (1993). These specimens are single-phased, fine-grained (≤5 mm), free of microcracks, and have bulk densities greater than 99% of the corresponding single-crystal X-ray density. Elastic compressional (P) and shear (S) wave velocities were determined at room pressure and temperature for these polycrystalline garnet specimens by phase comparison ultrasonic interferometry. For Mj100, the P and S wave velocities are within 1% of the Hashin-Shtrikman averages calculated from the single crystal elastic moduli measured by Brillouin spectroscopy. Both the elastic bulk modulus (K) and the shear modulus (G) decrease continuously with increasing majorite content from pyrope garnet (Py100) to pure majorite garnet (Mj100). The compositional dependence of K and G are given by K = 172.3 (40) − 0.085X, and G = 91.6 (10) − 0.038X, where X = mol% majorite), respectively, indicating that substitution of Si for Mg and Al decreases both K and G by about 5% along the solid solution series.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002699900054
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 2
    Electronic Resource
    Electronic Resource
    Measurement of the elasticity of the actin tail of Listeria monocytogenes (2000)
    Springer
    European biophysics journal 29 (2000), S. 134-140 
    Details
    ISSN: 1432-1017
    Keywords: Key wordsListeria monocytogenes ; Cell motility ; Actin gel ; Elasticity ; Optical tweezers ; Cell mechanics
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Physics
    Notes: Abstract We report biophysical experiments performed on the bacterium Listeria monocytogenes, a model system to study actin-based motility. Using optical tweezers and electrophoresis experiments, we find that the bacterium is firmly attached to its tail, and we demonstrate that the tail responds as an elastic gel when deformed. We have measured its elastic modulus at a value of 103–104 Pa, which is 10 times higher than the rigidity of the eukaryotic cytoplasm. These results demonstrate that the bacterium and its tail form a very robust system, consistent with the steadyness of the motion observed in vivo. We propose an elastic model for the propulsion mechanism which takes into account the connection and thus the interaction between the actin filaments. It provides a generic description of the various aspects of actin-tail based movements.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002490050258
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 3
    Electronic Resource
    Electronic Resource
    Shear circular dislocation loops investigated with elasticity theory and atomistic simulations (2000)
    Springer
    Journal of computer-aided materials design 7 (2000), S. 25-42 
    Details
    ISSN: 1573-4900
    Keywords: Copper ; Dislocation ; Elasticity ; Molecular dynamics
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract The elastic fields of displacements, strains, and stresses for a shear circular loop are obtained with the Burgers formula. In addition, interactions between two shear circular loops are obtained based on elasticity theory. A series of molecular dynamics (MD) simulations on a shear circular partial dislocation loop in copper have been performed to examine the elastic solutions. It is found that the results of the MD simulations are in good agreement with those of elasticity theory for a loop with radius ∼7.5 nm.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1008766500345
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 4
    Electronic Resource
    Electronic Resource
    Complex hypersingular integral equation for the piece-wise homogeneous half-plane with cracks (2000)
    Springer
    International journal of fracture 102 (2000), S. 177-204 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; half-plane ; boundary integral equations ; hypersingular.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract New complex hypersingular integral equation (CHSIE) is derived for the half-plane containing the inclusions (which can have the different elastic properties), holes, notches and cracks of the arbitrary shape. This equation is obtained by superposition of the equations for each homogeneous region in a half-plane. The last equations follow from the use of complex analogs of Somigliana's displacement and stress identities (SDI and SSI) and Melan's fundamental solution (FS) written in a complex form. The universal numerical algorithm suggested before for the analogous problem for a piece-wise homogeneous plane is extended on case of a half plane. The unknown functions are approximated by complex Lagrange polynomials of the arbitrary degree. The asymptotics for the displacement discontinuities (DD) at the crack tips are taken into account. Only two types of the boundary elements (straight segments and circular arcs) are used to approximate the boundaries. All the integrals involved in CHSIE are evaluated in a closed form. A wide range of elasticity problems for a half-plane with cracks, openings and inclusions are solved numerically.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1007633814813
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 5
    Electronic Resource
    Electronic Resource
    Interaction among a row of ellipsoidal inclusions (2000)
    Springer
    International journal of fracture 102 (2000), S. 371-392 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; body force method ; singular integral equations ; numerical analysis ; three-dimensional analysis ; stress concentration factor ; ellipsoidal inclusion.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract In this paper the interaction among a row of N ellipsoidal inclusions of revolution is considered. Inclusions in a body under both (A) asymmetric uniaxial tension in the x-direction and (B) axisymmetric uniaxial tension in the z-direction are treated in terms of singular integral equations resulting from the body force method. These problems are formulated as a system of singular integral equations with Cauchy-type or logarithmic-type singularities, where unknowns are densities of body forces distributed in the r,θ,z directions. In order to satisfy the boundary conditions along the ellipsoidal boundaries, the unknown functions are approximated by a linear combination of fundamental density functions and polynomials. The present method is found to yield rapidly converging numerical results for interface stresses. When the elastic ratio E 1⇒E I/E M〉1, the primary feature of the interaction is a large compressive or tensile stress σn on the interface θ=0. When E 1⇒E I/E M〈1, a large tensile stress σθ or σt on the interface θ=1/2π is of interest. If the spacing b/d and the elastic ratio E I/E M are fixed, the interaction effects are dominant when the shape ratio a/b is large. For any fixed shape and spacing of inclusions, the maximum stress is shown to be linear with the reciprocal of the squared number of inclusions.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1007604809440
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 6
    Electronic Resource
    Electronic Resource
    A Note on Elasticity and Price Dispersions in the Music Recording Industry (2000)
    Springer
    Review of industrial organization 17 (2000), S. 465-470 
    Details
    ISSN: 1573-7160
    Keywords: Elasticity ; music recording industry ; oligopoly ; price dispersions
    Source: Springer Online Journal Archives 1860-2000
    Topics: Economics
    Notes: Abstract The present note examines price dispersions inthe music recording industry between new release andmid-line (older) recordings. The model employs theframework developed within the industrial economicsliterature and provides empirical results suggestingthat new release prices are lower than those ofmid-level recordings. This result follows fromdiffering buyer characteristics and varying levelsof close substitutes, leading to higher demandelasticities for new release recordings. Finally,the theoretical expectations should hold in thepresence of either significant scale economies ormodest minimum efficient scales of production.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1007820616596
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 7
    Electronic Resource
    Electronic Resource
    Rheological properties of fresh and cryopreserved human arteries tested in vitro (2000)
    Springer
    Rheologica acta 39 (2000), S. 461-468 
    Details
    ISSN: 1435-1528
    Keywords: Key words In vitro tests ; Elasticity ; Human artery ; Cryopreservation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Chemistry and Pharmacology , Physics
    Notes: Abstract Cryopreservation is widely used to preserve blood vessels for a while but is controversially suspected to affect the mechanical behavior of these allografts. The aim of this study was to determine whether differences in the three-dimensional mechanical behavior exist or not between fresh and cryopreserved arteries. Using a previously developed experimental system, in vitro inflation tests were performed on twenty segments of human fresh and cryopreserved arteries, in static conditions. Opening angles were also measured from images of rings in zero-stress state. The initial reference state was chosen as the unloaded state and tests were performed on specimens stretched at natural “in vivo” length. Mechanical measures calculated are “natural” (Hencky) strains (finite deformations), “true” (Cauchy) stresses in radial, circumferential, and longitudinal directions as well as strain energy per unit volume. Tangent moduli are derived from radial and circumferential stress-strain characteristics using non-linear curve fitting. Values of incremental and pressure-strain elastic parameters, wall stiffness, and compliance per unit length are also calculated. Results are presented in terms of characteristics of stresses and strains in the three directions, axial force, tangent moduli vs strains or stresses, and energy per unit volume, for both types of artery, with reference to transmural pressure. Detailed numerical results are given at mean transmural pressure or in the physiological range. Significant differences are indicated by statistic Student T-tests. Results obtained show that significant differences exist between rheological properties of fresh and cryopreserved segments of human artery. Strains, stresses, axial force, strain energy, and wall stiffness values highlight those differences whereas elastic parameters, compliance, and opening angle do not. The usefulness of some parameters to compare the mechanical behavior existing between fresh and cryopreserved arteries is therefore underlined.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s003970000110
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 8
    Electronic Resource
    Electronic Resource
    Application of a new separation analyzer for the characterization of dispersions stabilized with clay derivatives (2000)
    Springer
    Colloid & polymer science 278 (2000), S. 369-374 
    Details
    ISSN: 1435-1536
    Keywords: Key words Separation analyzer ; Organoclay dispersions ; Elasticity ; Emulsion stability ; Emulsions stabilized by clay derivatives
    Source: Springer Online Journal Archives 1860-2000
    Topics: Chemistry and Pharmacology , Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract The performance of a newly developed separation analyzer is demonstrated by characterization of the sedimentation kinetics and the swelling behavior of organoclays in binary solvent mixtures (toluene/cyclohexane) as well as by investigation of oil-in-water and water-in-oil emulsions stabilized by clay derivatives. The automatic measuring system – LUMiFuge 114 – is based on a special centrifuge with an integrated optoelectronic sensor system which allows the measuring of spatial and temporal changes of light transmission during the rotation in a variable centrifugal field (12–1200g). By using the new device a fast and reproducible characterization of settling behavior and dispersion stability was possible. Moreover, the evaluation of the long-term stability of samples with high separation stability as well as of the heterogenity of the separation process, the sample transparency and the elasticity of the sediment as a function of alternating centrifugal force could be carried out.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s003960050527
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 9
    Electronic Resource
    Electronic Resource
    Anisotropy of Young's modulus of human tibial cortical bone (2000)
    Springer
    Medical & biological engineering & computing 38 (2000), S. 333-338 
    Details
    ISSN: 1741-0444
    Keywords: Biomechanics ; Cortical bone ; Young's modulus ; Anisotropy ; Elasticity ; Ultrasonics
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Chemistry and Pharmacology , Medicine
