ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Articles  (7,803)
  • Nature Publishing Group  (7,803)
  • Cell Press
  • 1995-1999  (7,803)
  • Natural Sciences in General  (7,803)
  • 1
    Electronic Resource
    Electronic Resource
    Structural evidence for dimerization-regulated activation of an integral membrane phospholipase (1999)
    [s.l.] : Nature Publishing Group
    Nature 401 (1999), S. 717-721 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Dimerization is a biological regulatory mechanism employed by both soluble and membrane proteins. However, there are few structural data on the factors that govern dimerization of membrane proteins. Outer membrane phospholipase A (OMPLA) is an integral membrane enzyme which participates in ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/44890
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 2
    Electronic Resource
    Electronic Resource
    Emerging insights into the genesis of epilepsy (1999)
    [s.l.] : Nature Publishing Group
    Nature 399.1999, Supplementary, A15-, (8 S.) 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Epilepsy, a brain disorder that is characterized by recurrent seizures, refers to a collection of disorders that affect 1–2% of the population worldwide. A seizure is a brief change in behaviour caused by the disordered, synchronous and rhythmic firing of populations of neurons in the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/399a015
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 3
    Electronic Resource
    Electronic Resource
    Translating cell biology into therapeutic advances in Alzheimer's disease (1999)
    [s.l.] : Nature Publishing Group
    Nature 399.1999, Supplementary, A23-, (9 S.) 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Studies of the molecular basis of Alzheimer's disease exemplify the increasingly blurred distinction between basic and applied biomedical research.The four genes so far implicated in familial Alzheimer's disease have each been shown to elevate brain levels of the self-aggregating amyloid-β ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/399a023
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 4
    Electronic Resource
    Electronic Resource
    Prospects for new restorative and neuroprotective treatments in Parkinson's disease (1999)
    [s.l.] : Nature Publishing Group
    Nature 399.1999, Supplementary, A32-, (8 S.) 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Parkinson's disease (PD) is one of the major neurodegenerative disorders of middle and old age, and was originally described by James Parkinson in 1817. It is characterized by a trio of cardinal symptoms—muscle rigidity, tremor and bradykinesia—but can also involve postural deficits and ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/399a032
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 5
    Electronic Resource
    Electronic Resource
    Progress in determining the causes and treatment of multiple sclerosis (1999)
    [s.l.] : Nature Publishing Group
    Nature 399.1999, Supplementary, A40-, (8 S.) 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The cause of multiple sclerosis remains unknown after more than a century of study. Unconfirmed work has once more indicated that a viral infection may be important in the aetiology of the disease, and there is considerable evidence for an important genetic influence on disease susceptibility. The ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/399a040
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 6
    Electronic Resource
    Electronic Resource
    Stability offers unique opportunity for research (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 4-5 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] On 13 January this year, Brazil suffered a shock which, if you listen to some commentators abroad, shook it to its very core. In São Paulo the following week, however, the locals were unfazed. By Latin American standards, a devaluation of 25 per cent (later 45 per cent) is not much to get ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/19795
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 7
    Electronic Resource
    Electronic Resource
    Scientists seek support from Mexican public (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 7-9 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...Last year, Luis Herrera-Estrella thought he saw an opportunity to use his science to contribute to Mexico's economy. Herrera-Estrella, a plant biotechnologist at the Centre for Research and Advanced Studies of the National Polytechnic Institute (CINVESTAV), was one of several scientists invited ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18754
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 8
    Electronic Resource
    Electronic Resource
    Customs delays drive researchers to smuggling (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 10-10 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Even for those fortunate scientists in Latin America who manage to obtain adequate funding, have bright graduate students to work with and fast Internet links connecting them to the world of science, a major obstacle remains on the road to first-rate research: fast access to equipment and ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18763
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 9
    Electronic Resource
    Electronic Resource
    Centre fights fixation with basic research (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 9-20 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The challenge of combining high-quality basic research with a mission to address the country's wider needs is embodied in the experience of UNAM's Nitrogen Fixation Research Centre, in Cuernavaca. The centre was founded in 1980 with the aim of studying the molecular basis of biological nitrogen ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18760
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 10
    Electronic Resource
    Electronic Resource
    Chile tries to bridge gap in scientific standards (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 11-12 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...Whichever way you look at it — by the reputation of its leading researchers abroad or the orderliness of its universities, by the amount its government spends on science or the number of papers its researchers publish each year in international journals — Chile's small scientific ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18766
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 11
    Electronic Resource
    Electronic Resource
    Andes observatories belatedly take root (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 13-13 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...Many astronomers regard Chile as the best place on Earth for astronomy. A stroll at night outside the dome at the Cerro Tololo Inter-American Observatory (CTIO) near La Serena in northern Chile reveals why. The sky is crystal clear, and so still that stable images of stars are a near certainty. ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18774
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 12
    Electronic Resource
    Electronic Resource
    Community split on Peronist reform effort (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 14-15 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...After a hectic day fighting to save his country from currency contagion — it's Monday on the week after the Brazilian réal collapsed, and speculators have the Argentinian peso in their sights — the Argentinian chef de cabinet, Jorge Rodríguez, is relaxed and relieved to ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18778
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 13
