ALBERT

Description: Background The Paleolithic diet is promoted worldwide for improved gut health. However, there is little evidence available to support these claims, with existing literature examining anthropometric and cardiometabolic outcomes. Objective To determine the association between dietary intake, markers of colonic health, microbiota, and serum trimethylamine-N-oxide (TMAO), a gut-derived metabolite associated with cardiovascular disease. Design In a cross-sectional design, long-term (n = 44, 〉 1 year) self-reported followers of a Paleolithic diet (PD) and controls (n = 47) consuming a diet typical of national recommendations were recruited. Diets were assessed via 3-day weighed diet records; 48-h stool for short chain fatty acids using GC/MS, microbial composition via 16S rRNA sequencing of the V4 region using Illumina MiSeq. TMAO was quantified using LC–MS/MS. Results Participants were grouped according to PD adherence; namely excluding grains and dairy products. Strict Paleolithic (SP) (n = 22) and Pseudo-Paleolithic (PP) (n = 22) groups were formed. General linear modelling with age, gender, energy intake and body fat percentage as covariates assessed differences between groups. Intake of resistant starch was lower in both Paleolithic groups, compared to controls [2.62, 1.26 vs 4.48 g/day (P 

Description: Purpose Intermittent energy restriction (IER) is a popular weight loss (WL) strategy; however, its efficacy in clinical practice remains unknown. The present study compared the effects of IER compared to continuous energy restriction (CER) on WL and cardiometabolic risk factors in primary care. Methods A (self-selected) cohort study was conducted at the Rotherham Institute for Obesity (RIO), a primary care-based weight management service. 197(24% male) obese patients volunteered to participate and selected their diet group. IER participants (n = 99) consumed ~ 2600 kJ for two days/week. CER participants (n = 98) restricted their diet by ~ 2100 kJ/day below estimated requirements. Both interventions were delivered alongside RIO standard care. Changes in anthropometry and cardiometabolic disease risk markers (fasting biochemistry and blood pressure) were assessed after a 6-month intervention period and then participants were followed up again 6 months later (month 12). Results 27 IER patients (27%) and 39 CER patients (40%) completed the 6-month weight loss phase. Among completers, mean (SEM) WL was greater in the IER group at 6 months (5.4 ± 1.1% versus 2.8 ± 0.6%; p = 0.01), as were reductions in fat mass (p 

Description: Purpose Food-based dietary guidelines are proposed to not only improve diet quality, but to also reduce the environmental impact of diets. The aim of our study was to investigate whether food-related behavioral activation therapy (F-BA) applying Mediterranean-style dietary guidelines altered food intake and the environmental impact of the diet in overweight adults with subsyndromal symptoms of depression. Methods In total 744 adults who either received the F-BA intervention (F-BA group) or no intervention (control group) for 12 months were included in this analysis. Food intake data were collected through a food frequency questionnaire at baseline and after 6 and 12 months. Greenhouse gas emissions (GHGE), land use (LU), and fossil energy use (FEU) estimates from life-cycle assessments and a weighted score of the three (pReCiPe score) were used to estimate the environmental impact of each individual diet at each timepoint. Results The F-BA group reported increased intakes of vegetables (19.7 g/day; 95% CI 7.8–31.6), fruit (23.0 g/day; 9.4–36.6), fish (7.6 g/day; 4.6–10.6), pulses/legumes (4.0 g/day; 1.6–6.5) and whole grains (12.7 g/day; 8.0–17.5), and decreased intake of sweets/extras (− 6.8 g/day; − 10.9 to − 2.8) relative to control group. This effect on food intake resulted in no change in GHGE, LU, and pReCiPe score, but a relative increase in FEU by 1.6 MJ/day (0.8, 2.4). Conclusions A shift towards a healthier Mediterranean-style diet does not necessarily result in a diet with reduced environmental impact in a real-life setting. Trial registration ClinicalTrials.gov. Number of identification: NCT02529423. August 2015.

Description: Purpose Previously, the nutritional contribution, environmental and financial costs of dairy products have been examined independently. Our aim was to determine the nutritional adequacy, financial cost and environmental impact of UK diets according to dairy content. Methods In this cross-sectional study of adults (19–64 years) from the UK National Diet and Nutrition Survey years 1–4 (n = 1655), dietary intakes assessed from 4-day estimated food diaries were organized into quartiles (Q) total grams of dairy (milk, cheese, yogurt, dairy desserts) and analyzed using ANCOVA controlling for age, sex and energy intake with Bonferroni post hoc test for nutritional adequacy, Alternative Healthy Eating Index (AHEI-2010), environmental impact [greenhouse gas emissions (GHGE), eutrophication and acidification potentials], financial cost, markers of health and cardio-metabolic diseases. Results Nutritional adequacy, particularly for protein, calcium and iodine (+ 18 g, + 533 mg, + 95 g, respectively, all P 

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The objective of this secondary analysis is to describe the types of commercial complementary foods (CCF) consumed by infants and young children enrolled in the European Childhood Obesity Project (CHOP), to describe the contribution of CCF to dietary energy intakes and to determine factors associated with CCF use over the first 2 years of life.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉The CHOP trial is a multicenter intervention trial in Germany, Belgium, Italy, Poland and Spain that tested the effect of varying levels of protein in infant formula on the risk for childhood obesity. Infants were recruited from October 2002 to June 2004. Dietary data on CCF use for this secondary analysis were taken from weighted, 3-day dietary records from 1088 infants at 9 time points over the first 2 years of life.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Reported energy intakes from CCF during infancy (4–9 months) was significantly higher (〈em〉p〈/em〉 ≤ 0.002) amongst formula-fed children compared to breastfed children. Sweetened CCF intakes were significantly higher (〈em〉p〈/em〉 ≤ 0.009) amongst formula-fed infants. Female infants were fed significantly less CCF and infant age was strongly associated with daily CCF intakes, peaking at 9 months of age. Infants from families with middle- and high-level of education were fed significantly less quantities of CCF compared to infants with parents with lower education. Sweetened CCF were very common in Spain, Italy and Poland, with over 95% of infants and children fed CCF at 9 and 12 months of age consuming at least one sweetened CCF. At 24 months of age, 68% of the CHOP cohort were still fed CCF.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉CCF comprised a substantial part of the diets of this cohort of European infants and young children. The proportion of infants being fed sweetened CCF is concerning. More studies on the quality of commercial complementary foods in Europe are warranted, including market surveys on the saturation of the Western European market with sweetened CCF products.〈/p〉 〈/span〉

Description: 〈p〉Authors of the original article have observed an inadvertent error in their manuscript post-publication.〈/p〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Epidemiological studies directly investigating the association between different types of meat intake and cognitive impairment are limited. We, therefore, examined this association in the Singapore Chinese Health Study.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In total, 16,948 participants were included in analysis. Diet was measured by a 165-item semiquantitative food-frequency questionnaire at baseline (1993–1998) when participants were 45–74 years. Cognitive impairment was defined using a Singapore modified version of Mini-Mental State Examination during follow-up three visits (2014–2016) when participants were 61–96 years. Multivariable logistic regression models were used to estimate odds ratio (OR) and 95% confidence interval (CI).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Cognitive impairment was present in 2443 (14.4%) participants. Compared to the lowest quartile, the highest quartile of red meat intake was associated with increased risk of cognitive impairment (OR 1.16, 95% CI 1.01–1.32, 〈em〉P〈/em〉 for trend = 0.009), while the corresponding value for poultry intake was 0.89 (95% CI 0.78–1.02, 〈em〉P〈/em〉 for trend = 0.10). Higher fresh fish/shellfish was associated with a lower risk of cognitive impairment (OR 0.88, 95% CI 0.77–1.00, 〈em〉P〈/em〉 for trend = 0.03), while preserved fish/shellfish intake was associated with a higher risk (OR 1.19, 95% CI 1.04–1.36, 〈em〉P〈/em〉 for trend = 0.01).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉This study found that a higher intake of red meat in midlife was associated with increased likelihood of cognitive impairment in later life, while substitution of red meat intake with poultry or fresh fish/shellfish was associated with reduced risk.〈/p〉 〈/span〉