    Notes: Abstract The anisotropy of Young's modulus in human cortical bone was determined for all spatial directions by performing coordinate rotations of a 6 by 6 elastic stiffness matrix. The elastic stiffness coefficients were determined experimentally from ultrasonic velocity measurements on 96 samples of normal cortical bone removed from the right tibia of eight human cadavers. The following measured values were used for our analysis: c 11 =19.5 GPa, c 22 =20.1 GPa, c 33 =30.9 GPa, c 44 =5.72 GPa, c 55 =5.17 GPa, c 66 =4.05 GPa, c 23 =12.5 GPa. The remaining coefficients were determined by assuming that the specimens possessed at least an orthorhombic elastic symmetry, and further assuming that c 13 =c 23 , c 12 =c 11 –2c 66 . Our analysis revealed a substantial anisotropy in Young's modulus in the plane containing the long axis of the tibia, with maxima of 20.9 GPa parallel to the long axis, and minima of 11.8 GPa perpendicular to this axis. A less pronounced anisotropy was observed in the plane perpendicular to the long axis of the tibia. To display our results for the full three-dimensional anisotropy of cortical bone, a closed surface was used to represent Young's modulus in all spatial directions.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02347055
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 10
    Electronic Resource
    Electronic Resource
    Controllability and Stabilization in Elasticity, Heat Conduction and Thermoelasticity: Review of Recent Developments* (2000)
    Springer
    Journal of global optimization 17 (2000), S. 353-386 
    Details
    ISSN: 1573-2916
    Keywords: Approximation ; Elasticity ; Exact and approximate controllability ; Heat equations ; Stabilization ; Thermoelasticity ; Thermoviscoelasticity
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract The aim of this paper is to review developments in exact and approximate controllability as well as stabilization of elastic, thermoelastic, and thermo-viscoelastic bodies. Heat equations are also discussed.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1026596405554
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 11
    Electronic Resource
    Electronic Resource
    Generalized stress intensity factors in the interaction between two fibers in matrix (2000)
    Springer
    International journal of fracture 103 (2000), S. 19-39 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; composite material ; fracture mechanics ; fiber ; generalized stress intensity factor ; end effect ; interaction ; rectangular inclusions.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract To evaluate the mechanical strength of fiber reinforced composites it is necessary to consider singular stresses at the end of fibers because they cause crack initiation, propagation, and final failure. The singular stress is expressed by generalized stress intensity factors defined at the corner of fibers. As a 2D model an interaction between rectangular inclusions under longitudinal tension is treated in this paper. The body force method is used to formulate the problem as a system of singular integral equations with Cauchy-type or logarithmic-type singularities, where the unknown functions are the densities of body forces distributed in infinite plates having the same elastic constants as those of the matrix and inclusions. In order to analyze the problem accurately, the unknown functions are expressed as piecewize smooth functions using two types of fundamental densities and power series, where the fundamental densities are chosen to represent the symmetric stress singularity of 1/r 1−λ 1 and the skew-symmetric stress singularity of 1/r 1−λ 2. Then, generalized stress intensity factors at the end of inclusions are systematically calculated for various locations, spacings and elastic modulus of two rectangular inclusions in a plate subjected to longitudinal tension.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1007696723382
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 12
    Electronic Resource
    Electronic Resource
    A Contact Problem of the Interaction of a Semi-Finite Inclusion with a Plate (1999)
    Springer
    Georgian mathematical journal 6 (1999), S. 489-500 
    Details
    ISSN: 1572-9176
    Keywords: Elasticity ; elastic mixtures ; general representations ; integral Fredholm equations ; boundary value problems ; splitted boundary value problems
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract A piece wise-homogeneous plane made up of twodifferent materials and reinforced by an elastic unclusion is considered on a semi-finite section where the different materials join. Vertical and horizontal forces are applied to the inclusion which haz a variable thichness and a variable elasticity modulus. Under certain conditions the problem is reduced to integrodifferential equations of third order. The solution is constructed effectively by applying the methods of theory of analytic functions to a boundary value problem of the Carleman type for a strip. Asymptotic estimates of normal contact stress are obtained.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1022932902050
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 13
    Electronic Resource
    Electronic Resource
    Application of Analogues of General Kolosov–Muskhelishvili Representations in the Theory of Elastic Mixtures (1999)
    Springer
    Georgian mathematical journal 6 (1999), S. 1-18 
    Details
    ISSN: 1572-9176
    Keywords: Elasticity ; elastic mixtures ; general representations ; Fredholm integral equations ; boundary value problems ; splitted boundary value problems
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract The existence and uniqueness of a solution of the first, the second and the third plane boundary value problem are considered for the basic homogeneous equations of statics in the theory of elastic mixtures. Applying the general Kolosov–Muskhelishvili representations from [1], these problems can be split and reduced to the first and the second boundary value problem for an elliptic equation which structurally coincides with the equation of statics of an isotropic elastic body.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1022904308409
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 14
    Electronic Resource
    Electronic Resource
    Elasticity and movements of the cockroach tarsus in walking (1999)
    Springer
    Journal of comparative physiology 185 (1999), S. 157-172 
    Details
    ISSN: 1432-1351
    Keywords: Key words Insect ; Walking ; Elasticity ; Tarsus ; Joints
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Abstract Anatomical, kinematic and ablation studies were performed to evaluate the contribution of elasticity in use of the cockroach tarsus (foot) in walking. The distal tarsus (claws and arolium) engages the substrate during the stance phase of walking by the action of a single muscle, the retractor unguis. Kinematic and ablation studies demonstrated that tarsal disengagement occurs at the end of stance, in part via the action of elastic elements at the penultimate tarsal joint. In isolated legs, this joint exhibits very rapid (less than 20 ms duration) recoil to extension when released from the engaged position, and recoil is even more rapid (less than 10 ms) after removal of the retractor tendon (apodeme). The joint also possesses an enlarged cuticular condyle which is the attachment for ligaments and articular membranes, some of which fulfill morphological criteria consistent with the presence of the elastic protein resilin. Measurements of restoring forces generated by joint displacement indicate that they are graded but could readily lift the mass of the distal tarsus. This biomechanical design can facilitate efficient use of the tarsus in walking while under active control by only a single muscle and may also be highly advantageous when cockroaches very rapidly traverse irregular terrain.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s003590050374
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 15
    Electronic Resource
    Electronic Resource
    A method based on singularity theory to predict edge delamination of laminates (1999)
    Springer
    International journal of fracture 100 (1999), S. 105-120 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; composite materials ; delamination.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract Delamination starting from a stress free edge is the main mode of failure of cross-ply laminates. The analysis of singularities and resulting stress concentrations at interfaces along these edges are not sufficient to provide a satisfying model of onset mechanisms. In particular, the model is by far less sensitive to the layers thickness than observed in traction experiments. A refined asymptotic process is proposed which takes into account the existence of surface flaws (micro-cracks or notches). Numerical results prove that this model is much more in agreement with the experiments. Moreover, the knowledge of the interface toughness, in addition with the experiments, allows to estimate a characteristic fracture length, a kind of process zone. It is a material property and in a first approximation it arises to be of the same order of magnitude than the characteristic inhomogeneity length of the components, i.e. the fibers diameter.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1018382422833
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 16
    Electronic Resource
    Electronic Resource
    On 3D Cracks Intersecting a Free Surface in Laminated Composites (1999)
    Springer
    International journal of fracture 99 (1999), S. 25-40 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; brittle fracture ; singularities.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract In two- and three-dimensional linear elasticity, the singularities together with matched asymptotic expansions allow to extend the brittle fracture mechanics. Although there exist some difference between 2D and 3D approaches, the usual crack tip singularity exponent $$\frac{1}{2}$$ remains in both cases the hinge value between strong and weak singularities. In 3D, 0 was expected to be also a hinge, but it seems difficult to exhibit solutions with a negative exponent. One aim of this paper is to investigate numerically such specific cases and to derive some asymptotics of the classical stress intensity factors. The second part is dedicated to prove that, in case of a small linear ligament, negative exponents cannot exist.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1018366720722
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 17
    Electronic Resource
    Electronic Resource
    The interface crack problem for bonded piezoelectric and orthotropic layers under antiplane shear loading (1999)
    Springer
    International journal of fracture 98 (1999), S. 87-102 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; fracture mechanics ; integral transform ; piezoelectric material ; layered material ; interface crack ; stress intensity factor ; energy release rate.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract The primary objective of this paper is to study the influence of the electroelastic interactions on the stress intensity factor in bonded layers of piezoelectric and orthotropic materials containing a crack along the interface under antiplane shear. Attention is given to a two-layer hybrid laminate formed by adding a layer of piezoelectric ceramic to a unidirectional graphite/epoxy composite or an aluminum layer. Electric displacement or electric field is prescribed on the surfaces of the piezoelectric layer. The problem is formulated in terms of a singular integral equation which is solved by using a relatively simple and efficient technique. A number of examples are given for various material combinations. The results show that the effect of the electroelastic interactions on the stress intensity factor and the energy release rate can be highly significant.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1018755614151
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 18
    Electronic Resource
    Electronic Resource
    Thermoelastic Equilibrium of Bodies in Generalized Cylindrical Coordinates (1998)
    Springer
    Georgian mathematical journal 5 (1998), S. 521-544 
    Details
    ISSN: 1572-9176
    Keywords: Elasticity ; thermoelasticity ; transversally isotropic body ; thermoelastic equilibrium
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract Using the method of separation of variables, an exact solution is constructed for some boundary value and boundary-contact problems of thermoelastic equilibrium of one- and multilayer bodies bounded by the coordinate surfaces of generalized cylindrical coordinates ρ, α, z. ρ, α are the orthogonal coordinates on the plane and z is the linear coordinate. The body, occupying the domain Ω = {ρ0 〈 ρ 〈 ρ1, α0 〈 α 〈 α1, 0 〈 z 〈 z 1}, is subjected to the action of a stationary thermal field and surface disturbances (such as stresses, displacements, or their combinations) for z = 0 and z = z 1. Special type homogeneous conditions are given on the remainder of the surface. The elastic body is assumed to be transversally isotropic with the plane of isotropy z = const and nonhomogeneous along z. The same assumption is made for the layers of the multilayer body which contact along z = const.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/B:GEOR.0000008130.94207.f5