    Electronic Resource
    Electronic Resource
    Collapse of réal sharpens Brazil's contrasts (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 16-18 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...One of the least welcome tasks facing researchers at the Federal University of Rio de Janeiro — the second largest research university in Brazil — is to review grant applications from their colleagues 300 miles inland in São Paulo. “They ask for money for ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18785
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 14
    Electronic Resource
    Electronic Resource
    Brazil's space programme comes of age (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 19-19 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...This year, if schedules hold, Brazil will finally realize its 20-year ambition to join the first rank of spacefaring nations. The agenda for 1999 has all the ingredients of a mature space programme, from the debut of a new Brazilian rocket to the selection of astronauts to fly on the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18791
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 15
    Electronic Resource
    Electronic Resource
    Resources lacking to save Amazon biodiversity (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 20-21 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...The people of the Amazon basin are among the poorest of South America, but the region's rainforests are home to the richest diversity of life in the world. The potential of that wealth for the region was recognized implicitly for the first time in 1992, when representatives of 150 nations ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18795
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 16
    Electronic Resource
    Electronic Resource
    Cuban biotechnology treads a lonely path (1999)
    [s.l.] : Nature Publishing Group
    Nature 398 (1999), S. 22-23 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] ...“Cuba's future must, by necessity, be a future of scientists,” Fidel Castro declared in 1960, soon after the Cuban revolution. Almost 40 years later, his prophesy is some way from fulfilment. But in one area of applied science — biotechnology — a concerted national effort ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/18799
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 17
    Electronic Resource
    Electronic Resource
    The changing landscape of ischaemic brain injury mechanisms (1999)
    [s.l.] : Nature Publishing Group
    Nature 399.1999, Supplementary, A7-, (8 S.) 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] There is growing optimism among researchers in the field of brain ischaemia, as human stroke has at last become treatable and current research efforts delineate several new, potential therapies. Most strokes are caused by acute interruption of the brain arterial blood supply by a thrombus, leading ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/399a007
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 18
    Electronic Resource
    Electronic Resource
    Absence of a planetary signature in the spectra of the star 51 Pegasi (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 795-796 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] As part of a long-term study of magnetic-cycle-type variations in cool stars3'4, observations of 51 Peg have been collected for a number of years at the University of Western Ontario using a coude spectrograph5 having a resolving power of -100,000. This Letter is based on data from 39 exposures ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385795a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 19
    Electronic Resource
    Electronic Resource
    Induction of molecular asymmetry by a remote chiral group (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 799-801 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The more general aspects of the long-range asymmetric induction explored here can be represented by equation (1) where R* is chiral and FG is a functional group that allows a reaction to take place such that 1 is converted into 2 with the creation of new stereochemical information R*. Our aim was ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385799a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 20
    Electronic Resource
    Electronic Resource
    Uniform elemental analysis of materials by sputtering and photoionization mass spectrometry (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 797-799 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] In these experiments, steady-state sputtering of bulk materials was used to eliminate any need to consider preferential sputtering, and to ensure sampling over all velocity components of the sputtered material. Examination using a pulsed ion beam showed that steady-state can be reached when the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385797a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 21
    Electronic Resource
    Electronic Resource
    Eccentricity forcing of Pliocene–Early Pleistocene climate revealed in a marine oxygen-isotope record (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 801-804 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Figure 1 Benthic (Cibicidoides wuellerstorfi) 6180 record from Ocean Drilling Program Site 659 (18°05' N, 21°02' W, 3,070m water depth). Age control is based on oxygen-isotope chronostratigraphy (0-2.85 Myr) and tuning the lithogenic component to 65° N July insolation (2.85-5.2 Myr), as ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385801a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 22
    Electronic Resource
    Electronic Resource
    Vegetation-induced warming of high-latitude regions during the Late Cretaceous period (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 804-807 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Simulations were conducted using a coupled ocean-atmosphere-sea-ice general circulation model (National Center for Atmospheric Research GENESIS Global Climate Model, Version 1.02)8. GENESIS includes an atmospheric model, a mixed-layer ocean model with prescribed ocean heat transport, multi-layer ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385804a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 23
    Electronic Resource
    Electronic Resource
    Lower Palaeolithic hunting spears from Germany (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 807-810 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] In 1983 I began archaeological excavations in the area of the Schoningen brown-coal mine. The mine complex has an area of 6km , of which more than 350,000m has been excavated3'4. During the course of the mining operation and excavation of Holocene sites, the Pleistocene exposures were ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385807a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 24
    Electronic Resource
    Electronic Resource
    Viable offspring derived from fetal and adult mammalian cells (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 810-813 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] It has long been known that in amphibians, nuclei transferred from adult keratinocytes established in culture support development to the juvenile, tadpole stage3. Although this involves differentiation into complex tissues and organs, no development to the adult stage was reported, leaving open the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385810a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 25
    Electronic Resource
    Electronic Resource