Description: 〈p〉In the original publication, the funding and conflict of interest statements were not correct.〈/p〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Background〈/h3〉 〈p〉Enterolignans are important biomarkers of microbiota diversity, with higher levels indicating greater diversity. Diet and inflammation have been shown to play a role in maintaining microbiota diversity. This study examined whether inflammatory potential of diet, as measured by the Dietary Inflammatory Index (DII〈sup〉®〈/sup〉) has an impact on levels of urinary enterolignans in the National Health and Nutrition Examination Survey (NHANES) 2003–2008. We also carried out construct validation of the DII with C-reactive protein (CRP).〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Data came from NHANES 2003–2008. Enterolignans [enterodiol (END) and enterolactone (ENL)] and CRP were assayed from urine and serum specimens, respectively. Energy-adjusted DII (E-DII) scores were calculated from food intakes assessed using 24-h dietary recalls and expressed per 1000 calories consumed. Associations were examined using survey-based multivariable linear and logistic regression for enterolignans, and logistic regression for CRP.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉After multivariable adjustment, higher E-DII scores (i.e., indicating a relatively more pro-inflammatory diet) were associated with lower levels of creatinine-normalized END [beta coefficient (〈em〉b〈/em〉)〈sub〉DIIquartile4vs1〈/sub〉 = − 1.22; 95% CI = − 0.69, − 1.74; 〈em〉P〈/em〉〈sub〉trend〈/sub〉 ≤ 0.001] and ENL (〈em〉b〈/em〉〈sub〉DIIquartile4vs1〈/sub〉 = − 7.80; 95% CI = − 5.33, − 10.26; 〈em〉P〈/em〉〈sub〉trend〈/sub〉 ≤ 0.001). A positive association was also observed when enterolignans were dichotomized based on the cut-off of the 75th percentile value. In this same sample, the E-DII also was associated with CRP ≥ 3 mg/l (OR〈sub〉DIIcontinuous〈/sub〉 = 1.12; 95% CI 1.05, 1.19).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉In these NHANES data, there was an association between E-DII score and enterolignans. This study also provided construct validation of the E-DII using CRP in a nationally representative sample. The results indicate that dietary inflammatory potential is associated with urinary enterolignans, a potential marker for microbiota diversity. However, studies are required to understand the direct association between DII and microbiota.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Evidence of low-carbohydrate, high-fat diets (LCHF) for type 2 diabetes (T2DM) prevention is scarce. We investigated how carbohydrate intake relates to HbA1c and T2DM prevalence in a nationally representative survey dataset.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We analyzed dietary information (4-day food diaries) from 3234 individuals aged ≥ 16 years, in eight waves of the UK National Diet and Nutrition Survey (2008–2016). We calculated LCHF scores (0–20, higher score indicating lower  %food energy from carbohydrate, with reciprocal higher contribution from fat) and UK Dietary Reference Value (DRV) scores (0–16, based on UK dietary recommendations). Associations between macronutrients and diet scores and diabetes prevalence were analyzed (in the whole sample) using multivariate logistic regression. Among those without diabetes, analyses between exposures and %HbA1c (continuous) were analyzed using multivariate linear regression. All analyses were adjusted for age, sex, body mass index, ethnicity, smoking status, total energy intake, socioeconomic status and survey years.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉In the overall study sample, 194 (6.0%) had diabetes. Mean intake was 48.0%E for carbohydrates, and 34.9%E for total fat. Every 5%E decrease in carbohydrate, and every 5%E increase in fat, was associated with 12% (95% CI 0.78–0.99; 〈em〉P 〈/em〉= 〈em〉0.03〈/em〉) and 17% (95% CI 1.02–1.33; 〈em〉P 〈/em〉= 0.02) higher odds of diabetes, respectively. Each two-point increase in LCHF score is related to 8% (95% CI 1.02–1.14; 〈em〉P 〈/em〉= 0.006) higher odds of diabetes, while there was no evidence for association between DRV score and diabetes. Among the participants without diagnosed diabetes (〈em〉n〈/em〉 = 3130), every 5%E decrease in carbohydrate was associated with higher %HbA1c by + 0.016% (95% CI 0.004–0.029; 〈em〉P 〈/em〉= 0.012), whereas every 5%E increase in fat was associated with higher  %HbA1c by + 0.029% (95% CI 0.015–0.043; 〈em〉P 〈/em〉〈 0.001). Each two-point increase in LCHF score is related to higher  %HbA1c by + 0.010% (0.1 mmol/mol), while each two-point increase in the DRV score is related to lower  %HbA1c by − 0.023% (0.23 mmol/mol).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Lower carbohydrate and higher fat intakes were associated with higher HbA1c and greater odds of having diabetes. These data do not support low(er) carbohydrate diets for diabetes prevention.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The association of glycemic index (GI) and glycemic load (GL) with metabolic syndrome (MetS) is controversial. Therefore, we conducted this first systematic review and dose–response meta-analysis of observational studies to quantify these associations.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We searched PubMed, EMBASE, Web of Science, and the Cochrane Library for relevant studies up to 1 April 2019. Summary odds ratios (OR) and 95% confidence intervals (CI) were calculated by a random-effects model. This study was registered with PROSPERO (CRD42019131788).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉We included eight high-quality (〈em〉n〈/em〉 = 5) or medium-quality (〈em〉n〈/em〉 = 3) cross-sectional studies in the final meta-analysis, comprising 6058 MetS events and 28,998 participants. The summary ORs of MetS for the highest versus lowest categories were 1.23 (95% CI 1.10–1.38, 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 0, tau〈sup〉2〈/sup〉 = 0, 〈em〉n〈/em〉 = 5) for dietary GI, 1.06 (95% CI 0.89–1.25, 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 36.2%, tau〈sup〉2〈/sup〉 = 0.0151, 〈em〉n〈/em〉 = 6) for dietary GL. The summary OR was 1.12 (95% CI 1.00–1.26, 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 0, tau〈sup〉2〈/sup〉 = 0, 〈em〉n〈/em〉 = 3) per 5 GI units, 0.96 (95% CI 0.83–1.10, 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 33.4%, tau〈sup〉2〈/sup〉 = 0.0059, 〈em〉n〈/em〉 = 2) per 20 GL units.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Dietary GI was positively associated with the prevalence of MetS. However, no significant association was found between dietary GL and the prevalence of MetS. Further studies with prospective design are needed to establish potential causal relationship between dietary GI and the MetS.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Background〈/h3〉 〈p〉Inflammatory processes are involved in chronic diseases. It has been suggested that melatonin reduces inflammation by its radical scavenging properties; however, the results of the previous studies are inconclusive. The objective of the present meta-analysis is to determine the direction and magnitude of melatonin supplementation effect on inflammatory biomarkers.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Databases including PubMed, Scopus, Cochran Library, Embase, and Google Scholar were searched up to April 2019. Meta-analysis was performed using random-effect model. Subgroup analysis, sensitivity analysis, and meta-regression were also carried out.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Thirteen eligible studies with 22 datasets with total sample size of 749 participants were included in the meta-analysis. Melatonin supplementation significantly decreased TNF-α and IL-6 levels [(WMD = − 2.24 pg/ml; 95% CI − 3.45, − 1.03; 〈em〉P〈/em〉 〈 0.001; 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 96.7%, 〈em〉P〈/em〉〈sub〉heterogeneity〈/sub〉 〈 0.001) and (WMD = − 30.25 pg/ml; 95% CI − 41.45, − 19.06; 〈em〉P〈/em〉 〈 0.001, 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 99.0%; 〈em〉P〈/em〉〈sub〉heterogeneity〈/sub〉 〈 0.001)], respectively. The effect of melatonin on CRP levels was marginal (WMD = − 0.45 mg/L; 95% CI − 0.94, 0.03; 〈em〉P〈/em〉 = 0.06; 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 96.6%, 〈em〉P〈/em〉〈sub〉heterogeneity〈/sub〉 〈 0.001).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉The results of the present meta-analysis support that melatonin supplementation could be effective on ameliorating of inflammatory mediators.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉We investigated the effect of dietary fats on the incorporation of saturated (SAFAs) and monounsaturated dietary fatty acids (MUFAs) into plasma phospholipids and the regulation of the expression of lipid-metabolizing enzymes in the liver.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Mice were fed different diets containing commonly used dietary fats/oils (coconut fat, margarine, fish oil, sunflower oil, or olive oil) for 4 weeks (〈em〉n〈/em〉 = 6 per diet group). In a second experiment, mice (〈em〉n〈/em〉 = 6 per group) were treated for 7 days with synthetic ligands to activate specific nuclear hormone receptors (NHRs) and the hepatic gene expression of CYP26A1 was investigated. Hepatic gene expression of stearoyl-coenzyme A desaturase 1 (SCD1), elongase 6 (ELOVL6), and CYP26A1 was examined using quantitative real-time PCR (QRT-PCR). Fatty acid composition in mouse plasma phospholipids was analyzed by gas chromatography (GC).