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 19
    Electronic Resource
    Electronic Resource
    Transverse Decay of Solutions in an Elastic Cylinder (1998)
    Springer
    Meccanica 33 (1998), S. 577-585 
    Details
    ISSN: 1572-9648
    Keywords: Circular cylinder ; Transverse decay ; Elasticity
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract In a semi‐infinite cylinder composed of anisotropic linearised elastic material, loaded on the base and clamped along the lateral surface, it is known that the solution as measured, for example, by the strain‐energy flux through a plane cross‐ection decays longitudinally at most exponentially with respect to the axial distance from the base. There is, however, also a transverse radial decay of the solution, again measured for example by the strain‐energy, occurring from the region close to the cylinder's axis to the region near the lateral surface, where the energy vanishes. This problem is considered in the present paper which discusses a circular semi‐infinite cylinder and derives an estimate for the strain‐energy contained in a cylindrical annulus at a given distance from the base and of variable height, and whose outer surface coincides with the lateral surface of the cylinder. It is shown that the strain‐energy decays at most algebraically to zero as the inner radius of the annulus increases to that of the cylinder. Sommario. E'noto che in un cilindro semi‐infinito composto da materiale elastico lineare anisotropo, caricato sulla base ed incastrato lungo la superficie laterale, la soluzione elastica, misurata, per esempio, dal flusso di energia di deformazione attraverso una sezione trasversale piana, decade con legge al più esponenziale con la distanza dalla base. C'è tuttavia, anche un decadimento radiale della soluzione, misurato, per esempio, dall'energia di deformazione che passa dalla regione vicina all'asse del cilindro a quella vicin alla superficie laterale dove l'energia si annulla Questo problema è qui studiato. Si discute in particolare un cilindro circolare semi‐infinito e si deduce una stima per l'energia di deformazione contenuta in un anello cilindrico ad una distanza assegnata dalla base e di altezza variabile, e la cui superficie esterna coincide con la superficie laterale del cilindro. Si dimostra che l'energia di deformazione decade al più con legge algebrica a zero quando il raggio interno del cilindro si avvicina a quello esterno.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004343004833
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 20
    Electronic Resource
    Electronic Resource
    Modeling elastic properties of microtubule tips and walls (1998)
    Springer
    European biophysics journal 27 (1998), S. 501-513 
    Details
    ISSN: 1432-1017
    Keywords: Key words Microtubule ; Elasticity ; Competing curvatures
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Physics
    Notes: Abstract Electron micrographs of tips of growing and shrinking microtubules are analyzed and interpreted. The many shapes observed are all consistent with a simple mechanical model, a flexible tube with competing intrinsic curvatures. Observations are also consistent with growing and shrinking microtubules having the same intrinsic curvature for protofilaments, the one observed in oligomers peeling off shrinking microtubules. If this is so, the lateral bonds between protofilaments are responsible for the difference between shapes of tips on growing and shrinking microtubules.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002490050160
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 21
    Electronic Resource
    Electronic Resource
    Elasticity of an upper mantle clinopyroxene (1998)
    Springer
    Physics and chemistry of minerals 26 (1998), S. 7-13 
    Details
    ISSN: 1432-2021
    Keywords: Key words Pyroxene ; Elasticity ; Monoclinic ; Systematics ; ISS
    Source: Springer Online Journal Archives 1860-2000
    Topics: Chemistry and Pharmacology , Geosciences , Physics
    Notes: Abstract  The ambient pressure elastic properties of a natural clinopyroxene (C2/c symmetry) from Kilbourne Hole, NM have been determined. In terms of end-members, diopside (CaMgSi2O6), hedenbergite (CaFeSi2O6), jadeite (NaAlSi2O6), cosmochlor (NaCrSi2O6), and Mg-Tschermak (MgAl(AlSi)O6), its composition is Di72He9Jd3Cr3Ts12. The analytic density, based on chemistry and cell parameters is 3.327 (0.003) g/cm3. The elastic constants [c11, c12, c13, c15, c22, c23, c25, c33, c35, c44, c46, c55, c66] are [273.8 (0.9), 83.5 (1.3), 80.0 (1.1), 9.0 (0.6), 183.6 (0.9), 59.9 (1.6), 9.5 (1.0), 229.5 (0.9), 48.1 (0.6), 76.5 (0.9), 8.4 (0.8), 73.0 (0.4), 81.6 (1.0)] GPa where uncertainties are reported at the 95% confidence level. The aggregate (mean of Hashin-Strikman bounds) adiabatic bulk modulus is 117.2 (0.7) GPa, and the shear modulus is 72.2 (0.2) GPa. Although measured moduli are broadly consistent with trends in elasticity versus atomic volume, deviations from the systematics would produce significant (percent level) changes in calculated velocities for candidate mantle mineral assemblages. The compositional dependence of elasticity for several clinopyroxenes is explored on the basis of just the Di+He and Jd+Ts mole fractions. The bulk modulus lies within experimental uncertainties of the linear mixture of end-member properties while the shear modulus deviates by 3%.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002690050156
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 22
    Electronic Resource
    Electronic Resource
    Steady-State Flow Experiments to Visualise the Stress Field and Potential Crack Trajectories in 2D Elastic-Brittle Cracked Media in Uniaxial Compression (1998)
    Springer
    International journal of fracture 92 (1998), S. 349-357 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; stress field ; crack-induced perturbations ; cracks interactions ; crack growth ; Hele Shaw cell ; steady-state flow
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract An experimental method to visualise crack-induced perturbations of the stress field in two-dimensional elastic cracked media is presented. The method is based on the formal equivalence between the steady-state velocity field of an incompressible Newtonian fluid and the displacement field in an incompressible elastic solid in equilibrium. Two-dimensional steady-state flow experiments of an incompressible Newtonian fluid were conducted in a Hele Shaw cell. Thin rubber inclusions were inserted in the cell to model pre-existing cracks. The streamlines around the obstacles were visualised by injection of methylen blue dye into the flow. Several experiments were conducted in which different configurations of cracks were modeled: (1) one single crack inclined to the flow direction; (2) left-stepping en échelon cracks with different step-overs; and (3) randomly distributed cracks. The results compare well with the available experimental data on crack growth in elastic plates under uniaxial compression and demonstrate the ability of the method to accurately account both for cracks induced perturbations and potential crack trajectories in elastic media. Different mechanisms of crack interaction such as screening or enhancing effects are illustrated by the experiments.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1007537222483
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 23
    Electronic Resource
    Electronic Resource
    On Variational Approaches to Plate Modes (1997)
    Springer
    Meccanica 32 (1997), S. 143-156 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; Reissner–Mindlin plate theory ; Solid mechanics.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract The three basic functionals of potential energy, complementary energy and Hellinger–Prange–Reissner are usedto obtain a rational derivation of Reissner–Mindlinplate models, starting from the three-dimensional theory.We show that the models so obtained are instances of the same plate theory; nevertheless, due to the different constitutive relations governing their response, they mimic the three-dimensional behaviour in three different manners.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004271405217
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 24
    Electronic Resource
    Electronic Resource
    Equal Curvature and Equal Constraint Cantilevers: Extensions of Euler and Clebsch Formulas (1997)
    Springer
    Meccanica 32 (1997), S. 493-503 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; Equal curvature ; Equal constraint ; Structural mechanics
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract The flexure of cantilevers is one of the early problems, if not the first, to have been studied by the elasticity theoreticians. One considers axisymmetrical rods and rectangular section beams. This investigation concerns the case where the maximum stress is constant (Galilei-Euler-Clebsch problem) as well as the case where the curvature of the medium fiber is constant. For both cases, it is shown that the equations to solve belong to the same class. The research was into thickness distributions replying to those conditions under various loading cases. At the free end, the distributions obtained degenerate into a family for which the thickness is null, but contrary to a widely held opinion, they also and naturally give forms showing a finite thickness at this end. The proposed distributions have a general form which has not been found in the literature treating elasticity theory or strength of materials [1-9]. They are extensions of Euler and Clebsch formulas.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004278131928
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 25
    Electronic Resource
    Electronic Resource
    On Small-Displacement Waves in Prestressed Bodies with Isotropic Incremental Elasticity Tensor (1997)
    Springer
    Meccanica 32 (1997), S. 505-514 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; Linear theory ; Residual stresses ; Waves motions in solids ; Mechanics of solids.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Notes: Abstract We consider a body at rest in a prestressed configurationκwhich responds elastically to small incremental displacements fromκthe incremental elasticity tensor is supposed isotropic. On the basis of the paper [1] we characterize the conditions for the propagation of longitudinal, transverse, and oblique small-displacement waves superimposed toκFormulae for the propagation speeds of these waves are written in terms of the prestress components and Lamparameters. The amplitudes of longitudinal and transverse waves are eigenvectors for the prestress.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1004238416907
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 26
    Electronic Resource
    Electronic Resource
    The effect of an elliptical inclusion on a crack (1997)
    Springer
    International journal of fracture 85 (1997), S. 351-364 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; Crack ; Stress Intensity Factor ; Inclusion.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract The interaction between an elliptical inclusion and a crack is analyzed by body force method. The investigated stress field is simulated by superposing the fundamental solutions for a point force applied at a point in an infinite plate containing an elliptical inclusion. Based on numerical results, effects of the inclusion shape on the crack tip stress intensity factor are discussed. It is found that for small cracks emanating from a stress-higher point on the inclusion interface the stress intensity factors are mainly determined by the stresses, occurring at the crack starting point before the crack initiation, and the inclusion root radius, besides the crack length. However, for the cracks occurring in a stress-lower region around the inclusion, it is difficult to characterize the effect of the inclusion geometry on the stress intensity factors of small cracks by the inclusion root radius alone.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1007420011592
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 27
    Electronic Resource
    Electronic Resource
    Plane Elastic Problem of a Crack Normal to and Terminating at Bimaterial Interface of Isotropic and Orthotropic Half Plates (1997)
    Springer
    International journal of fracture 88 (1997), S. 393-406 
    Details
    ISSN: 1573-2673
    Keywords: Elasticity ; singularity ; crack ; interface ; anisotropy.