    Evidence against a dedicated system for word learning in children (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 813-815 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] In two experiments (study 1 and study 2), 48 three-year-old children (mean age, 3yr 7 months), 47 four-year-old children (mean age, 4yr 5 months) and 48 undergraduate students first participated in a training phase that lasted for about twenty minutes. This phase involved the manipulation of ten ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385813a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 26
    Electronic Resource
    Electronic Resource
    A cGMP-gated cation channel in depolarizing photoreceptors of the lizard parietal eye (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 815-819 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] We recorded under voltage clamp from inside-out membrane patches excised from the outer segments of dissociated parietal-eye photoreceptors of the side-blotched lizard, Uta stansburiana. These photoreceptors are remarkably similar to rods and cones in morphology (Fig. la). The outer segment of the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385815a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 27
    Electronic Resource
    Electronic Resource
    Insensitivity to anaesthetic agents conferred by a class of GABA A receptor subunit (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 820-823 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] In mammals, the 13 known subtypes of GABAA receptor sub units have been categorized within four structural classes (a 1-6, pi-3, *yl-3 and 8). These subunits are thought to assemble in different pentameric complexes, with most functional receptors containing a/P/'Y or a/p/8 subunit combinations11. ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385820a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 28
    Electronic Resource
    Electronic Resource
    Mechanism of resistance of African trypanosomes to cytotoxic human HDL (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 823-826 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The human and animal diseases caused by subspecies of African trypanosomes are biochemically and morphologically indistinguishable14. Resistance to normal human serum is an unstable phenotype in T. b. rhodesiense because trypanosomes susceptible to lysis by human serum rapidly accumulate upon ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385823a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 29
    Electronic Resource
    Electronic Resource
    Hrs-2 is an ATPase implicated in calcium-regulated secretion (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 826-829 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Using the yeast two-hybrid approach10, we isolated a complementary DNA encoding a protein that interacts selectively with SNAP-25. The putative protein encoded by the rat clone is similar to Hrs, a growth-factor-induced phosphoprotein11. The consistent sequence we obtained in the analysis of human ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385826a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 30
    Electronic Resource
    Electronic Resource
    pangolin encodes a Lef-1 homologue that acts downstream of Armadillo to transduce the Wingless signal in Drosophila (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 829-833 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Figure 1 Eye phenotypes of wild-type (a), sev-wg (b), sev-wg, armS9/+ (c) and sev-wg, pa nS28/+ (d) animals. Scanning electron micrographs are shown, anterior is to the left. The smooth, regular arrangement of the ommatidial facets is disrupted by the expression of a sev-wg transgene in a ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385829a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 31
    Electronic Resource
    Electronic Resource
    Finding a gene in a haystack (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 839-843 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] TSG-p53 knockout mice From Taconic Knockout mice deficient in thep53 tumour suppressor gene as a result of homologous recombination According to the manufacturer, recent data show the p53 gene is the most commonly mutated gene in human cancers; ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385839a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 32
    Electronic Resource
    Electronic Resource
    Crystal structure of the anthrax toxin protective antigen (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 833-838 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Protective antigen, named for its use in vaccines, is a long, flat molecule of dimensions 100 X -50 X 30 A (Fig. Ib). Domain 1 (residues 1-258) comprises a p-sandwich with jelly-roll topology, several small helices, and a pair of adjacent calcium ions coordinated by residues in a variant of the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385833a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 33
    Electronic Resource
    Electronic Resource
    Notes for contributors (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 844-844 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Nature is a weekly international journal covering all the sciences. Its readership is interdisciplinary, so manuscripts should be written clearly and simply, authors remembering that English is not the first language of many readers. Competition for Nature's limited space is severe, so brevity is ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385844a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 34
    Electronic Resource
    Electronic Resource
    Science and technology deserve better from Brussels (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 661-661 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Anyone with even superficial knowledge of the history of the European Union (EU) knows that eighteen months can be a very short time in Europolitics. Yet that is all the time that remains before the European Commission needs to issue calls for proposals for the EU's fifth Framework programme (FP5) ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385661a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 35
    Electronic Resource
    Electronic Resource
    Japan's successful launch paves way for interplanetary missions (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 663-663 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [TOKYO] The world's first space-based radio-telescope was launched last week by Japan's Institute of Space and Astronautical Science (ISAS). The event not only marked the start of a major international project in Very Long Baseline Interferometry (VLBI), but was also the first launch for ISAS using ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385663a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 36
    Electronic Resource
    Electronic Resource
    Insurers agree moratorium on gene data (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 663-663 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [LONDON] British insurance companies have provisionally agreed that, for an initial period of two years, they will not use genetic information about individuals in issuing life insurance policies linked to house mortgages for less than £100,000. But the companies are insisting ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385663b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 37
    Electronic Resource
    Electronic Resource
    Europe reshuffles its scientific committees following BSE crisis (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 664-664 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [PARIS] The European Commission has, as anticipated, announced a radical reform of its system of scientific advisory committees, removing them from commission departments whose interests could conflict with considerations of public health and consumer protection. Jacques Santer, the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385664a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 38