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉We found significantly reduced hepatic gene expression of SCD1 and ELOVL6 after the fish oil diet compared with the other diets. This resulted in reduced enzyme-specific fatty acid ratios, e.g., 18:1n9/18:0 for SCD1 and 18:0/16:0 and 18:1n7/16:1n7 for ELOVL6 in plasma phospholipids. Furthermore, CYP26A1 a retinoic acid receptor-specific target was revealed as a new player mediating the suppressive effect of fish oil-supplemented diet on SCD1 and ELOVL6 hepatic gene expression.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Plasma levels of MUFAs and SAFAs strongly reflect an altered hepatic fatty acid-metabolizing enzyme expression after supplementation with different dietary fats/oils.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Wheat is a frequent elicitor of food allergy in childhood. Especially in popular media, the better digestibility and the lower allergenicity of ancient grains are repeatedly postulated. We addressed the question whether ancient wheat-related grains are less allergenic than modern wheat.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Proteins from cultivars of spelt, einkorn, emmer and durum along with durum soft wheat flour, Tritordeum and bread wheat were separated by electrophoresis. Immunoblots were performed with a pool serum of six sera from wheat-sensitized children aged 1–11 years (wheat-specific IgE 22 kU〈sub〉A〈/sub〉/l). As controls, pool serum from five sera atopic patients aged 3–13 years who had no sensitization to wheat (wheat-specific IgE 0.11 kU〈sub〉A〈/sub〉/l) and six sera from non-atopics at the age of 3 months to 5 years (wheat-specific IgE 0.06 kU〈sub〉A〈/sub〉/l) was used. Area under the curve (AUC) in Coomassie-stained gels and immunoblots was determined and related.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Water/salt-soluble protein patterns were very similar among varieties. In einkorn cultivars, one protein band corresponding to an alpha-amylase/trypsin inhibitor (ATI) was absent. Water-insoluble protein fractions differed markedly among varieties and cultivars. IgE bound to a large number of proteins in all protein fractions both in wheat and in the wheat-related ancient grains.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Patients with sensitization to wheat show a significant IgE binding against both modern and ancient grain varieties of the genus Triticum. Therefore, ancient grains do not appear to have a generally reduced risk for wheat allergy sufferers. However, few individuals only sensitized to ATI could benefit from the consumption of einkorn.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Western diet, rich in carbohydrates and fat, is said to be a major factor underlying metabolic syndrome. Interventions with prebiotics, the key modulators of the gut microbiota, have paramount impact on host-associated metabolic disorders. Herein, we investigated the effect of fungus-derived (1,3)/(1,6)-β-glucan, a highly soluble dietary fiber, on high-fat diet (HFD)-induced metabolic distress.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Male C57BL/6 J mice were fed with different diet groups (〈em〉n〈/em〉 = 11): control diet, HFD, 3 g/kg or 5 g/kg of β-glucan-incorporated HFD. At the end of experimental study period (12th week), body weight, feces weight and fecal moisture content were observed. Further, colonic motility was measured using activated charcoal meal study. Proteins extracted from liver and intestine tissues were subjected to western blot technique. Paraffin-embedded intestinal tissues were sectioned for histochemical [Periodic acid-Schiff (PAS) and Alcian blue (AB) staining] analysis. Fecal microbiota analysis was performed using MOTHUR bioinformatic software.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉β-glucan consumption exhibited anti-obesity property in mice groups fed with HFD. In addition, β-glucan ameliorated HFD-induced hepatic stress, colonic motility and intestinal atrophy (reduction in colon length, goblet cells, and mucosal layer thickness). Further, β-glucan incorporation shifted bacterial community by increasing butyrate-producing bacteria such as 〈em〉Anaerostipes〈/em〉, 〈em〉Coprobacillus〈/em〉, and 〈em〉Roseburia〈/em〉 and decreasing reportedly obesity-associated bacteria such as 〈em〉Parabacteroides〈/em〉 and 〈em〉Lactococcus.〈/em〉〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Altogether, the outcomes of this present pre-clinical animal study show β-glucan to be a promising therapeutic candidate in the treatment of HFD-induced metabolic distress. Further comprehensive research has to be conducted to brace its clinical relevance, reproducibility and efficacy for aiding human health.〈/p〉 〈/span〉 〈span〉 〈h3〉Graphical abstract〈/h3〉 〈p〉 〈span〉 〈span〉 〈img alt="" src="https://static-content.springer.com/image/MediaObjects/394_2019_2110_Figa_HTML.png"〉 〈/span〉 〈/span〉 〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Background〈/h3〉 〈p〉A healthy diet and optimal lifestyle choices are amongst the most important actions for the prevention of cardiometabolic diseases. Despite this, it appears difficult to convince consumers to select more nutritious foods. Furthermore, the development and production of healthier foods do not always lead to economic profits for the agro-food sector. Most dietary recommendations for the general population represent a “one-size-fits-all approach” which does not necessarily ensure that everyone has adequate exposure to health-promoting constituents of foods. Indeed, we now know that individuals show a high variability in responses when exposed to specific nutrients, foods, or diets.〈/p〉 〈/span〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉This review aims to highlight our current understanding of inter-individual variability in response to dietary bioactives, based on the integration of findings of the COST Action POSITIVe. We also evaluate opportunities for translation of scientific knowledge on inter-individual variability in response to dietary bioactives, once it becomes available, into practical applications for stakeholders, such as the agro-food industry. The potential impact from such applications will form an important impetus for the food industry to develop and market new high quality and healthy foods for specific groups of consumers in the future. This may contribute to a decrease in the burden of diet-related chronic diseases.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Increased circulating concentrations of short-chain fatty acids (SCFA) achieved by ingestion of high-fibre diets is associated with anti-inflammatory effects through promotion of FoxP3+ regulatory T(reg) cells in mouse models. This study aimed to determine whether similar increments in blood SCFA levels can be achieved in humans and whether these are associated with similar immune modulatory effects.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In a pilot single-blinded, randomised, controlled cross-over study in ten healthy subjects, the effects were determined of high- (39 g/day) and low-fibre (18 g/day) intake (all food provided) on SCFA (gas chromatography), proportions of Treg cells (flow cytometry) and a panel of cytokines (multiplex methodology) measured in peripheral blood at day 5 of each diet.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Actual fibre intake differed between the diets by 19 [16–21] g/day (〈em〉P〈/em〉〈 0.001). Median [range] total plasma SCFA levels with high-fibre intake were 174.5 [104.8–249.5] µmol/L, which were greater than those associated with low-fibre intake at 59.0 [26.5–79.9] (〈em〉P 〈/em〉〈 0.001). Differences were significantly different for both acetate and propionate. The frequencies of total CD4 T cells and T-regulatory cells, and concentrations of inflammatory and anti-inflammatory cytokines were not significantly different between the dietary interventions.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Plasma SCFA levels can be modulated by altering dietary fibre consumption in healthy individuals with increments similar to those achieved in murine studies. Five days of diet intervention did not result in changes in regulatory T-cell proportions and cytokine concentrations in peripheral blood, and may require longer duration of dietary change.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Observational studies have suggested that polyunsaturated fatty acids (PUFAs) may decrease Alzheimer’s disease (AD) risk. In the present study, we examined this hypothesis using a Mendelian randomization analysis.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We used summary statistics data for single-nucleotide polymorphisms associated with plasma levels of n-6 PUFAs (linoleic acid, arachidonic acid) and n-3 PUFAs (alpha-linolenic acid, eicosapentaenoic acid, docosapentaenoic acid, docosahexaenoic acid), and the corresponding data for AD from a genome-wide association meta-analysis of 63,926 individuals (21,982 diagnosed AD cases, 41,944 controls).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉None of the genetically predicted PUFAs was significantly associated with AD risk; odds ratios (95% confidence interval) per 1 SD increase in PUFA levels were 0.98 (0.93, 1.03) for linoleic acid, 1.01 (0.98, 1.05) for arachidonic acid, 0.96 (0.88, 1.06) for alpha-linolenic acid, 1.03 (0.93, 1.13) for eicosapentaenoic acid, 1.03 (0.97, 1.09) for docosapentaenoic acid, and 1.01 (0.81, 1.25) for docosahexaenoic acid.