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract In this paper, the displacement and stress fields for a crack normal to and terminating at a bimaterial interface of isotropic and orthotropic half planes are studied as a plane problem. The eigenequation, by which the order of stress singularity is determined, is given in an explicit form. A discriminant function is presented to judge whether the stress singularity at the crack tip is greater than -1/2 or not. An explicit closed form expression is derived for the displacement and stress distribution near the crack tip.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1023/A:1007497200087
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 28
    Electronic Resource
    Electronic Resource
    Point force and edge dislocation in a two-phase anisotropic medium (1996)
    Springer
    Zeitschrift für angewandte Mathematik und Physik 47 (1996), S. 617-630 
    Details
    ISSN: 1420-9039
    Keywords: Elasticity ; composite material ; Green's function ; plane problem ; anisotropy ; point force ; dislocation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics , Physics
    Notes: Abstract Green's functions are derived for the in-plane deformation due to an in-plane point force and edge dislocation acting at a point in a plane of two joined semi-infinite anisotropic plates. The Lekhnitskii's complex potential approach is used, and a general expression of the solutions is obtained in closed-form. Including the case of an isotropic-anisotropic two-phase medium and the case of an isotropic-isotropic two-phase medium, the solutions are given for all possible combinations of materials with either s1 ≠ s2 or S1=s2, where si and s2 are the roots of the characteristic equation of the material.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00914875
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 29
    Electronic Resource
    Electronic Resource
    Green's functions for a point force and dislocation outside an elliptic inclusion in plane elasticity (1996)
    Springer
    Zeitschrift für angewandte Mathematik und Physik 47 (1996), S. 894-905 
    Details
    ISSN: 1420-9039
    Keywords: Elasticity ; Green's function ; inclusion ; plane problem ; point force ; dislocation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics , Physics
    Notes: Abstract The plane elasticity problem of an infinite plate containing an elliptic inclusion is considered. The Green's functions for a point force and/or a dislocation located outside the inclusion are derived. By using the complex potential approach of Muskhelishvili, the general solutions are obtained in a form of carefully selected functions plus an infinite series. The numerical convergence of the solutions is better than that of Stagni-Lizzio's solutions. The proposed solutions can also be applied to the case of a point force and dislocation acting at a point right on the interface.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00920040
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 30
    Electronic Resource
    Electronic Resource
    Three-dimensional shapes of looped DNA (1996)
    Springer
    Meccanica 31 (1996), S. 235-271 
    Details
    ISSN: 1572-9648
    Keywords: DNA double helix ; Thin rod ; Equilibrium ; Kirchhoff's analogy ; Elasticity ; Bifurcation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario Si analizzano le configurazioni di equilibrio di una molecola chiusa di DNA per mezzo di un modello di trave sottile, omogenea, isotropa e linearmente elastica, con sezione circolare. La configurazione di equilibrio di una tale trave, inizialmente rettilinea e poi ritorta, soggetta a forze esterne e momenti solo alle sue estremità, è descritta dalla soluzione di equazioni identiche a quelle che governano il moto di un girostato simmetrico in rotazione intorno ad un punto fisso in un campo gravitazionale (l'analogie di Kirchhoff). Per poter rappresentare l'equilibrio del cappio di DNA, il modello di trave deve essere racchiuso in un anello, Il corrispondente problema al contorno consiste in un sistema di quattro equazioni nonlineari rispetto a quattro parametri. Le soluzioni del problema fuori del piano vengono ottenute tramite l'analisi perturbativa ed una procedura di continuazione al variare di un parametro. Si discutono le modifiche di configurazione del sistema per diversi valori dei parametri.
    Notes: Abstract The equilibrium shapes of a closed DNA are investigated by employing a model of a thin, homogeneous, isotropic, linearly elastic rod of circular cross section. An equilibrium configuration of such an initially straight and twisted rod, submitted to external forces and moments at its ends only, obeys equations identical to those governing the rotation of a symmetric gyrostat spinning about a fixed point in a gravitational field (the Kirchhoff analogy). To represent the equilibrium of the looped DNA, the model rod must be smoothly closed into a ring. The corresponding BVP results in a system of four nonlinear equations with respect to four parameters. The perturbation analysis and the parameter continuation approach are used to find nonplanar solutions. The conformation change is discussed for various values of parameters.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00426990
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 31
    Electronic Resource
    Electronic Resource
    Two instructive instabilities in non-linear elasticity: Biaxially loaded membrane, and rubber balloons (1996)
    Springer
    Meccanica 31 (1996), S. 387-395 
    Details
    ISSN: 1572-9648
    Keywords: Stability ; Elasticity ; Solid Mechanics
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario I solidi elastici si ‘svergolano’ sotto carichi di compressione, cioè le soluzioni diventano non-univoche e biforcano, e il solido diventa instabile. Fenomeni simili possono avvenire anche in trazione, come qui si mette in evidenza esaminando una membrana quadrata tesa simmetricamente secondo due direzioni: la rottura della simmetria fa perdere unicità alla soluzione. Sotto carico non-simmetrico, le curve carico-deformazione divengono non-monotone, e quindi compare una isteresi che riflette una catastrofe di piegatura, come segnalato per primo da Kearsley [1]. I palloni sottili hanno relazioni raggio-pressione non monotone, il che suggerisce proprietà di stabilità non banali. Si presenta un'analisi di stabilità per due pallon interconnessi, che parte da quelle di Dreyer et al. [2] e Kitsche et al. [3] e le sviluppa.
    Notes: Abstract Elastic bodies buckle under compressive loads, i.e. solutions become non-unique, they bifurcate and the body becomes unstable. Similar phenomena occur in tension as is evidenced here by the symmetric biaxial loading of a square membrane. Symmetry breaking removes the non-uniqueness. Under non-symmetric loading the load-deformation curves become non-monotone, consequently a hysteresis occurs which is the reflection of a fold-type catastrophy. This instructive instability was discovered by Kearsley [1]. Here we investigate it more fully and present some additional aspects. Balloons have non-monotone pressure-radius relations which suggest non-trivial stability properties. A stability analysis is presented for two interconnected balloons. In this we follow — and expand on — the analyses presented by Dreyer et al. [2] and Kitsche et al. [3].
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00429927
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 32
    Electronic Resource
    Electronic Resource
    A note on the optimal state of a binary solid mixture in a stressed elastic bar (1996)
    Springer
    Meccanica 31 (1996), S. 519-525 
    Details
    ISSN: 1572-9648
    Keywords: Bar ; Elasticity ; Phase equilibrium ; Thermomechanics of continua
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario Si considerano le possibili configurazioni di equilibrio di una sbarra composta da una miscela solida di due materiali elastici, posta in posizione verticale e soggetta, oltre al campo gravitazionale, ad una azione, forza o spostamento applicato, in corrispondenza di una estremità. Si suppone che, in ogni sezione trasversale, il modulo di Young della sbarra dipenda solo dal rapporto locale fra i due componenti della miscela in quella sezione e che questa dipendenza soddisfi la diseguaglianza di Paul [2]. Viene mostrato che fra tutte le possibili disposizioni dei due materiali base presenti all'interno del corpo in quantità assegnata, quella che corrisponde ad un minimo per l'energia potenziale prevede che uno dei due componenti si separi dall'altro, concentrandosi in un singolo strato orizzontale. Questo risultato suggerisce che quando un cilindro composito è sottoposto a queste sollecitazioni, i suoi materiali costituenti tenderanno a diffondersi e, alla fine, a separarsi.