    Electronic Resource
    Electronic Resource
    Chemists urge US to ratify weapons pact (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 664-664 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [WASHINGTON] More than 140 chemists and biochemists belonging to the US National Academy of Sciences have added their voices to those urging the US Senate to move quickly to ratify the international Chemical Weapons Convention (CWC). The treaty, which takes effect on 29 April, ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385664b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 39
    Electronic Resource
    Electronic Resource
    EU research plan fails to charm critics (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 665-665 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [MUNICH] Draft proposals for the European Union (EU)'s next five-year research programme, published in Brussels last week, suggest that hopes for a greater concentration of EU research funds on fewer research topics may not materialize. Furthermore, the proposals in the second ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385665a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 40
    Electronic Resource
    Electronic Resource
    EMBO panel gives biology in Finland a pat on the back ... (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 666-666 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [HELSINKI] Molecular biology and biotechnology research in Finland has been given a glowing report in a study by the European Molecular Biology Organization (EMBO), which attributes much of this success to the creation of a multidisciplinary centres-of-excellence programme. Although ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385666a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 41
    Electronic Resource
    Electronic Resource
    ... as privatization windfall fills research coffers (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 666-666 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [HELSINKI] Finland is to use the proceeds from the privatization of a series of state-owned companies related to the chemical, pulp and paper, and heavy metal industries to increase its research budget by 25 per cent over the next three years. The move will make it one of the biggest spenders on ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385666b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 42
    Electronic Resource
    Electronic Resource
    Chair of GMO panel resigns over maize (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 667-667 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [PARIS] One of France's leading human geneticists has resigned as chairman of the committee that advises the French government on genetically modified organisms (GMOs), claiming that a recent decision by the French government to ban the cultivation of a transgenic maize has made his job ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385667a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 43
    Electronic Resource
    Electronic Resource
    Three share Australian prize for telecoms (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 667-667 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [SYDNEY] The Australia Prize, worth A$300,000 (US$375,000) and awarded this year for research work in the field of telecommunications, has been shared by three researchers covering the range from theory to application. At the fundamental end of the spectrum, Allan Snyder (centre), a ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385667b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 44
    Electronic Resource
    Electronic Resource
    Sceptics and salmon challenge scientists (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 668-668 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [SEATTLE] A sharp controversy has broken out around the scientific uncertainties involved in proposals to introduce a new, ecosystem-based approach to save dwindling salmon stocks found in the Columbia River basin, the main river system in the northwestern United States. Plans to ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385668a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 45
    Electronic Resource
    Electronic Resource
    'Whistleblowers face blast of hostility' (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 669-669 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [SEATTLE] Whistleblowers who alert authorities to alleged instances of scientific misconduct are facing an increasingly hostile environment in which colleagues, research administrators and even investigators called in to examine their claims are closing ranks against them, the annual meeting of the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385669a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 46
    Electronic Resource
    Electronic Resource
    Marconi's daughter sends out distress call about collection (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 669-669 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [LONDON] The archives of Guglielmo Marconi (right), the inventor of wireless communication, which had been due for auction in April, are expected to be withdrawn from sale in the wake of a public outcry that included complaints from Marconi's daughter Elettra. Some 1,000 individual ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385669b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 47
    Electronic Resource
    Electronic Resource
    News in brief (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 670-670 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [PARIS] French scientists are supporting a growing campaign of civil disobedience launched last week by artists and intellectuals in protest at proposed legislation to control illegal immigration. Opposition to the law - which comes up for a second reading in the National Assembly this week - ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385670a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 48
    Electronic Resource
    Electronic Resource
    Patent threat to research (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 672-672 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Sir- The proposed Directive to the European Parliament and Council of the European Union on biotechnological patents (95/0350(COD)), currently under discussion, poses a threat to the future of scientific and medical research. Its potential consequences are as serious as those arising from the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385672a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 49
    Electronic Resource
    Electronic Resource
    Not such a bad book (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 672-672 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Sir- I did not see proofs of my review of Triple-Helical Nucleic AcidsbyV. N. Soyfer and V. N Potaman, and, in consequence of the editing, the printed result (Nature 385, 218; 1997) was much more negative than I had intended. The book reviewed the structural aspects of triplex structures extremely ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385672b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 50
    Electronic Resource
    Electronic Resource
    Improvement welcome (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 672-672 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Sir- Philip Anderson's review of Per Bak's book How Nature Works: The Science of Self-Organized Criticalityis seriously flawed1. Among other things, he claims that "Bak quotes two authors from Ilya Prigogine's institute who seem to have revived (20 years later and without attribution), the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385672c0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 51