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉This study did not support the hypothesis that PUFAs decrease AD risk.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Our aim was to estimate the prevalence of folate inadequacy (POFI) according to life stage, socio-economic status, and geographical regions after the mandatory fortification of wheat and maize flour in Brazil.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉This was a population-based study. Data from two non-consecutive food records from the National Dietary Survey/Household Budget Survey 2008–2009 were used to estimate the usual dietary folate intake in µg dietary folate equivalents (DFEs). The National Cancer Institute method was used to account for within-person variance and the Estimated Average Requirement (EAR) cut-point method was used to calculate the POFI. The survey included 32,749 individuals, 15,700 males and 17,049 females, over 10 years old. Pregnant women, lactating women, and individuals with unreliable energy intake data were excluded.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Overall POFI was 31.5% and mean dietary folate intake was 411.1 µg DFE. The lowest POFI occurred in the youngest age group of 10–13 years in both sexes, while the highest POFI was observed in the group ≥ 71 years. In women of childbearing age, POFI was around 32%. The lowest income strata had the highest POFI. The most developed regions (South and Southeast) had the lowest POFI compared to less developed regions.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our data show that folate inadequacy is still prevalent in Brazil mainly in low-income groups and less developed regions. Actions need to be taken to ensure that women of childbearing age, who presented a high prevalence of inadequate folate intake, achieve the recommended daily intake of 400 µg DFEs.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Critically low skeletal muscle mass and strength, observed in 20% of people with chronic heart failure (CHF), reduces functional capacity, quality of life (QoL) and survival. Protein and essential amino acid (EAA) supplementation could be a viable treatment strategy to prevent declines in muscle strength and performance, and subsequently improve QoL and survival. This systematic review (PROSPERO: CRD42018103649) aimed to assess the effect of dietary protein and/or EAA supplementation on muscle strength and performance in people with CHF.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Searches of PubMed, MEDLINE and Embase identified studies that reported changes in strength or muscle performance following protein and/or EAA supplementation in patients with CHF. Following PRISMA guidelines and using predefined inclusion/exclusion criteria relating to participants, intervention, control, outcome and study design, two reviewers independently screened titles, abstracts and full manuscripts for eligibility. Risk of bias was assessed using Cochrane Risk of Bias Tool (RCTs) or Mixed Methods Appraisal Tool (cohort studies). Data were extracted for analysis using predefined criteria.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Five randomised controlled trials (RCT) and one cohort study met our inclusion criteria. All RCTs had a high risk of bias. The methodological quality of the cohort study was moderate. Heterogeneity of extracted data prevented meta-analyses, qualitative synthesis was therefore performed. Data from 167 patients with CHF suggest that protein and/or EAA supplementation does not improve strength, but may increase six-minute walk test distance, muscle mass and QoL.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉The limited quality of the studies makes firm conclusions difficult, however protein and/or EAA supplementation may improve important outcome measures related to sarcopenia. High-quality randomised controlled studies are needed.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The objective of the study was to evaluate the anti-obesity effect of 〈em〉Lactobacillus rhamnosus〈/em〉 LS-8 and 〈em〉Lactobacillus crustorum〈/em〉 MN047, and illustrate the potential functional mechanism about the alleviation of high fat and high fructose diet (HFFD) induced obesity and related metabolic abnormalities.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉C57BL/6J mice were subjected to a standard or HFFD with or without supplementation of 〈em〉L. rhamnosus〈/em〉 LS-8 and 〈em〉L. crustorum〈/em〉 MN047 for 10 weeks. Obesity related metabolic indices including glucose tolerance, insulin resistance, serum lipid, liver function, hormones and inflammatory cytokines were assessed by standard protocols. For the monitoring of inflammatory response and lipid metabolism, transcriptional levels were profiled in liver and/or adipose tissues. Furthermore, gut microbiota composition analyses in the fecal samples were performed using 16S rRNA gene sequencing, and gut microbial metabolites, including lipopolysaccharide (LPS) and short-chain fatty acids (SCFAs), were also tested for the assessment of the relationship between gut microbiota variation and inflammatory response.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Administration with 〈em〉L. rhamnosus〈/em〉 LS-8 and 〈em〉L. crustorum〈/em〉 MN047 significantly mitigated body weight gain and insulin resistance, and inflammatory response (TNF-α, IL-1β and IL-6 levels in serum and corresponding mRNA levels in adipose tissues) was significantly inhibited in these two strains-treated mice. Moreover, 〈em〉L. rhamnosus 〈/em〉LS-8 and 〈em〉L. crustorum〈/em〉 MN047 could partially normalized mRNA expression levels involved in lipid metabolism including 〈em〉Pparγ〈/em〉, 〈em〉Srebp〈/em〉-〈em〉1c〈/em〉, 〈em〉CD36〈/em〉, 〈em〉Fabp2〈/em〉 and 〈em〉FAS〈/em〉. In addition, these two strains manipulated gut microbiota by decreasing the abundance of 〈em〉Bacteroides〈/em〉 and 〈em〉Desulfovibrio〈/em〉 and increasing that of 〈em〉Lactobacillus〈/em〉 and 〈em〉Bifidobacterium〈/em〉, which in turn raised the levels of feces SCFAs and lowered the levels of circulating LPS.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉These results indicated that 〈em〉L. rhamnosus〈/em〉 LS-8 and 〈em〉L. crustorum〈/em〉 MN047 supplementation possessed the anti-obesity effect on the HFFD fed mice by alleviating inflammatory response and regulating gut microbiota, which further suggested that these two probiotics can be considered as an alternative dietary supplement in combination with the preventive and therapeutic strategies against obesity and related complications.〈/p〉 〈/span〉 〈span〉 〈h3〉Graphic abstract〈/h3〉 〈p〉 〈span〉 〈span〉 〈img alt="" src="https://static-content.springer.com/image/MediaObjects/394_2019_2117_Figa_HTML.png"〉 〈/span〉 〈/span〉 〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Application of intelligent formulation design has the ability to address the poor bioavailability and improve the fasted state bioavailability of fish oils. In this study we assessed the ability of a self-emulsifying drug delivery system (SEDDS), AquaCelle〈sup〉®〈/sup〉, as an additive to enhance the oral absorption of Omega-3 ethyl esters (EE) in healthy subjects under low-fat diet conditions.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) EE were formulated with AquaCelle〈sup〉®〈/sup〉. A single dose (680 mg dose of oil containing 272 mg of EPA EE and 204 mg of DHA EE), randomized, double-blind, study measured uptake of EPA and DHA over 24 h in healthy adults. Participants were randomized into two groups, receiving either the SEDDS AquaCelle〈sup〉®〈/sup〉 fish oil formulation or the unformulated fish oil EE as control.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The AquaCelle〈sup〉®〈/sup〉 fish oil EE formulation demonstrated instant and complete emulsification on addition to water to produce an emulsion with an average diameter of 43 μm, compared to the oil alone which did not emulsify. The study revealed a significant difference in absorption (〈em〉C〈/em〉〈sub〉max〈/sub〉 and AUC〈sub〉0–24h〈/sub〉) between the AquaCelle〈sup〉®〈/sup〉 group and the control group. The AquaCelle〈sup〉®〈/sup〉 group was capable of increasing maximum plasma concentrations and absorption (AUC〈sub〉0–24h〈/sub〉) of total Omega-3 (EPA + DHA) 3.7- and 7.1-fold, respectively, compared to the control.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Formulating Omega-3 EE with a SEDSS concentrate (AquaCelle〈sup〉®〈/sup〉) demonstrated a significant improvement in the oral absorption of Omega-3 fatty acids without requiring a high-fat meal.〈/p〉 〈/span〉 〈span〉 〈h3〉Graphic abstract〈/h3〉 〈p〉 〈span〉 〈span〉 〈img alt="" src="https://static-content.springer.com/image/MediaObjects/394_2019_2118_Figa_HTML.png"〉 〈/span〉 〈/span〉 〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉We determined the association of total sugar intake with body weight and fat mass in children on an energy-equivalent basis and potential changes in the association from 2 to 8 years of age.