    Notes: Abstract We consider the potential energy of the equlibrium configuration under gravity and prescribed vertical forces or displacement of a vertical bar which is composed of a mixture of two elastic materials. It is supposed that in each horizontal cross section the mixture has an effective Young's modulus which depends only on the ratio of the two materials in that cross section, and that the dependence satisfies the bound of Paul [2]. It is shown that among all arrangements of the constituents with a given volume fraction, the smallest potential energy is attained when one of the materials is segregated in a single horizontal layer. This result suggests that when a composite cylinder is kept in such a state of strain, its constituent material will eventually diffuse into this segregated state.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00420823
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 33
    Electronic Resource
    Electronic Resource
    On the first stationary boundary-value problem of elasticity in weighted Sobolev spaces in exterior domains of R3 (1996)
    Springer
    Applied mathematics & optimization 34 (1996), S. 183-190 
    Details
    ISSN: 1432-0606
    Keywords: Elasticity ; Exterior domains ; First boundary-value problem ; Weighted Sobolev spaces ; Stokes problem ; 35 ; 73 ; 76
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract This paper solves the first boundary-value problem of elasticity both in interior and exterior domains ofR 3. The equations are set in weighted Sobolev spaces for exterior domains that describe the decay of the functions at infinity. The results established include existence, regularity, and convergence of iterations of the solution.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01182623
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 34
    Electronic Resource
    Electronic Resource
    Structural mechanics of carbon nanotubes: From continuum elasticity to atomistic fracture (1996)
    Springer
    Journal of computer-aided materials design 3 (1996), S. 173-182 
    Details
    ISSN: 1573-4900
    Keywords: Nanotechnology ; Fullerenes ; Fibers ; Elasticity ; Fracture ; Simulations
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Summary Motivated by recent observations of bent, collapsed and twisted carbon nanotubes, we investigate their behavior at large deformations. These hollow molecules behave remarkably similar to their macroscopic homologs. They reversibly switch into different morphological patterns, and each shape change corresponds to an abrupt release of energy and a singularity in the stress-strain curve. These transformations, simulated using a realistic many-body potential, are accurately described by a continuum-shell model. In contrast, a response to axial tension proceeds smoothly up to a fracture threshold, beyond which a monoatomic carbon chain unravels between the tube fragments.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01185652
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 35
    Electronic Resource
    Electronic Resource
    Anisotropic elastic bending models of DNA (1996)
    Springer
    Journal of biological physics 22 (1996), S. 227-243 
    Details
    ISSN: 1573-0689
    Keywords: Anisotropy ; DNA bending ; DNA curvature ; Elasticity ; Finite element methods ; Sequence dependent stiffness
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Physics
    Notes: Abstract Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)n, (tctctaaaaaatatataaaaa)n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)n, (atctaatctaacacaacaca)n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00401875
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 36
    Electronic Resource
    Electronic Resource
    Dynamic contour: A texture approach and contour operations (1995)
    Springer
    The visual computer 11 (1995), S. 277-289 
    Details
    ISSN: 1432-2315
    Keywords: Elasticity ; Active contour methods ; Segmentation ; Image processing
    Source: Springer Online Journal Archives 1860-2000
    Topics: Computer Science
    Notes: Abstract The large morphometric variability in biomedical organs requires an accurate fitting method for a pregenerated contour model. We propose a physically based approach to fitting 2D shapes using texture feature vectors and contour operations that allow even automatic contour splitting. To support shrinkage of the contour and obtain a better fit for the concave parts an area force is introduced. When two parts of the active contour approach each other, it divides. The contour undergoing elastic deformation is considered as a set of masses linked by springs with their natural lengths set to zero. We also propose a method for automatic estimation of some model parameters based on a histogram of image forces along a contour.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01898405
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 37
    Electronic Resource
    Electronic Resource
    Effects of magnesium deficiency on strength, mass, and composition of rat femur (1994)
    Springer
    Calcified tissue international 54 (1994), S. 44-49 
    Details
    ISSN: 1432-0827
    Keywords: Bone ; Stress ; Elasticity ; Mechanical properties ; Calcium
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine , Physics
    Notes: Abstract Magnesium (Mg) participates in the normal formation and remodeling of bone. However, little is known about effects of Mg status on the biomechanical function of bone. We examined gross morphometry and composition as well as biomechanical properties of the femurs of male rats fed diets adequate or deficient in Mg. Comparison of deficient animals and controls yielded a number of differences (all significant at P〈0.05). Mg-depleted animals exhibited slow growth, inefficient food utilization, and greatly reduced concentrations of Mg in both serum and femur ash. Compared with controls, femurs from depleted animals were shorter, but wet weights, diameters, and midfemoral cross-sectional areas showed no differences. Bone length was reduced to a greater degree than could be accounted for by differences in body weights between the groups. Bones of Mg-deficient rats contained less dry matter and less ash (which contained more Ca/g) than those of controls, along with a higher percentage of moisture. Significantly reduced bone strength in depleted animals was evident from the lighter loads supported at the elastic limit (yield point) and at fracture and from decreased stresses accompanying those loads. Modulus of elasticity, however, was not affected by Mg depletion. Different yield and breaking loads were related to different body weights of groups, but stresses were reduced for deficient bones even after adjusting for body size. Our data establish abnormal biomechanical behavior of cortical bone in Mg-deficient animals and emphasize the importance of measuring such functional properties of bone in the assessment of responses to altered metabolic conditions under experimental conditions.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00316289
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 38
    Electronic Resource
    Electronic Resource
    Mechanical and biochemical analyses of tibial compartment fascia in chronic compartment syndrome (1994)
    Springer
    Annals of biomedical engineering 22 (1994), S. 272-279 
    Details
    ISSN: 1573-9686
    Keywords: Chronic compartment syndrome ; Fascia ; Elasticity ; Viscoelasticity ; Collagen ; Collagen crosslinking
    Source: Springer Online Journal Archives 1860-2000
    Topics: Medicine , Technology
    Notes: Abstract Increases in compartment pressure associated with chronic compartment syndrome (CCS) may be due to changes in the mechanical properties and/or thickness of fascia (4,22). To explore this possibility, we compared the mechanical and biochemical characteristics (stiffness, thickness, time-dependent response, collagen content, and collagen crosslinking) of fascia from patients with symptomatic anterior compartment syndrome to fascia from adjacent collateral compartments. We tested 43 specimens harvested from 20 individuals during surgical fasciectomy. Properties of normal (lateral)-compartment (NC) and pathological (anterior)-compartment (PC) fascia were mechanically tested in the axial and transverse directions forming four groups. An external control group (EX) of six specimens of anterior and lateral-compartment fascia harvested from amputated legs was also included in the study. PC fascia was found to be thicker and structurally stiffer (elastic modulus times thickness) in the axial direction than was NC fascia (p≤0.05). No significant differences were found between NC and PC time-dependent response, although significant differences between percent relaxation in the pooled axial and transverse direction specimens were observed. No differences were found in the collagen content, as measured by hydroxyproline (Hyp) concentration, between NC and PC fascia. PC fascia was found to have less collagen crosslinking by hydroxylyslpyridinoline (HP) concentration. In conclusion, although this study does not elucidate etiological factors in CCS, the changes found in PC fascia suggest that fascial mechanical properties contribute to the pathology.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02368234
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 39
    Electronic Resource
    Electronic Resource
    Relationships between stem structure and bending strength in Pinus radiata seedlings (1993)
    Springer
    Trees 7 (1993), S. 86-91 
    Details
    ISSN: 1432-2285
    Keywords: Pinus radiata ; Stem deformation ; Nitrogen ; Stem form ; Elasticity
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Agriculture, Forestry, Horticulture, Fishery, Domestic Science, Nutrition
    Notes: Summary Seedlings from nine families of Pinus radiata were grown in a glasshouse under conditions of high and low nitrate nitrogen availability to investigate effects on anatomical and strength characteristics of stems. Families were classified into groups dependent upon their previously determined susceptibility to stem deformation prevalent in plantations established on fertile ex-pasture. Nitrogen treatments significantly affected seedling form in terms of both branch production and stem slenderness. The high N treatment resulted in shorter seedlings, a proportion of which were obviously stunted. Stem strength of seedlings, physically supported throughout the experiment, was assessed as stem lean at harvest as well as the bending strength of the fresh stem at 50% stem height. These two variables were found not to be correlated. Stem lean at harvest was greatest in families known to be susceptible to stem deformation. These families produced stems that were also more slender than families of low susceptibility. Increased stem lean was associated mostly with increased stem slenderness while elasticity was more influenced by pith diameter, stem density and wood radius.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00225474
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 40
    Electronic Resource
    Electronic Resource
    Strength and structure of stems from fast grown Pinus radiata (1993)
    Springer
    Trees 7 (1993), S. 131-136 
    Details
    ISSN: 1432-2285
    Keywords: Pinus radiata ; Stem strength ; Elasticity ; Lignin ; Microfibril angle
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Agriculture, Forestry, Horticulture, Fishery, Domestic Science, Nutrition
    Notes: Summary Segments of living stems from 2-year-old, fast growing Pinus radiata, established on a fertile ex-pasture, were examined in terms of their bending strength parallel to the grain. Stem anatomical and structural variables were examined to identify variables that could explain variation in bending strength. Half of the seedlings were physically supported to minimise the confounding effects of compression wood production in response to environmental stresses. Differences between seedlings and cuttings were examined. Variation in microfibril angle and lignin content was sufficient to account for 81% of the variation in bending strength. A positive correlation between both of these variables and elasticity was evident. Few differences were found to be caused by the support treatment or between seedlings and cuttings. The support treatment resulted in significantly fewer branches in the top most whorl, while cuttings had less branches in this whorl than seedlings.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00199612
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 41
    Electronic Resource
    Electronic Resource
    Accuracy in measurements and the temperature and volume dependence of thermoelastic parameters (1993)
    Springer
    Pure and applied geophysics 141 (1993), S. 327-339 
    Details
    ISSN: 1420-9136
    Keywords: Elasticity ; thermoelasticity ; piston-cylinder ; rectangular parallepiped resonance ; MgO ; NaCl ; Anderson-Grüneisen parameter ; equation of state
    Source: Springer Online Journal Archives 1860-2000
    Topics: Geosciences , Physics
    Notes: Abstract To obtain the temperatureT and volumeV (or pressureP) dependence of the Anderson-Grüneisen parameter δ T , measurements with high sensitivity are required. We show two examples:P, V, T measurements of NaCl done with the piston cylinder and elasticity measurements of MgO using a resonance method. In both cases, the sensitivity of the measurements leads to results that provide information about δ T (η,T), where η≡V/V 0 andV 0 is the volume at zero pressure. We demonstrate that determination of δ T leads to understanding of the volume and temperature dependence ofq=(∂ ln γ/∂ lnV) T over a broadV, T range, where γ is the Grüneisen ratio.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00998334
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 42
    Electronic Resource
    Electronic Resource
    Thigmonasticity of thistle staminal filaments (1993)
    Springer
    Planta 190 (1993), S. 58-64 
    Details
    ISSN: 1432-2048
    Keywords: Cell wall ; Cirsium (cell wall) ; Cuticle ; Elasticity ; Thigmonasticity
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract Investigations of the longitudinal distribution of the extensibility of staminal filaments of the common thistle (Cirsium horridulum Michx.) showed that the base of the filaments (attachment to corolla) is almost twice as elastic as the apical portion (next to anthers). Boiling leads to a more uniform distribution of extensibility. Using a stress-strain analyzer we investigated the elastic properties of fresh, water-boiled, partially hydrolyzed (acid-boiled), and dehydrated filaments. Stress-strain curves of sinusoidally stretched sets of filaments revealed complex, non-linear behavior with an average modulus of elasticity of 5 MPa·m−2. The phase angle varied from approximately 18 degrees for 0.01-Hz deformations to 84 degrees at 2 Hz, indicating strong viscoelastic components. The viscoelasticity of the filaments indicates that the cell walls have a high ratio of pectin to cellulose. Boiling does not affect Young's modulus, but dehydration does. The technique of applying sinusoidal loads and the analysis of the stress-strain curves proves useful for the assessment of mechanical properties of cell walls, especially for non-growing or contractile tissues.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00195675
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 43
    Electronic Resource
    Electronic Resource
    Elasticity of the crystal-like, amorphous solid-like, and liquid-like structures in deionized suspensions of colloidal silica spheres (1993)
    Springer
    Colloid & polymer science 271 (1993), S. 873-883 
    Details
    ISSN: 1435-1536
    Keywords: Elasticity ; suspension structure ; colloidal crystals ; colloidal silica ; reflection spectroscopy ; viscometry
    Source: Springer Online Journal Archives 1860-2000
    Topics: Chemistry and Pharmacology , Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics
    Notes: Abstract Elastic moduli (G) of deionized suspensions of colloidal silica spheres (diameters=45–192 nm; standard deviations of sphere size divided by the mean diameter=0.05–0.21; surface charge densities=0.33–0.94 μC/cm2; volume fractions of sphere (ϕ)=0.019–0.21) have been determined by the reflection spectrum measurements in a sedimentation equilibrium and the rotatory viscometry. TheG-values are 56–460 Pa (ϕ=0.019–0.051), 330–890 Pa (0.06–0.09), and 100 Pa (0.025) for the crystal-like, amorphous solid-like, and liquid-like structures, respectively. TheG-values seem to be in the order amorphous solid-like 〉 crystal-like 〉 liquid-like at the same sphere concentration. The suspension structures and their elastic moduli are highly influenced by the sizes and their monodispersities of the spheres. These results support that the electrostatic intersphere repulsion and the long Debye-screening length around the spheres are important for the appearance of the suspension structures.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00652770
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 44
    Electronic Resource
    Electronic Resource
    Difference equations approach to the analysis of layered systems (1992)
    Springer
    Meccanica 26 (1992), S. 195-209 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; layered systems ; difference equations
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario Nell' articolo vengono esaminate, sulla base di equazioni alle differenze, strutture di tipo ‘catena’. Si mettono in rilievo i vantaggi di un tale approccio. Per i sistemi complessi sono state ottenute equazioni alle differenze sia in termini di trazioni che spostamenti. Vengono stabiliti legami con altri metodi. Si fa un'analisi dettagliata del caso in cui la soluzione per un singolo strato ě rappresentata sotto la forma della serie di Fourier (integrale). Vengono esposti pure risultati pratici.