    Electronic Resource
    Electronic Resource
    Improvement welcome (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 672-672 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Philip Anderson replies- The words "without attribution" referred only to the book's author, Per Bak, and not to the original authors, whose work I had not seen, and who I could assume gave proper references. But my other comment remains valid. When Ruderman, Pines and Shaham ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385672d0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 52
    Electronic Resource
    Electronic Resource
    A crisis in scientific morale (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 673-674 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] So long as individual scientists believe, and behave according to the belief, that the essence of success in science is the freedom to discover the right experiment and then to do it according to one's own lights, all the social structures that connect scientists to one another will be based solely ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385673a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 53
    Electronic Resource
    Electronic Resource
    A new age for type-II superconductors? (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 675-676 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Many properties of materials depend crucially on defects. Soft metals bend irreversibly when dilute concentrations of defects called dislocation lines move in response to an applied stress. The Bronze Age began when early metallurgists added small concentrations of tin to copper to create a ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385675a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 54
    Electronic Resource
    Electronic Resource
    Different means to common ends (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 676-677 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Telomeres - the structures that are found at the ends of eukaryotic chromosomes - have evolved to solve two problems: they ensure the complete replication of chromosome ends (which cannot be accomplished by known DNA poly-merases), and they protect those ends from degradation or fusion1. In most ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385676a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 55
    Electronic Resource
    Electronic Resource
    The nose leads the eye (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 677-679 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Stimuli such as light, odours, hormones and other chemical signals, generate an intracellular response by altering the levels of intracellular second messengers. This type of signal transduction involves three components - a receptor protein that interacts directly with the stimulus; a ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385677a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 56
    Electronic Resource
    Electronic Resource
    Plus c'est le même chews (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 679-679 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] This small piece of used chewing gum (actual size) is 6,500 years old. It was found in a bog at Bokeberg in Sweden, and similar ancient chewing gum has been discovered at sites all over Northern Europe. What was it made of? It is clearly some sort of natural tar. Pine resin was one ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385679a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 57
    Electronic Resource
    Electronic Resource
    Memory floxed (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 680-681 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] As the generations come and go, new memories are made while old ones fade away. The arrival of a new generation of mouse mutants, together with advances in their electrophysiological assessment, have now been heralded with the publication of four papers by Susumu Tonegawa, Eric Kandel and their ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385680a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 58
    Electronic Resource
    Electronic Resource
    Restricting gene inactivation to a subset of neurons (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 680-680 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Cre is a bacteriophage recombinase that excises DNA between a pair of paiindromic sequences called toxP sites11. If the loxP sites are introduced into a mouse so as to flank a targeted gene (referred to as the f loxed gene, for 'flanked by loxP1), that gene will be excised in cells that express ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385680b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 59
    Electronic Resource
    Electronic Resource
    Cool tropical punch of the ice ages (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 681-683 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] It seems incongruous, but many climatolo-gists now believe that the key for unlocking the mysteries of the ice ages may be found in the tropics. Climate model simulations conducted by Webb et a/.1, published on page 695 of this issue, suggest a surprisingly effective means for cooling the ice-age ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385681a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 60
    Electronic Resource
    Electronic Resource
    100 YEARS AGO (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 684-684 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] In view of the importance which attaches to Dr. Yersin's discovery of the plague virus and its anti-toxin, the following notes on his work may be of interest.... While at Tonkin, in the spring of 1894, he received the request from the French Government to proceed to Hong Kong to study the plague ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385684a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 61
    Electronic Resource
    Electronic Resource
    Blocking adenoslne with antisense (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 684-685 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Over the past decade, the widely recognized growth in the incidence of asthma has increased the need for new therapies. The aim of any asthma therapy is to control the inflammation and hyper-sensitivity of the airways that result from the condition. The purine adenosine has been implicated in both ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385684b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 62
    Electronic Resource
    Electronic Resource
    The amazing atom laser * (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 685-686 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The word laser now has a strong emo-I tional impact, conjuring up images of I space-battles and high-tech surgery. There was a time when this strange acronym, as yet unloved by science-fiction writers, conjured up nothing at all to a general audience. What is more, scientists thought of the laser ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385685a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 63
    Electronic Resource
    Electronic Resource
    Sheets of light (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 686-686 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Optical fibres can not only transmit light-pulses jthe| can amplify them. When illuminated by a suitable pumping radiation, an erbium-doped silica fibre becomes a distributed laser, amplifying the pulses that travel along it. Daedalus is now extending tiie principle to two dimensions. ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385686a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 64