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Data were available from the Childhood Obesity Project Trial initiated in 2002. Sugar intake was measured by 3-day weighed food protocols at 2, 3, 4, 5, 6, and 8 years of age. Body mass index (BMI) and fat mass index (FMI) were available at the same time points. To investigate the association of sugar intake with anthropometrics over time, linear mixed models were applied. Odds ratios for having a high BMI or FMI (above one standard deviation) were estimated by logistic random-effects models. To control for total energy intake, the residual method was chosen and models were additionally adjusted for total energy intake.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Data were available for 809 children with in total 2846 observations. In an isocaloric model, an increase of 100 kcal from sugar per day was significantly associated with lower zBMI (− 0.033; 95% CI −0.061, − 0.005) and zFMI (− 0.050; 95% CI − 0.089, − 0.011). In addition, a 100 kcal higher sugar intake was related to lower odds of having a high zBMI (OR 0.743; 95% CI 0.611, 0.903).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉This study provides no indication that increased total sugar intake positively affects BMI on an energy-equivalent basis. Whether the negative association of sugar is due to physiological effects or points more to macronutrient preferences or a reporting bias (lower sugar intake) in children with higher BMI can be debated.〈/p〉 〈/span〉 〈span〉 〈h3〉Clinical trial registry〈/h3〉 〈p〉ClinicalTrials.gov Identifier: NCT00338689; Registered: June 19, 2006. URL: 〈a href="http://clinicaltrials.gov/ct2/show/NCT00338689?term=NCT00338689&rank=1"〉http://clinicaltrials.gov/ct2/show/NCT00338689?term=NCT00338689&rank=1〈/a〉.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The rate of neural tube defects (NTDs) in Europe has remained similar since the 1990s despite folic acid supplement recommendations (400 µg/day) for women of childbearing age. Mandatory folic acid fortification of staple foods has proved effective for reducing the prevalence of NTDs in over 80 countries. This study estimated the impact of addition of folic acid to bread or flour in the Republic of Ireland on reducing the risk of occurrence of NTD-affected pregnancies and the possible risk of masking (undiagnosed) vitamin B〈sub〉12〈/sub〉 deficiency in older adults.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Analyses were based on the Irish National Adult Nutrition Survey (2008–2010). Folic acid fortification was modelled using DaDiet© software. Estimates were made of the increase in average daily folic acid intake in women (18–50 years) and the risk of exceeding the tolerable upper intake level (UL) of 1000 µg for folic acid in adults over 50 years of age.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The fortification scenarios examined would reduce the risk of NTD-affected pregnancies by 8–32%, corresponding to an increase of 39–152 μg in the mean daily folic acid intake of WCBA. The risk of masking anaemia associated with vitamin B〈sub〉12〈/sub〉 deficiency in older adults would be negligible as the probability of exceeding the UL for folic acid, even by a small amount, is very low (≤ 0.2%).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉These levels of addition of folic acid to bread or flour would effectively reduce the risk of NTDs while allowing safe consumption of folic acid at current levels from other fortified foods and supplements.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The aim of this study was to investigate the effects of creatine supplementation on muscle wasting in Walker-256 tumor-bearing rats.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Wistar rats were randomly assigned into three groups (〈em〉n〈/em〉 = 10/group): control (C), tumor bearing (T), and tumor bearing supplemented with creatine (TCr). Creatine was provided in drinking water for a total of 21 days. After 11 days of supplementation, tumor cells were implanted subcutaneously into T and TCr groups. The animals’ weight, food and water intake were evaluated along the experimental protocol. After 10 days of tumor implantation (21 total), animals were euthanized for inflammatory state and skeletal muscle cross-sectional area measurements. Skeletal muscle components of ubiquitin–proteasome pathways were also evaluated using real-time PCR and immunoblotting.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The results showed that creatine supplementation protected tumor-bearing rats against body weight loss and skeletal muscle atrophy. Creatine intake promoted lower levels of plasma TNF-α and IL-6 and smaller spleen morphology changes such as reduced size of white pulp and lymphoid follicle compared to tumor-bearing rats. In addition, creatine prevented increased levels of skeletal muscle Atrogin-1 and MuRF-1, key regulators of muscle atrophy.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Creatine supplementation prevents skeletal muscle atrophy by attenuating tumor-induced pro-inflammatory environment, a condition that minimizes Atrogin-1 and MuRF-1-dependent proteolysis.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉To explore the associations between type of milk feeding (the “nutrients”) and mode of breast milk feeding (the “nursing”) with child cognition.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Healthy children from the GUSTO (Growing Up in Singapore Toward healthy Outcomes) cohort participated in repeated neurodevelopmental assessments between 6 and 54 months. For “nutrients”, we compared children exclusively bottle-fed according to type of milk received: formula only (〈em〉n〈/em〉 = 296) vs some/all breast milk (〈em〉n〈/em〉 = 73). For “nursing”, we included only children who were fully fed breast milk, comparing those fed directly at the breast (〈em〉n〈/em〉 = 59) vs those fed partially/completely by bottle (〈em〉n〈/em〉 = 63).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Compared to infants fed formula only, those who were bottle-fed breast milk demonstrated significantly better cognitive performance on both the Bayley Scales of Infant and Toddler Development (Third Edition) at 2 years [adjusted mean difference (95% CI) 1.36 (0.32, 2.40)], and on the Kaufman Brief Intelligence Test (Second Edition) at 4.5 years [7.59 (1.20, 13.99)]. Children bottle-fed breast milk also demonstrated better gross motor skills at 2 years than those fed formula [1.60 (0.09, 3.10)]. Among infants fully fed breast milk, those fed directly at the breast scored higher on several memory tasks compared to children bottle-fed breast milk, including the deferred imitation task at 6 months [0.67 (0.02, 1.32)] and relational binding tasks at 6 [0.41 (0.07, 0.74)], 41 [0.67 (0.04, 1.29)] and 54 [0.12 (0.01, 0.22)] months.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our findings suggest that nutrients in breast milk may improve general child cognition, while nursing infants directly at the breast may influence memory.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉No study has summarized earlier findings on the effect of probiotic supplementation on inflammatory biomarkers. This systematic review and meta-analysis was conducted to systematically review the available placebo-controlled clinical trials about the effect of probiotic supplementation on several inflammatory biomarkers in adults.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Relevant papers published up to March 2018 were searched up through PubMed, MEDLINE, SCOPUS, EMBASE, and Google Scholar, using following suitable keywords. Clinical trials that examined the effect of probiotic supplementation on inflammation in adults were included.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Overall, 42 randomized clinical trials (1138 participants in intervention and 1120 participants in control groups) were included. Combining findings from included studies, we found a significant reduction in serum hs-CRP [standardized mean difference (SMD) − 0.46; 95% CI − 0.73, − 0.19], TNF-a (− 0.21; − 0.34, − 0.08), IL-6 (− 0.37; − 0.51, − 0.24), IL-12 (− 0.47; − 0.67, − 0.27), and IL-4 concentrations (− 0.48; − 0.76, − 0.20) after probiotic supplementation. Pooling effect sizes from 11 studies with 12 effect sizes, a significant increase in IL-10 concentrations was seen (0.21; 0.04, 0.38). We failed to find a significant effect of probiotic supplementation on serum IL-1B (− 0.17; − 0.37, 0.02), IL-8 (− 0.01; − 0.30, 0.28), and IFN-g (− 0.08; − 0.31, 0.15) and IL-17 concentrations (0.06; − 0.34, 0.46).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Probiotic supplementation significantly reduced serum concentrations of pro-inflammatory cytokines including, hs-CRP, TNF-a, IL-6, IL-12, and IL-4, but it did not influence IL-1B, IL-8, IFN-g, and IL-17 concentrations. A significant increase in serum concentrations of IL-10, as a anti-inflammatory cytokine was also documented after probiotic supplementation.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Evidence for the association between chocolate intake and risk of chronic diseases is inconclusive. Therefore, we aimed to synthesize and evaluate the credibility of evidence on the dose-response association between chocolate consumption with risk of all-cause mortality, coronary heart disease (CHD), stroke, heart failure (HF), type 2 diabetes (T2D), colorectal cancer (CRC), and hypertension.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Prospective studies were searched until July 2018 in PubMed, Embase, and Web of Science. Random-effects meta-analyses comparing highest versus lowest intake categories, linear, and non-linear dose-response analyses were conducted. The credibility of evidence was evaluated with the NutriGrade scoring-system.