    Notes: Abstract The analysis of chain-like structures is tackled on the basis of difference equations. The advantages of such an approach are outlined. Difference equations for layered systems are derived both in terms of tractions and displacements. Interconnections with other methods are stated. Detailed analysis is given for the case when solution for a single layer is presented by Fourier series (integrals). Practical conclusions are driven at.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00430937
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 45
    Electronic Resource
    Electronic Resource
    After-Effects of Electrolytically diffused hydrogen in the second-order elastic coefficient of poynting’s effect in nickel and steel (1992)
    Springer
    Il nuovo cimento della Società Italiana di Fisica 14 (1992), S. 1105-1113 
    Details
    ISSN: 0392-6737
    Keywords: Elasticity ; elastic constants ; vibration ; Diffusion ; migration and displacement of impurities
    Source: Springer Online Journal Archives 1860-2000
    Topics: Physics
    Notes: Summary If hydrogen is diffused electrolytically in a metal, it subsequently escapes out if the metal is left to itself. However this hydrogen-treated metal does not totally regain the original magnitudes of its various physical properties,e. g., thermo e.m.f., electrical resistivity, elastic modulii etc. This effect has also been observed in the second-order elastic effect (the Poynting effect) in nickel and two varieties of steel. Measurements were carried out first before hydrogen diffusion. The samples were electrolytically diffused with hydrogen and the left to themselves for a few days and the measurements were repeated. The changed values of the coefficient of Poynting effect are discussed in terms of the dislocations created by in-and out-going hydrogen.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02456763
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 46
    Electronic Resource
    Electronic Resource
    The elastic deformability of closed multilayered membranes is the same as that of a bilayer membrane (1992)
    Springer
    European biophysics journal 21 (1992), S. 251-255 
    Details
    ISSN: 1432-1017
    Keywords: Multilayered membranes ; Elasticity ; Elastic constants
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Physics
    Notes: Abstract The elastic behavior of closed multilayered membranes is analyzed with the assumption that the constituent layers are in close contact but are unconnected in the sense that they are free to slide by one another. The system exhibits three independent elastic deformation modes for any number of the constituent layers equal to or larger than two. These are the area expansivity of the membrane neutral surface, and the local and non-local membrane bending. The corresponding elastic moduli are expressed in terms of the elastic moduli of the constituent layers, their areas, and distances between their neutral surfaces. Closed multilayered membranes only differ from a closed bilayer membrane in that for any of their shapes some of the constituent layers are expanded and some compressed.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00185119
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 47
    Electronic Resource
    Electronic Resource
    The rigid inclusion with highest penetration (1991)
    Springer
    Meccanica 26 (1991), S. 149-153 
    Details
    ISSN: 1572-9648
    Keywords: Elasticity ; shape optimization
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mechanical Engineering, Materials Science, Production Engineering, Mining and Metallurgy, Traffic Engineering, Precision Mechanics , Physics
    Description / Table of Contents: Sommario Un'inclusione clinidrica rigida con sezione trascersale di area limitata e forma variabile è immersa in un mezzo elastico infinito. Avendo supposto che la sezione possegga un asse di simmetria e che sia spinta nel mezzo da una forza agent secondo tale asse, si pone il problema di trovare il profilo della sezione per cui è massima la penetrazione. Una risposta si può dare solo per due classi particolari di domini in elasticità piana.
    Notes: Abstract A cylindrical bounded rigid inclusion with cross section of bounded area and variable shape is embedded in an infinite elastic medium. Assuming that the cross section possesses an axis of symmetry and that it is pushed into the medium by a force acting in the direction of this axis, the question arises of finding the section's profile for which penetration is highest. A solution is found only for two particular classes of domains in plane elasticity.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00429882
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 48
    Electronic Resource
    Electronic Resource
    Thigmonasticity of thistle staminal filaments (1991)
    Springer
    Protoplasma 163 (1991), S. 174-180 
    Details
    ISSN: 1615-6102
    Keywords: Asteraceae ; Thigmonasticity ; Cuticle ; Elasticity ; Extensibility
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary Touching stimulates thistle (Cirsium horridulum Michx.) staminal filaments to rapidly shorten to approximately 70% of their original length. The filaments subsequently re-elongate and regain contractibility within 10min. This thigmonastic movement can be repeated at least 10 times in detached flowers. Filament length is reduced by bathing in 1 M sorbitol, indicating that length change depends on variation in turgor pressure, as is also indicated by plasmolysis observed in contracted filaments. Contraction also depends upon elastic properties of the cuticle. These properties of the cuticle are resistant to boiling in water, chloroform or acid, and treatment with proteases, protein denaturants, sulfatases, and many cell wall degrading enzymes, but are sensitive to cutinase, β-glucuronidase, and boiling in 1 M NaOH. Analysis of carbohydrates from flowers boiled in 1 N NaOH showed that most galacturonic acid residues were extracted from filaments but not from petals (which are inelastic). The filament galacturonic acid residues may form a part of the cuticular contractile mechanism, and/or they may facilitate the bending of the vascular and cortical cells that occurs during contraction. Our results indicate that the elasticity of the stretched cuticle provides the force for the contraction of the filaments and the build-up of turgor causes re-elongation.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01323341
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 49
    Electronic Resource
    Electronic Resource
    The small anisotropy formulation of elastic deformation (1989)
    Springer
    Acta applicandae mathematicae 14 (1989), S. 259-268 
    Details
    ISSN: 1572-9036
    Keywords: 73C20 ; 73C25 ; 73C50 ; 73G05 ; 73G10 ; Elasticity ; constitutive relations ; specific internal energy ; shear modulus ; hyperelasticity ; isotropic ; anisotropy
    Source: Springer Online Journal Archives 1860-2000
    Topics: Mathematics
    Notes: Abstract The specific internal energy defines the constitutive relation (stress-strain function) in elastic deformations. We introduce a form for the specific internal energy that expresses the idea of small anisotropy. In this formulation, only one parameter is needed to specify the anisotropic part of the deformation.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01307216
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 50
    Electronic Resource
    Electronic Resource
    Deformable models (1988)
    Springer
    The visual computer 4 (1988), S. 306-331 
    Details
    ISSN: 1432-2315
    Keywords: Modeling ; Animation ; Deformation ; Elasticity ; Dynamics ; Simulation
    Source: Springer Online Journal Archives 1860-2000
    Topics: Computer Science
    Notes: Abstract We develop physically-based models of deformable curves, surfaces, and solids for use in computer graphics. Our deformable models are governed by the mechanical laws of continuous bodies whose shapes can change over time. These laws, expressed in the form of dynamic differential equations, unify the description of shape and motion. By solving the equations numerically we are able to create realistic animations involving the interaction of deformable models with various applied forces, ambient media, and impenetrable obstacles in a simulated physical world. We develop deformable models capable of perfectly elastic behavior and more general inelastic behavior, including viscoelasticity, plasticity, and fracture.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01908877
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 51
    facet.materialart.
    Unknown
    Boundary Value Problems in Linear Viscoelasticity (1988)
    Springer
    In:  Berlin, Springer, vol. 10, no. Subvol. b, pp. 220, (ISBN 1-4020-0653-5)
    Details
    Publication Date: 1988
    Keywords: Rheology ; Elasticity ; Inelastic ; Rock mechanics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    BIBLIOGRAPHY SEISMOLOGY
  • 52
    facet.materialart.