    Electronic Resource
    Electronic Resource
    Giant female or dwarf male spiders? (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 687-688 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Explanations of the difference in size between male and female spiders usually assume male dwarfism, thus implying that males, rather than females, have changed in size1'3 (but see refs 4-6). A well-known case of sexual dimorphism is the orb-weaving tetragnathid spider genus Nephila (Fig. 1), in ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385687a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 65
    Electronic Resource
    Electronic Resource
    Giant female or dwarf male spiders? (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 688-688 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Vollrath and Parker reply - Spider males are smaller than females, with very few exceptions1'2. This sexual dimorphism is an ancient trait: males are marginally smaller in liphistiid spiders ('living fossils' with a segmented abdomen)3 and trapdoor spiders4. Compared with 'modern' labidognath ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385688a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 66
    Electronic Resource
    Electronic Resource
    Hydration in electrical double layers (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 689-690 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The interaction between two surfaces separated by an electrolyte (an electrical double layer) is a fundamental determinant of the behaviour of colloids. Direct measurement of this interaction1'2 revealed a strong, approximately exponential, short-range repulsion that has been interpreted as an ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385689a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 67
    Electronic Resource
    Electronic Resource
    A gene family of silicon transporters (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 688-689 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Silicon is essential in biological systems, affecting development and cellular metabolism1"4. In polymerized form, as silica, it is a biological material with valuable structural characteristics2. Yet little is known at the molecular level about how cells transport, process and use silicon. Here we ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385688b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 68
    Electronic Resource
    Electronic Resource
    Hydration in electrical double layers (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 690-690 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Israelachvili and Wennerstrom reply - Marcelja's theoretical analysis is an important development in our understanding of the electrostatic interactions between charged surfaces in aqueous electrolyte solutions. The analysis supports our recent suggestion5 that monotonically repulsive 'hydration ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385690a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 69
    Electronic Resource
    Electronic Resource
    Genius triumphs over jealousy (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 691-692 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Large scientific collaborations breed infighting. Sometimes this stimulates the progress of an experiment, but more often the acrimony leaves bitter scars. The CORE satellite project, which mapped cosmic background radiation for four years after its launch in November 1989, involved more than 1,500 ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385691a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 70
    Electronic Resource
    Electronic Resource
    Flying yellow kangaroos (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 692-692 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] In 1981, I finally succeeded in getting dropped by helicopter into New Guinea's highest, largest, most remote unexplored mountain range, the uninhabited Foja Mountains, which rise like an island out of lowland swamps. I dreamed of discovering there a population of diprotodonts, the rhinoceros-like ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385692a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 71
    Electronic Resource
    Electronic Resource
    Out of the shadow of the guillotine (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 693-694 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Most scientists and historians of science know Andre-Marie Ampere (1775-1836) solely as the founding father of electrodynamics, in particular as the creator of an elegant law of electrodynamic force. Yet Ampere's interest in electrodynamics came rather late in his career and lasted only six years, ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385693a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 72
    Electronic Resource
    Electronic Resource
    The framework of feelings (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 694-694 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The progress of cognitive neuroscience towards an understanding of mind is beyond question, but one component has so far proved intractable - emotion. With few notable exceptions, the preferred strategy of cognitive neuroscience in dealing with emotion has been to ignore it. Given that so much of ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385694a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 73
    Electronic Resource
    Electronic Resource
    Influence of ocean heat transport on the climate of the Last Glacial Maximum (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 695-699 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] A series of climate simulations using an atmospheric general circulation model shows that maintaining ocean heat transport at close to present-day values, but with otherwise glacial boundary conditions, leads to an enhanced cooling, particularly in the tropics. This is in agreement with recent ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385695a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 74
    Electronic Resource
    Electronic Resource
    Visibility of scattered broad-line emission in Seyfert 2 galaxies (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 700-702 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Since the discovery of a hidden broad-line region (HBLR) in NGC1068, about 12 additional HBLRs have been detected by spectropolarimetry in Seyfert 2 galaxies4"8. Unfortunately, all previous studies are known to be biased in their continuum polarization properties, with samples chosen to be either ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385700a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 75
    Electronic Resource
    Electronic Resource
    Magneto-optical observation of twisted vortices in type-II superconductors (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 702-705 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] The flux structures were visualized using a magneto-optical technique. This technique was initially used to understand the basic principles of vortex line motion under the Lorentz force (j X B) due to a transport supercurrent j (ref. 11); it has been considerably developed and is now particularly ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385702a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 76
    Electronic Resource
    Electronic Resource