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Overall, 27 investigations were identified (〈em〉n〈/em〉 = 2 for all-cause mortality, 〈em〉n〈/em〉 = 9 for CHD, 〈em〉n〈/em〉 = 8 for stroke, 〈em〉n〈/em〉 = 6 for HF, 〈em〉n〈/em〉 = 6 for T2D, 〈em〉n〈/em〉 = 2 for hypertension and CRC, respectively). No associations with HF (RR 0.99, 95% CI 0.94, 1.04) and T2D (RR 0.94, 95% CI 0.88, 1.01) per each 10 g/day increase in chocolate intake were observed in the linear dose-response meta-analyses. However, a small inverse association for each 10 g/daily increase could be shown for the risk of CHD (RR 0.96, 95% CI 0.93, 0.99), and stroke (RR 0.90, 95% CI 0.82, 0.98). The credibility of evidence was rated either very low (all-cause mortality, HF, T2D, CRC or hypertension) or low (CHD, stroke).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Chocolate consumption is not related to risk for several chronic diseases, but could have a small inverse association with CHD and stroke. Our findings are limited by very low or low credibility of evidence, highlighting important uncertainty for chocolate–disease associations.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Dietary biomarkers allow the accurate and objective determination of the dietary intake of humans and can thus be valuable for investigating the relation between consumption of foods and biochemical as well as physiological responses. The objective of this study was the identification of potential urinary biomarkers for consumption of tomato juice.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In the course of a dietary intervention study, the human urine metabolome of a study cohort was compared between a tomato-free diet and after intake of tomato juice by application of an LC-HRMS-based metabolomics approach. The data acquisition was achieved using an orbitrap mass spectrometer, followed by multistage data processing and univariate as well as multivariate statistical analysis to identify discriminating features.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Statistical analysis revealed several unique features detectable after tomato juice intake. The most discriminating markers were putatively identified as hydroxylated and sulfonated metabolites of esculeogenin B, aglycone of the steroidal glycoalkaloid esculeoside B recently found in tomato juice. Furthermore, the β-carboline alkaloids tangutorid E and F and glucuronidated derivatives thereof were identified in urine.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Steroidal glycoalkaloids in tomato juice are cleaved after ingestion, and hydroxylated and sulfonated metabolites of their aglycones might serve as urinary biomarkers for tomato juice intake. Similarly, β-carboline alkaloids and glucuronidated derivatives were identified as potential urinary biomarkers. Both the aglycones of the steroidal alkaloids and the β-carboline alkaloids might exhibit biological activities worth investigating.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Curcumin has shown to exert a positive impact on human glucose metabolism, even if its bioavailability is usually very low. The present study aimed to explore the effect of phosphatidylserine- and piperine-containing curcumin phytosomes on a large number of metabolic parameters related to insulin resistance, in the context of a randomized double-blind placebo-controlled trial involving 80 overweight subjects with suboptimal fasting plasma glucose.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Subjects were randomized to be treated with indistinguishable tablets (2 per day, to be taken after dinner) containing 800 mg phytosomal curcumin (Curserin®: 200 mg curcumin, 120 mg phosphatidylserine, 480 mg phosphatidylcholine and 8 mg piperine from 〈em〉Piper nigrum〈/em〉 L. dry extract) for 8 weeks.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉After 56-day treatment, the curcumin-treated group experienced a significant improvement in fasting plasma insulin (FPI), HOMA index, waist circumference, blood pressure, triglycerides (TG), HDL-C, liver transaminases, gamma-GT, index of liver steatosis and serum cortisol compared to the baseline. FPI, TG, liver transaminases, fatty liver index and serum cortisol level also significantly improved compared with the placebo-treated group. Compared to the baseline, at the end of the study placebo group experienced an improvement only in FPG and TG.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉In conclusion, the present trial shows that supplementation with a phytosomal preparation of curcumin containing phosphatidylserine and piperine could improve glycemic factors, hepatic function and serum cortisol levels in subjects with overweight and impaired fasting glucose.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Recent evidence has demonstrated that the gut microbiota plays a critical role in the treatment of obesity and other metabolic dysfunctions. Ginger (〈em〉Zingiber officinale〈/em〉 Roscoe), one of the most commonly used spices and dietary supplements, has been shown to exert beneficial effects against obesity and related disorders. However, to date, the mechanisms linking these effects to the gut microbiota remain unclear. This study aims to investigate the relationship between the gut microbiota and the metabolic adaptations resulting from ginger supplementation in mice.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Four groups of mice were fed a normal chow diet (NCD) or a high-fat diet (HFD) with or without ginger supplementation for 16 weeks. Lipid profiles, proinflammatory cytokines, glucose tolerance, microbiota composition and short-chain fatty acid (SCFA) concentrations were analyzed at the end of the experiment. In addition, microbiota-depleted mice were transplanted with the fecal microbiota of mice fed a HFD or mice fed a HFD along with ginger supplementation. Glucose tolerance and microbiota composition were assessed after a 8-week fecal microbiota transplantation (FMT).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉We observed marked decreases in body weight, liver steatosis, and low-grade inflammation as well as amelioration of insulin resistance in the HFD-fed mice treated with ginger. Furthermore, ginger supplementation modulated the gut microbiota composition and increased species belonging to the 〈em〉Bifidobacterium〈/em〉 genus and SCFA-producing bacteria (〈em〉Alloprevotella〈/em〉 and 〈em〉Allobaculum〈/em〉), along with increases in fecal SCFA concentrations. The FMT experiment showed anti-obesity and microbiota-modulating effects similar to those observed in the oral ginger-feeding experiment.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉This study suggests that modulation of the gut microbiota as a result of ginger supplementation has a therapeutic effect on obesity in mice.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Low vitamin D status is prevalent worldwide. We aim to investigate the effect of vitamin D fortification on serum 25-hydroxyvitamin D (25(OH)D) concentration in women of Danish and Pakistani origin at risk of vitamin D deficiency.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉A 12-week randomized, double-blinded, placebo-controlled intervention trial during winter time, designed to provide 20 µg vitamin D〈sub〉3〈/sub〉/day through fortified yoghurt, cheese, eggs and crisp bread, and assess the change in serum 25(OH)D. Participants were 143 women of Danish and Pakistani origin, living in Denmark, randomized into four groups, stratified by ethnicity.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Mean (SD) baseline 25(OH)D concentrations among women of Danish and Pakistani origin were 49.6 (18) and 46.9 (22) nmol/L, respectively (〈em〉P〈/em〉 = 0.4). While 9% of Danish women had 25(OH)D 〈 30 nmol/L, the prevalence among women of Pakistani origin was 24%. Median (IQR) vitamin D intake among Danish and Pakistani women at endpoint was 32.0 (27.0, 34.4) µg/day and 24.2 (19.2, 30.8) µg/day, respectively. Endpoint serum 25(OH)D increased in fortified groups to 77.8 (14) nmol/L among Danish women and 54.7 (18) nmol/L among women of Pakistani origin (〈em〉P〈/em〉 〈 0.01). At endpoint, 0% in the Danish-fortified group and 3% in the Pakistani-fortified group had 25(OH)D 〈 30 nmol/L, compared with 23 % and 34% in their respective control groups.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Vitamin D fortification of four different foods for 12 weeks during winter was effective in increasing serum 25(OH)D and reducing the prevalence of very low vitamin D status among women of Danish and Pakistani origin.〈/p〉 〈/span〉 〈span〉 〈h3〉ClinicalTrials.gov with identifier〈/h3〉 〈p〉NCT02631629.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉This study examined the association of free sugar (FS) intake with obesity measures and blood pressure (BP) among a nationally representative sample of Australian adults.