    Unknown
    Applications of Tensor Functions in Solid Mechanics (1987)
    Springer
    In:  Wien, Springer, vol. 17, pp. 225, (ISBN 0-19-851393-3)
    Details
    Publication Date: 1987
    Keywords: Textbook of physics ; Textbook of geophysics ; Elasticity ; Textbook of mathematics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    BIBLIOGRAPHY SEISMOLOGY
  • 53
    Electronic Resource
    Electronic Resource
    Precision calculation of elasticity for percolation (1986)
    Springer
    Journal of statistical physics 44 (1986), S. 211-223 
    Details
    ISSN: 1572-9613
    Keywords: Elasticity ; percolation ; conductivity ; critical exponents
    Source: Springer Online Journal Archives 1860-2000
    Topics: Physics
    Notes: Abstract Monte Carlo transfer matrix evaluation of the elastic constants at the percolation threshold of the random-bond honeycomb lattice, with widths of up to 96 and lengths of about two million lattice constants (roughly 200 hours CDC Cyber 205 vector computer time) gave a critical exponentT=3.96±0.04 with a logarithmic correction term. This exponent agrees well with the scaling hypothesisT=t+2v=3.97, relatingT to the two-dimensional conductivity exponent.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01010913
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 54
    Electronic Resource
    Electronic Resource
    Effect of sample dimensions, lubrication and deformation rate on uniaxial compression of gelatin gels (1985)
    Springer
    Rheologica acta 24 (1985), S. 265-271 
    Details
    ISSN: 1435-1528
    Keywords: Elasticity ; gel ; compression
    Source: Springer Online Journal Archives 1860-2000
    Topics: Chemistry and Pharmacology , Physics
    Notes: Abstract The response of 10% gelatin gels to uniaxial compression is determined in part by frictional effects at the gel-platen interface. By using teflon-coated plates, lubricated with paraffin or silicone oil, these frictional effects are effectively eliminated. The stress-strain response can then be described by the two-constant Mooney-Rivlin relation, the sum of the two parameters (C 1 +C 2 ) being about 25% lower in lubricated compression than the value obtained in simple shear and torsion. Cross-head speed (for total testing times of 0.2–3 min) had no effect on material response, but long-term stress relaxation does occur over periods of about 30 min and longer. Sample radius did not affect the response in lubricated compression but had a major effect under unlubricated conditions. No systematic change in response was seen with sample diameter to height (aspect) ratios between 9.6 and 3.1 in lubricated compression, but data scatter for a given sample diameter was worst at the lowest heights (highest aspect ratio). Agreement of all true stress versus strain data was within about ± 7% regardless of sample height or deformation rate.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01332607
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 55
    Electronic Resource
    Electronic Resource
    Viscoelastic properties of the wrist motor servo in man (1984)
    Springer
    Annals of biomedical engineering 12 (1984), S. 599-620 
    Details
    ISSN: 1573-9686
    Keywords: Stretch reflex ; Muscle ; Elasticity ; Viscosity
    Source: Springer Online Journal Archives 1860-2000
    Topics: Medicine , Technology
    Notes: Abstract Viscoelastic properties play an important role in posture and movement. Such properties arise from muscle mechanics and from stretch-reflex actions. We describe experiments designed to characterize both linear and nonlinear elastic and viscous properties of the wrist motor servo in human subjects. First, we describe a trial comparison method for the identification of reflex responses that are unmodified by triggered reaction-time movements. Elastic properties were studied by applying step changes in load force that stretched or released the wrist flexor and extensor muscles. The properties were basically spring-like, but there was a short-range enhancement of stiffness that gave rise to a prominent hysteresis. Viscous properties were studied by applying ramp stretches at different velocities. Both EMG and force responses showed a weak fractional-power dependence on velocity similar to that described recently for muscle spindle receptors. Consideration is given to the possible advantages of this type of nonlinear feedback in the damping of postural responses and movements.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02371452
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 56
    Electronic Resource
    Electronic Resource
    Reflection from elastic discontinuities (1983)
    Springer
    Medical & biological engineering & computing 21 (1983), S. 697-701 
    Details
    ISSN: 1741-0444
    Keywords: Elasticity ; Pressure pulse ; Propagation ; Reflection
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Chemistry and Pharmacology , Medicine
    Notes: Abstract Elastic mismatching is studied by an impulse technique. Elastic mismatches are created by joining two latex rubber tubes of the same internal diameter but different wall thickness. A short duration pressure impulse is generated at the entrance of the water-filled tube system and the transmission characteristics of the impulse are determined from a series of measurements along the tube system using a catheter-tip pressure manometer. This technique enables the magnitude and phase change of the reflection at the elastic discontinuity to be obtained. A number of tube combinations are examined and in all cases a good agreement is shown between the measured reflection coefficient and the value calculated theoretically.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02464032
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 57
    facet.materialart.
    Unknown
    Geschwindigkeiten elastischer Wellen und Elastizitätskonstanten von Gesteinen und gesteinsbildenden Mineralen (1982)
    Springer
    In:  Professional Paper, Physical Properties of Rocks, Berlin, Springer, vol. V/1, no. Subvol. b, pp. 1-96, (ISBN: 3-540-23712-7)
    Details
    Publication Date: 1982
    Keywords: Velocity ; Elasticity ; Physical properties of rocks ; Handbook of geophysics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    BIBLIOGRAPHY SEISMOLOGY
  • 58
    Electronic Resource
    Electronic Resource
    Turgor pressure and water transport properties of suspension-cultured cells of Chenopodium rubrum L. (1981)
    Springer
    Planta 151 (1981), S. 95-102 
    Details
    ISSN: 1432-2048
    Keywords: Cell suspension culture ; Chenopodium ; Elasticity ; Immobilization ; Pressure probe ; Water relations
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract The turgor pressure and water relation parameters were determined in single photoautotrophically grown suspension cells and in individual cells of intact leaves of Chenopodium rubrum using the miniaturized pressure probe. The stationary turgor pressure in suspension-cultured cells was in the range of betwen 3 and 5 bar. From the turgor pressure relaxation process, induced either hydrostatically (by means of the pressure probe) or osmotically, the halftime of water exchange was estimated to be 20±10 s. No polarity was observed for both ex- and endosmotic water flow. The volumetric elastic modulus, ε, determined from measurements of turgor pressure changes, and the corresponding changes in the fractional cell volume was determined to be in the range of between 20 and 50 bar. ε increases with increasing turgor pressure as observed for other higher plant and algal cells. The hydraulic conductivity, Lp, is calculated to be about 0,5–2·10−6 cm s−1 bar−1. Similar results were obtained for individual leaf cells of Ch. rubrum. Suspension cells immobilized in a cross-linked matrix of alginate (6 to 8% w/w) revealed the same values for the half-time of water exchange and for the hydraulic conductivity, Lp, provided that the turgor pressure relaxation process was generated hydrostatically by means of the pressure probe. Thus, it can be concluded that the unstirred layer from the immobilized matrix has no effect on the calculation of Lp from the turgor pressure relaxation process, using the water transport equation derived for a single cell surrounded by a large external volume. By analogy, this also holds true for Lp-values derived from turgor pressure changes generated by the pressure probe in a single cell within the leaf tissue. The fair similarity between the Lp-values measured in mesophyll cells in situ and mesophyll-like suspension cells suggests that the water transport relations of a cell within a leaf are not fundamentally different from those measured in a single cell.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00384243
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 59
    Electronic Resource
    Electronic Resource
    Charging versus exclusion: Choice between recreation management tools (1981)
    Springer
    Environmental management 5 (1981), S. 161-175 
    Details
    ISSN: 1432-1009
    Keywords: Charging ; Exclusion ; Recreation management ; Consumers' surplus ; Distribution of recreational opportunity ; Substitute sites ; Intuitive expectations ; Visit rate ; Site carrying capacity ; Equilibrium price ; Elasticity ; Utility functions
    Source: Springer Online Journal Archives 1860-2000
    Topics: Energy, Environment Protection, Nuclear Power Engineering
    Notes: Abstract Overuse of recreation sites seems to justify regulation, and the principal tools for this are fee charging or physical exclusion. Both seem equally costly to administer. Both involve equal costs to consumers if recreationists visit from one origin, but if they come from different origins, costs may be greater and consumers' surplus less under either tool, depending on the shape of the demand curve. Which is the more equitable tool depends on the relative representation of rich and poor participants from near and distant origins. Potentially beneficial use of site revenues is an advantage of charging. Neither availability of substitutes nor variation in daily demand seems likely to change these results substantially, but a system of booking admissions before the trip outset might neutralize the advantages of charging. The optimal level of use varies with the regulatory tool chosen. The optimal admissions under exclusion could be fewer than or more than under charging, or may even be equal to unregulated use.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01867335
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 60
    Electronic Resource
    Electronic Resource
    Direct turgor pressure measurements in individual leaf cells of Tradescantia virginiana (1980)
    Springer
    Planta 149 (1980), S. 445-453 
    Details
    ISSN: 1432-2048
    Keywords: Elasticity ; Hydraulic conductivity ; Leaf cells ; Tradescantia ; Turgor pressure
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract The water relations of leaves of Tradescantia virginiana were studied using the miniaturized pressure probe (Hüsken, E. Steudle, Zimmermann, 1978 Plant Physiol. 61, 158–163). Under well-watered conditions cell turgor pressures, P o, ranged from 2 to 8 bar in epidermal cells. In subsidiary cells P o was about 1.5 to 4.5 bar and in mesophyll cells about 2 to 3.5 bar. From the turgor pressure, relaxation induced in individual cells by changing the turgor pressure directly by means of the pressure probe, the half-time of water exchange was measured to be between 3 and 100 s for the epidermal, subsidiary, and mesophyll cells. The volumetric elastic modulus, ε, of individual cells was determined by changing the cell volume by a defined amount and simultaneously measuring the corresponding change in cell turgor pressure. The values for the elastic modulus for epidermal, subsidiary, and mesophyll cells are in the range of 40 to 240 bar, 30 to 200 bar, and 6 to 14 bar, respectively. Using these values, the hydraulic conductivity, L p, for the epidermal, subsidiary, and mesophyll cells is calculated from the turgor pressure relaxation process (on the basis of the thermodynamics of irreversible processes) to be between 1 and 55·10-7 cm s-1 bar-1. The data for the volumetric elastic modulus of epidermal and subsidiary cells indicate that the corresponding elastic modulus for the guard cells should be considerably lower due to the large volume changes of these cells during opening or closing. Recalculation of experimental data obtained by K. Raschke (1979, Encycl. Plant Physiol. N.S., vol. 7, pp 383–441) on epidermal strips of Vicia faba indicates that the elastic modulus of guard cells of V. faba is in the order of 40–80 bar for closed stomata. However, with increasing stomatal opening, i.e., increasing guard cell volume, ε decreases. Therefore, in our opinion Raschke's results would indicate a relationship between guard cell volume and ε which would be inverse to that for plant cells known in the literature. ε assumes values between 20–40 bar when the guard cell colume is soubled.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00385746
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 61
    Electronic Resource
    Electronic Resource
    In vivo stiffness properties of the canine diaphragm muscle (1980)
    Springer
    Medical & biological engineering & computing 18 (1980), S. 625-632 
    Details
    ISSN: 1741-0444
    Keywords: Diaphragm ; Elasticity ; Modulus ; Muscle ; Passive
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Chemistry and Pharmacology , Medicine
    Notes: Abstract A measuring system used to monitor the orthogonal stresses and strains in the plane of the passive canine diaphragm musclein vivo is described. The system consists of four topically applied force-displacement transducers, a laser-camera subsystem to determine the local radii of curvature and an abdominally situated pressure transducer. Experimental results show that the passive musclein situ behaves as an anisotropic linearly elastic material for loads in the physiological range. A model is proposed which describes the diaphragm's response to load in terms of two moduli. Values obtained experimentally for the moduli are discussed.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02443135
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 62
    Electronic Resource
    Electronic Resource
    Elastic and strength properties of canine long bones (1977)
    Springer
    Medical & biological engineering & computing 15 (1977), S. 72-74 
    Details
    ISSN: 1741-0444
    Keywords: Bone ; Elasticity ; Mechanical strength
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Chemistry and Pharmacology , Medicine
    Notes: Summary The mechanical properties of canine long bones have been determined. The mean and standard deviation of the maximum load supported by six fresh canine femurs in 3-point bending was 1366±253 N. In all cases, the bones sustained a considerable amount of plastic deformation before failure. The modulus of elasticity (GN/m2), ultimate tensile stress (MN/m2) and yield stress (MN/m2) were 13·86, 108·3 and 88·3 for six humeral specimens and 13·88, 142·1 and 104·0 for 13 tibial specimens, respectively. The tibial specimens showed a statistically significant higher ultimate strength than the humeral specimens.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02441578
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 63
    Electronic Resource
    Electronic Resource
    Hydrodynamics of blood flow through the inferior vena cava (1977)
    Springer
    Medical & biological engineering & computing 15 (1977), S. 248-253 
    Details
    ISSN: 1741-0444
    Keywords: Elasticity ; Haemodynamics ; Inferior vena cava ; Negative-resistance effects
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Chemistry and Pharmacology , Medicine
    Description / Table of Contents: Sommaire La veine cave inférieure est un vaisseau affaissable soumis á des variations de la pression de respiration. Les observations cliniques sur le corps humain démontrent que, au cours d'une aspiration profonde, l'accroissement de la pente de pression propulsive provoque l'affaissement de la veine cave inférieure près du diaphragme, et réduit paradoxalement la circulation sanguine. Les empreintes faites au cours des autopsies démontrent qu'il se produit une constriction élastique fortement localisée à l'endroit où la veine cave inférieure, traverse le diaphragme. Un modèle mécanique passif, comportant une constriction élastique semblable, présente le même comportement paradoxal de résistance négative, conformément aux principes de l'écoulement à travers des tubes affaissables.