    Abrupt changes in early Holocene tropical sea surface temperature derived from coral records (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 705-707 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Our sea surface temperature (SST) data contrast markedly with the results of CLIMAP4 published nearly two decades ago which advanced the view that tropical ocean SSTs varied little between the current interglacial period and the Last Glacial Maximum (LGM) at 18-20kyr ago. Although ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385705a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 77
    Electronic Resource
    Electronic Resource
    Interhemispheric synchrony of the last deglaciation inferred from alkenone palaeothermometry (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 707-710 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] For high latitudes, the clearest palaeotemperature records are obtained from Greenland and Antarctica because amplitudes of climate variations were enhanced at high latitudes and because ice cores provide information at very high resolution for at least the last glacial cycle11"14. Although the ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385707a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 78
    Electronic Resource
    Electronic Resource
    Direct observation of complete miscibility in the albite–H 2 O system (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 710-712 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] In our experiments, we used a Bassett-type externally heated diamond anvil cell6'7. In this cell, the sample is contained in a 500-uim borehole in a rhenium gasket with an initial thickness of 250 u.m. The gasket is compressed between two flat diamond surfaces of 1 mm diameter. Heating is achieved ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385710a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 79
    Electronic Resource
    Electronic Resource
    Multituberculate and other mammal hair recovered from Palaeogene excreta (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 712-714 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Mammalian faeces and bird pellets are usually rare, isolated occurrences in the pre-Pleistocene palaeontological record3'4, as is the preservation of soft tissue such as hair5. We have examined a rich accumulation of hair-containing coprolites and regurgitalites (Fig. 1), an unprecedented datum in ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385712a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 80
    Electronic Resource
    Electronic Resource
    Haramiyids and Triassic mammalian evolution (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 715-718 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Class Mammalia Order Haramiyida Hahn, 1973 Family Haramiyidae Simpson, 1947 Haramiyavia clemmenseni gen. et sp. nov. Etymology. Combining Haramiya, Arabic (fern.)11 for 'trickster, petty thief with avia, Latin for grandmother; clemmenseni, as acknowledgement to Lars B. ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385715a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 81
    Electronic Resource
    Electronic Resource
    Airborne signalling by methyl salicylate in plant pathogen resistance (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 718-721 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Resistance to tobacco mosaic virus (TMV) in tobacco plants (Nicotiana tabacum cv. Xanthi-nc) carrying the AT gene is associated with a hypersensitive response at sites of viral inoculation. While investigating the movement and distribution of salicylic acid (SA) in TMV-inoculated tobacco plants, we ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385718a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 82
    Electronic Resource
    Electronic Resource
    DNA antisense therapy for asthma in an animal model (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 721-725 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Figure 1 a, Effects of adenosine AT receptor antisense ODN upon PC50 values in asthmatic rabbits. PC50 adenosine values were determined before and after intratracheal administration of aerosolized AS or AT MM to allergic rabbits. After a two-week rest period between parts of the experiment, rabbits ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385721a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 83
    Electronic Resource
    Electronic Resource
    Mechanism of odorant adaptation in the olfactory receptor cell (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 725-729 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] We investigated adaptation to odorant stimuli in single, dissociated olfactory receptor cells using whole-cell recording. An odorant pulse was applied to the cell and followed by a second pulse of the same intensity and duration (Fig. la). As reported previously2, the peak amplitude of the response ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385725a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 84
    Electronic Resource
    Electronic Resource
    Editing of ubiquitin conjugates by an isopeptidase in the 26S proteasome (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 737-740 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Figure 1 An intrinsic Ub isopeptidase activity in the PA700 complex, a, Isopeptidase activity assays used 125l-labelled Ub2 as the substrate and, where indicated, 43 nM PA700, 0.6 jxM Ubal, 60 jxM ATP, 14 nM 20S proteasomes, or 26S proteasomes assembled by preincubation of the PA700 and 20S ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385737a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 85
    Electronic Resource
    Electronic Resource
    Control of telomere length by the human telomeric protein TRF1 (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 740-743 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Figure 1 Tetracyclin-regulated expression of TRF1 proteins in HT1080 cells, a, Domain structure of TRF1 proteins used in this study. NLS, putative nuclear localization signal, b, Western analysis of inducible TRF1 expression in HTC75 clones. Whole-cell extracts from induced and uninduced cells were ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385740a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 86
    Electronic Resource
    Electronic Resource
    A metalloproteinase disintegrin that releases tumour-necrosis factor-α from cells (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 729-733 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Soluble TNF-a is released by cleavage of the precursor at the Ala76-Val77 bond, and we have previously shown that TACE cleaves a 12-residue peptide spanning this site with the same specificity3'11. The enzyme was purified by following its activity with an assay for cleavage of this processing-site ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385729a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 87
    Electronic Resource
    Electronic Resource
    Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-α (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 733-736 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Previous studies demonstrated that potent broad-spectrum inhibitors of the matrix metalloproteinases (MMPs) can prevent TNF-a release from monocytic cell lines6"8. These results provided evidence that the target of the inhibitors was TACE. We purified TACE from porcine spleen because this tissue ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385733a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 88
    Electronic Resource
    Electronic Resource