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Data from adults (weighted 〈em〉n〈/em〉 = 5136) who completed 2 × 24-h recalls and had complete data for BP, waist circumference (WC), waist-to-height ratio (WHtR), and body mass index (BMI) were analyzed. Associations between percentage energy of FS from all food sources (%EFS〈sub〉total〈/sub〉), beverages only (%EFS〈sub〉beverages〈/sub〉), and non-beverages sources only (%EFS〈sub〉non-beverages〈/sub〉) and obesity measures and BP were examined using linear and non-linear regressions. Logistic regression was used to calculate the odds ratios (OR) of being classified as overweight and/or obese, having increased cardiometabolic risks, and elevated BP per 5% point increase in %EFS〈sub〉total〈/sub〉, %EFS〈sub〉beverages〈/sub〉, and %EFS〈sub〉non-beverages〈/sub〉. All regression analyses were adjusted for known socio-economic and lifestyle confounders.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉%EFS〈sub〉beverage〈/sub〉 was positively associated with BMI, WC, and WHtR (all 〈em〉p〈/em〉 〈 0.05), while %EFS〈sub〉non-beverage〈/sub〉 was inversely associated with these outcomes. Increases in odds of having an undesirable WC/WHtR were found with increasing %EFS〈sub〉beverages〈/sub〉 (OR per 5% point increase in %EFS〈sub〉beverages〈/sub〉: 1.19 for WC; 1.23 for WHtR, both 〈em〉p〈/em〉 〈 0.001). %EFS〈sub〉total〈/sub〉 and %EFS〈sub〉non-beverages〈/sub〉 were weakly and negatively associated with diastolic BP. A 5% point increase in %EFS〈sub〉total〈/sub〉 and %EFS〈sub〉non-beverage〈/sub〉 was associated with a 10–25% reduction in odds of having elevated BP.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our results suggested that only a higher FS intake from beverages may be associated with obesity, and higher FS intake was associated with reduced odds of having elevated BP.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Excessive exposure of glucocorticoids activates adipose lipolysis, increases circulating free fatty acids, and contributes to ectopic lipid deposition in liver and skeletal muscle. Our previous study demonstrated that maternal betaine supplementation attenuates glucocorticoid-induced hepatic lipid accumulation in rat offspring. However, it is unclear whether maternal betaine supplementation is effective in preventing glucocorticoid-induced lipolysis in the adipose tissue of offspring.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In this study, 20 pregnant rats were fed with basal or betaine-supplemented (10 g/kg) diets throughout gestation and lactation, and the offspring rats were raised on the basal diet from weaning till 3 months of age followed by daily intraperitoneal injection of saline or 0.1 mg/kg dexamethasone (DEX) for 3 weeks.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Chronic DEX treatment significantly (〈em〉P〈/em〉 〈 0.05) decreased serum corticosterone level and increased proinflammatory cytokines, such as TNFα, IL-1β, and IL-6. Meanwhile, GR protein content in adipose tissue was increased in response to DEX treatment, which was associated with a significant (〈em〉P〈/em〉 〈 0.05) up-regulation of ATGL and HSL expression at both mRNA and protein levels. All these DEX-induced changes were significantly (〈em〉P〈/em〉 〈 0.05) attenuated in progeny rats derived from betaine-supplemented dams. Furthermore, DEX-induced hypomethylation of ATGL and HSL gene promoters was reversed by maternal betaine supplementation.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Taken together, these results suggest that maternal betaine supplementation is effective in alleviating glucocorticoid-induced lipolysis in adipose tissue with modification of DNA methylation on the promoter of lipolytic genes.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The interactions between lifestyle and genetic factors play an important role in obesity development. Mutations in melanocortin-4-receptor (MC4R) gene are one of the most common cause of monogenic obesity, however, the functional effects of polymorphic variants near MC4R gene in general populations remain uncertain. The aim of our study was to analyze whether the common single nucleotide polymorphisms (SNPs) of MC4R gene influence the food preferences, physical activity, body fat content and distribution, as well as fasting and postprandial energy expenditure and substrates utilization.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We genotyped previously identified MC4R SNPs: rs17782313, rs633265, rs1350341, rs12970134 in 927 subjects, who underwent anthropometric, total body fat content, visceral (VAT) and subcutaneous adipose tissue (SAT) measurements, and daily physical activity and dietary intake analysis. In randomly selected 47 subjects the energy expenditure, carbohydrate and lipid utilizations were evaluated in fasting state and after high-carbohydrate and control meals intake.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉We found the significant associations between studied SNPs of MC4R gene and VAT and VAT/SAT ratio. Moreover, the GG genotype carriers of rs1350341, who had the lowest VAT accumulation (〈em〉p〈/em〉 = 0.012), presented higher relative increase in postprandial carbohydrate utilization (〈em〉p〈/em〉 = 0.013, 〈em〉p〈/em〉 = 0.024).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉We have observed that common SNPs of the MC4R gene influence the body fat content and distribution, as well as relative increase in postprandial carbohydrate utilization. We believe that our study may help to understand better the impact of MC4R gene on obesity development, and to help to provide personalized prevention/treatment strategies to fight against obesity and its metabolic consequences.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Adherence to the Mediterranean diet has been associated with fewer depressive symptoms, however, it is unknown whether this is attributed to some or to all components. We examined the association between the individual food groups of the Mediterranean Diet Score (MDS), in isolation and in combination, with depression and anxiety (symptom severity and diagnosis).〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Data from 1634 adults were available from the Netherlands Study of Depression and Anxiety. Eleven energy-adjusted food groups were created from a 238-item food frequency questionnaire. In regression analysis, these were associated in isolation and combination with (1) depressive and anxiety disorders (established with the Composite International Diagnostic Interview) (current disorder 〈em〉n〈/em〉 = 414), and (2) depression and anxiety severity [measured with the Inventory of Depressive Symptomatology (IDS), the Beck Anxiety Inventory (BAI) and the Fear Questionnaire (FEAR)].〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Overall, the MDS score shows the strongest relationships with depression/anxiety [Diagnosis: odds ratio (OR) 0.77 per SD, 95% confidence interval (95% CI) 0.66–0.90, IDS: standardised betas (〈em〉β〈/em〉) − 0.13, 95% CI − 0.18, − 0.08] and anxiety (BAI: 〈em〉β〈/em〉 − 0.11, 95% CI − 0.16, − 0.06, FEAR: 〈em〉β〈/em〉 − 0.08, 95% CI − 0.13, − 0.03). Greater consumption of non-refined grains and vegetables was associated with lower depression and anxiety severity, whilst being a non-drinker was associated with higher symptom severity. Higher fruit and vegetable intake was associated with lower fear severity. Non-refined grain consumption was associated with lower odds and being a non-drinker with greater odds of current depression/anxiety disorders compared to healthy controls, these associations persisted after adjustment for other food groups (OR 0.82 per SD, 95% CI 0.71–0.96, OR 1.26 per SD 95% CI 1.08–1.46).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉We can conclude that non-refined grains, vegetables and alcohol intake appeared to be the driving variables for the associated the total MDS score and depression/anxiety. However, the combined effect of the whole diet remains important for mental health. It should be explored whether an increase consumption of non-refined grains and vegetables may help to prevent or reduce depression and anxiety.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉This study aimed to examine the psychological factors (knowledge, barriers and facilitators) that can contribute to hydration-related behaviors (i.e., fluid intake) in the general population and how these relate to physical health.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉A structured survey was developed to examine the links between hydration knowledge (29 items), attitudes about hydration (80 items), and fluid intake behavior (8 items) among US adults. Survey data from Phase 1 (〈em〉n 〈/em〉=301, US adults) psychometrically evaluated the items via item analysis (knowledge and fluid behavior) and factor analysis (attitudes). Phase 2 survey data (〈em〉n 〈/em〉=389, US adults and college students) refined and validated the new 16-item hydration knowledge measure, 4-item fluid intake behavior index, and 18-item attitude measure (barriers and facilitators of hydration-related behaviors) alongside indices of physical health (BMI and exercise behaviors).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Participants had a moderate level of hydration knowledge (Phase 1: 10.91 ± 3.10; Phase 2: 10.87 ± 2.47). A five-factor measure of attitudes which assessed both facilitators (social pressure and attention to monitoring) and barriers (lack of effort, physical barriers and lack of a fluid container) to hydration demonstrated strong internal consistency (〈em〉α〈/em〉s from 0.75 to 0.90). Attitudes about hydration—most notably barriers to hydration—were associated with indicators of health and with fluid intake behaviors, whereas hydration knowledge was not.