    Abstract: Zusammenfassung Die Vena cava inferior ist ein kollabierendes Gefäss, das Respirationsdruckschwankungen unterliegt. Klinische Beobachtungen an Menschen zeigen, dass ein Anstieg in dem propulsiven Druckgefälle bewirkt, dass die untere Hohlvene nahe der Membrane kollabiert und paradoxerweise daher den Blutstrom reduziert. Postmortale Abbildungengen zeigen, dass eine stark lokalisierte elastiche Verengung daher den Blutstrom reduziert. Postmortale Abbildungen zeigen, dasse eine stark lokalisierte elastische Verengung eintritt, wo die untere Hohlvene durch die Membrane führt. Ein passives mechanisches Modell mit einer ähnlichen elastischen Verengung zeigt ein ähnliches paradoxes oder negatives Widerstands-Verhalten, das den Prinzipien über den Strom durch kollabierende-Gefässe entspricht.
    Notes: Abstract The inferior vena cava (i.v.c.) is a collapsible vessel which is subject to respiratory pressure variations. Clinical observations on humans show that, during deep inspiration, an increase in the propulsive pressure gradient causes the i.v.c. to collapse near the diaphragm and paradoxically reduces the blood flow. Postmortem casts show that there is a sharply localised elastic constriction where the i.v.c. passes through the diaphragm. A passive mechanical model, incorporating a similar elastic constriction, exhibits similar paradoxical or negative-resistance behaviour, which is in accordance with the principles governing flow through collapsible tubes.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02441045
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 64
    facet.materialart.
    Unknown
    Stress and Strain - Basic Concepts of Continuum Mechanics for Geologists (1976)
    Springer
    In:  New York, Springer, vol. 1, no. 1, pp. 65-66, (ISBN 0 340 76405 8)
    Details
    Publication Date: 1976
    Keywords: Stress ; Textbook of geophysics ; Textbook of geology ; Elasticity
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    BIBLIOGRAPHY SEISMOLOGY
  • 65
    Electronic Resource
    Electronic Resource
    Elastic modulus of the human intact left ventricle—determination and physiological interpretation (1975)
    Springer
    Medical & biological engineering & computing 13 (1975), S. 151-161 
    Details
    ISSN: 1741-0444
    Keywords: Elasticity ; Human left ventricle ; Modulus ; Stress/strain ; Thick-walled model
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Chemistry and Pharmacology , Medicine
    Description / Table of Contents: Sommaire Le ventricule gauche (VG) est représenté par une enveloppe musculaire dont la performance est caractérisée par la pression de la chambre et la contrainte et la déformation sur la paroi ventriculaire; le module d'élasticité ventriculaire effectif du VG décrit la relation entre ces variables de la performance et représente donc la fonction du transfer du système physiologique du ventricule gauche. On présente une méthode de détermination indirecte du module effectifE du ventricule gauche. La méthode fait usage d'un modèle mathématique à paroi épaisse du VG et ayant un milieu isotropique homogène. On détermine des valeurs instantanées deE pour des sujets atteints de maladies cardiaques à étiologies variables, de façon à évaluer la réponse du VG aux surcharges chroniques de pression et de volume. Les valeurs résultantes deE sont utilisées diagnostiquement pour caractériser l'état physiologique du VG. Des valeurs normales de,E à la systole indiquent que la force de la contraction exercée par le VG est normale et qu'il s'est donc ajusté à la maladie cardiaque.
    Abstract: Zusammenfassung Das linke Ventrikel (LV) wird als Muskelschale dargestellt, dessen Leistung durch Kammerdruck und Beanspruchung der Ventrikulärwand beschrieben wird. Das effektive elastische Modul des LV bringt diese Leistungsvariablen aufeindander in Bezug und stellt daher die Ubertragungsfunktion des linken physiologischen Ventrikelsystems dar. Es wird ein Verfahren zur indirekten Bestimmung des effektiven Moduls (E) für das linke Ventrikel dargestellt. Das Verfahren verwendet das starkwandige mathematische Modell eines LV mit einem homogenen isotropen Medium. Sofortige E-Werte werden für Fälle mit Herzkrankheiten verschiedener Ursachen betimmt, um die Reaktion des LV auf chronische Überbelastung durch Druck und Volumen zu beaurteilen. Die sich für E ergebenden Werte werden diagnostisch dazu verwendent, den physiologischen Zustand des LV zu bestimmen. Normale Werte für E bei Systole bedeuten, daß die vom LV ausgeführte Kontraktion normal stark ist, was bedeutet, daß sich das LV auf die Herzkrankheit eingestellt hat.
    Notes: Abstract The left ventricle (l.v.) is represented as a shell of muscle whose performance is characterised in terms of the chamber pressure and stress/strain in the ventricular wall; the effective elastic modulus of the l.v. relates these peerformance variables, and hence represents the transfer function of the left ventricular physiological system. A method is presented for indirectly determining the effective modulusE for the left ventricle. The method employs a thick-walled mathematical model of the l.v. having a homogeneous isotropic medium. Instantaneous values ofE are determined for subjects with heart diseases of varied etiologies, in order to assess the responses of the l.v. to chronic overloads of pressure and volume. Resulting values forE are used diagnostically to characterise the physiological state of the l.v. Normal values ofE, at systole, indicate that the strength of contraction exercised by the l.v. is normal, and hence is an indication of the l.v. having adjusted to the heart disease.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02477722
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 66
    Electronic Resource
    Electronic Resource
    Limiting polytope geometry for rigid rods, disks, and spheres (1969)
    Springer
    Journal of statistical physics 1 (1969), S. 179-225 
    Details
    ISSN: 1572-9613
    Keywords: Rigid spheres ; Rigid disks ; Rigid rods ; Elasticity ; High pressure ; Polytopes ; Convexity ; Crystal anharmonicity ; Pair correlation functions ; Multidimensional geometry ; Crystalline order ; Crystal defects
    Source: Springer Online Journal Archives 1860-2000
    Topics: Physics
    Notes: Abstract The available configuration space for finite systems of rigid particles separates into equivalent disconnected regions if those systems are highly compressed. This paper presents a study of the geometric properties of the limiting high-compression regions (polytopes) for rods, disks, and spheres. The molecular distribution functions represent cross sections through the convex polytopes, and for that reason they are obliged to exhibit single-peak behavior by the Brünn-Minkowski inequality. We demonstrate that increasing system dimensionality implies tendency toward nearest-neighbor particle-pair localization away from contact. The relation between the generalized Euler theorem for the limiting polytopes and cooperative “jamming” of groups of particles is explored. A connection is obtained between the moments of inertia of the polytopes (regarded as solid homogeneous bodies) and crystal elastic properties. Finally, we provide a list of unsolved problems in this geometrical many-body theory.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01007250
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 67
    facet.materialart.
    Unknown
    Die nicht-linearen Feldtheorien der Mechanik (1965)
    Springer
    In:  Berlin, Springer, vol. 27, no. 2, pp. 15-17, (ISBN: 3-7643-7044-0)
    Details
    Publication Date: 1965
    Keywords: Handbook of physics ; Elasticity ; Non-linear effects ; Flugge
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    BIBLIOGRAPHY SEISMOLOGY
  • 68
    facet.materialart.
    Unknown
    Elastische Eigenschaften von Gesteinen und Mineralien (1952)
    Springer
    In:  Professional Paper, Landolt Börnstein (6. Edition) III. Band: Astronomie und Geophysik, Berlin, Springer, vol. 7, no. XVI:, pp. 326-330, (ISBN: 3-540-23712-7)
    Details
    Publication Date: 1952
    Keywords: Elasticity ; Rock mechanics ; Physical properties of rocks
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    BIBLIOGRAPHY SEISMOLOGY
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...