    Notes for contributors (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 748-748 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Nature is a weekly international journal covering all the sciences. Its readership is interdisciplinary, so manuscripts should be written clearly and simply, authors remembering that English is not the first language of many readers. Competition for Nature's limited space is severe, so brevity is ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385748a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 89
    Electronic Resource
    Electronic Resource
    According to the code (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 749-752 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] A visual research tool for custom visual displays The VSG2/3 visual stimulus generator From Cambridge Research Systems A system that creates a variety of both standard and customized visual displays, and drives a variety of monitors This software ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385749a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 90
    Electronic Resource
    Electronic Resource
    Regulation of telomere length and function by a Myb-domain protein in fission yeast (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 744-747 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] gate GGGTTACAAGGTTACGTGGTTACACGGTTACA gate gate GCTATGAATGCAGTAGTCGCGTAGTGTATCGA gate gate GGGTTACAAGGTTACG gate gate TGGTTACACGGTTACA gate gate GGTTACAGGTTACAGG gate gate GGGTTACAGGGGTTAC gate Colony colpqr blue white blue ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385744a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 91
    Electronic Resource
    Electronic Resource
    Bringing enlightenment to the pursuit of justice (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 563-563 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] Last week, a British appeals court overruled a decision by the Human Fertilization and Embryo Authority (HFEA) preventing a woman from travelling to Belgium to be inseminated with the sperm of her dead husband. The verdict, directing the HFEA to reconsider its decision, is the latest step in a ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385563a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 92
    Electronic Resource
    Electronic Resource
    Heavenly prospects and glad tidings (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 563-563 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] After two years of relentless gloom about their long-term funding prospects, scientists in the United States have cause this week for some mild celebration. There is good news in Japan, too, where a very different set of economic circumstances is leading to greater government investment in ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385563b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 93
    Electronic Resource
    Electronic Resource
    Outlook brightens for science in US budget proposals for 1998 (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 565-565 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [WASHINGTON] President Bill Clinton has proposed increases close to the rate of inflation for most US science agencies in his 1998 budget, lifting a threat that his plans to balance the overall federal budget by 2002 would severely hit research funding. The budget plan for the next ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385565a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 94
    Electronic Resource
    Electronic Resource
    Japanese increases include support for CERN's Large Hadron Collider (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 565-565 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [TOKYO] Japan has increased its financial support for the Large Hadron Collider being built at the European Laboratory for Particle Physics (CERN) in Geneva, Switzerland, in a supplementary budget aimed at reinvigorating the flagging Japanese economy. The Ministry of Education, ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385565b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 95
    Electronic Resource
    Electronic Resource
    Heat rises over UCSD 'misconduct' charge (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 566-566 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [SAN DIEGO] In an unusual conflict between academic officials and federal authorities, the US Department of Justice has taken over a federal lawsuit against a researcher at the University of California at San Diego (UCSD) concerning allegedly fraudulent grant applications at the same time as an ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385566a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 96
    Electronic Resource
    Electronic Resource
    Rifts found as Antarctic ice breaks apart (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 566-566 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [LONDON] Researchers from Greenpeace, the environmentalist group, last week came across significant rifts in the southern part of the Larsen ice shelf in the Antarctic peninsula - an area known as Larsen B (see above). Scientists from the British Antarctic Survey predicted last year that Larsen B ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385566b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 97
    Electronic Resource
    Electronic Resource
    UK universities urged to join forces to boost research (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 567-567 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [LONDON] Closer collaboration between British universities, aimed at creating world-class research centres and widening access to the latest research equipment, has been suggested by the government in a paper from the Department for Education. But government officials appear to be ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385567a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 98
    Electronic Resource
    Electronic Resource
    Congress turns the microscope on science spending (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 567-567 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [WASHINGTON] Increased monitoring of federal science agencies, aimed at ensuring that taxpayers get value for money, was revealed last week to be high on the agenda of the new chairman of the House of Representatives Science Committee for the committee's activities over the next two years. ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385567b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 99
    Electronic Resource
    Electronic Resource
    Congress vows to contest 'unacceptable' NIH plans (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 568-568 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [WASHINGTON] Biomedical lobbyists are disappointed that President Clinton's budget proposals for 1998 would increase funding for the US National Institutes of Health (NIH) by 2.6 per cent, only slightly higher than the anticipated level of inflation. If approved by Congress at this ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385568a0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 100
    Electronic Resource
    Electronic Resource
    Despite cutbacks, NASA pulls out of a threatened long-term nosedive (1997)
    [s.l.] : Nature Publishing Group
    Nature 385 (1997), S. 568-568 
    Details
    ISSN: 1476-4687
    Source: Nature Archives 1869 - 2009
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Notes: [Auszug] [WASHINGTON] Although the US National Aeronautics and Space Administration (NASA) is not scheduled for an increase in the proposed 1998 federal budget, it has been spared the steep decline in its tong-term funding that was threatened last year. A relieved NASA administrator, Daniel 001dm, said last ...
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1038/385568b0
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...