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Increasing hydration knowledge may be necessary for people who hold inaccurate information about hydration, but attitudes about hydration are likely to have a larger impact on fluid intake behaviors and health-related outcomes.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Accurate data on water and beverage intakes are essential for assessing hydration adequacy and setting proper guidelines. The objective of this study is to identify the patterns and sociodemographic determinants of water intake and to assess the intake adequacy for children in China.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉The study team recruited 41,439 children aged 6–17 years using a multi-stage cluster random sampling method. Daily water and beverage intakes were investigated with the standard questionnaires and measuring containers in face-to-face interviews. Each participant was assigned an adjustment weight to obtain a nationally representative sample. Sociodemographic factors influencing water intake were identified using multi-variable regressions. Water intake adequacy was evaluated by comparing with the recommended water intake (RWI).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The mean ± standard deviation of total water intake (TWI) was 1603 ± 731 mL/day for boys and 1487 ± 661 mL/day for girls. Plain water, food moisture, and other beverages contributed 51%, 20%, and 29% of the TWI. Multi-variable analyses showed that TWI of children increased with age, in urban areas and day schools, and with parents’ economic and educational levels. The majority (82%) of children had TWI not meeting the corresponding RWI, and the percentage increased with age except for 14–17-year-old boys.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Plain water is still the major source of daily water intake by children in China. Unfortunately, the majority of children do not have sufficient water intake, which warrants future actions and guidelines targeting adequate hydration.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Objective〈/h3〉 〈p〉Choline and docosahexaenoic acid (DHA) are essential nutrients for preterm infant development. They are metabolically linked via phosphatidylcholine (PC), a constitutive plasma membrane lipid and the major transport form of DHA in plasma. Plasma choline and DHA-PC concentrations rapidly decline after preterm birth. To improve preterm infant nutrition, we evaluated combined compared to exclusive choline and DHA supplementation, and standard feeding.〈/p〉 〈/span〉 〈span〉 〈h3〉Design〈/h3〉 〈p〉Randomized partially blinded single-center trial.〈/p〉 〈/span〉 〈span〉 〈h3〉Setting〈/h3〉 〈p〉Neonatal tertiary referral center in Tübingen, Germany.〈/p〉 〈/span〉 〈span〉 〈h3〉Patients〈/h3〉 〈p〉24 inborn preterm infants 〈 32 week postmenstrual age.〈/p〉 〈/span〉 〈span〉 〈h3〉Interventions〈/h3〉 〈p〉Standard nutrition (control) or, additionally, enteral choline (30 mg/kg/day), DHA (60 mg/kg/day), or both for 10 days. Single enteral administration of 3.6 mg/kg [methyl-D〈sub〉9〈/sub〉-] choline chloride as a tracer at 7.5 days.〈/p〉 〈/span〉 〈span〉 〈h3〉Main outcome measures〈/h3〉 〈p〉Primary outcome variable was plasma choline following 7 days of supplementation. Deuterated and unlabeled choline metabolites, DHA-PC, and other PC species were secondary outcome variables.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Choline supplementation increased plasma choline to near-fetal concentrations [35.4 (32.8–41.7) µmol/L vs. 17.8 (16.1–22.4) µmol/L, 〈em〉p〈/em〉 〈 0.01] and decreased D〈sub〉9〈/sub〉-choline enrichment of PC. Single DHA treatment decreased DHA in PC relative to total lipid [66 (60–68)% vs. 78 (74–80)%; 〈em〉p〈/em〉 〈 0.01], which was prevented by choline. DHA alone increased DHA-PC only by 35 (26–45)%, but combined treatment by 63 (49–74)% (〈em〉p〈/em〉 〈 0.001). D〈sub〉9〈/sub〉-choline enrichment showed preferential synthesis of PC containing linoleic acid. PC synthesis via phosphatidylethanolamine methylation resulted in preferential synthesis of DHA-containing D〈sub〉3〈/sub〉-PC, which was increased by choline supplementation.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉30 mg/kg/day additional choline supplementation increases plasma choline to near-fetal concentrations, dilutes the D〈sub〉9〈/sub〉-choline tracer via increased precursor concentrations and improves DHA homeostasis in preterm infants.〈/p〉 〈/span〉 〈span〉 〈h3〉Trial registration〈/h3〉 〈p〉clinicaltrials.gov. Identifier: NCT02509728.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉We prospectively examined associations of lung cancer risk with food intake of B vitamins involved in one-carbon metabolism and the use of folic acid-containing supplements among a low-income population of black and white adults in the Southeastern US.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Within the Southern Community Cohort Study, we included 1064 incident lung cancer cases among 68,236 participants aged 40–79 years at study enrollment. Food intake and the use of folic acid-containing supplements were assessed using a validated food frequency questionnaire at study enrollment. Multivariate Cox regression was used to estimate hazards ratios (HRs) and the 95% confidence intervals (CIs).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Folate and/or folic acid intake from food were not associated with lung cancer risk; HRs (95% CI) for highest compared with lowest quartile were 1.08 (0.91–1.29) for total dietary folate, 1.00 (0.84–1.19) for food folate, and 1.09 (0.91–1.30) for food folic acid, respectively. Similarly, no associations were observed after stratifying by sex, race and smoking status, except for a positive association with total dietary folate intake among black women (HR 1.46, 95% CI 1.04–2.05 for the highest quartile compared with the lowest quartile, 〈em〉P〈/em〉 trend = 0.02). Neither the use of folic acid-containing supplements nor food intake of vitamin B〈sub〉6〈/sub〉, vitamin B〈sub〉12〈/sub〉 and riboflavin were associated with lung cancer risk.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our findings do not support a protective effect of folate or folic acid for lung cancer prevention in a low-income population of black and white adults in the Southeastern US. Our finding of a positive association with total dietary folate intake among black women needs to be interpreted with caution and replicated in other studies.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Despite longstanding voluntary salt iodisation in Switzerland, data suggest inadequate iodine intake in vulnerable population groups. In response, the salt iodine concentration was increased from 20 to 25 mg/kg and we assessed the impact on iodine status.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We conducted a cross-sectional national study in school-age children (〈em〉n〈/em〉 = 731), women of reproductive age (〈em〉n〈/em〉 = 353) and pregnant women (〈em〉n〈/em〉 = 363). We measured urinary iodine concentration (UIC) and urinary sodium concentration (UNaC) in spot urine samples. The current median UIC was compared with national data from 1999, 2004 and 2009. We measured TSH, total T4 and thyroglobulin (Tg) on dried blood spot samples collected in women.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The median UIC (bootstrapped 95% CI) was 137 µg/L (131, 143 µg/L) in school children, 88 µg/L (72, 103 µg/L) in women of reproductive age and 140 µg/L (124, 159 µg/L) in pregnant women. Compared to 2009, the median UIC increased modestly in school children (〈em〉P〈/em〉 〈 0.001), but did not significantly change in pregnant women (〈em〉P〈/em〉 = 0.417). Estimated sodium intake exceeded the recommendations in all population groups. The prevalence of thyroid disorders in women was low, but Tg was elevated in 13% of the pregnant women.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Iodine intake is overall adequate in Swiss school-age children, but only borderline sufficient in pregnant and non-pregnant women, despite high salt intakes and satisfactory household coverage with iodized salt. Our findings suggest increasing the concentration of iodine in salt may not improve iodine intakes in women if iodised salt is not widely used in processed foods.〈/p〉 〈/span〉 〈span〉 〈h3〉Registration〈/h3〉 〈p〉This trial was registered at clinicaltrials.gov as NCT02312466.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉This work aimed to design and validate a novel short food frequency questionnaire (SFFQ) to assess habitual intakes of food items related to non-alcoholic fatty liver disease (NAFLD) in a cohort of European patients.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉A 48-item SFFQ was created, with questions from existing FFQs and expert knowledge, emphasizing foods and nutrients implicated in NAFLD pathogenesis. Consenting, fibroscan-diagnosed, NAFLD patients completed the SFFQ during a short interview and were asked to complete a 4-day diet diary (4DDD) at home for return by mail. Nutritional intakes were assessed utilizing the myfood24™ food composition dataset and estimated energy requirements (EER) were calculated using sex-, age- and weight-specific equations. Agreement between the dietary instruments was assessed by Spearman correlations and Bland Altman analysis.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Fifty-five patients completed both the SFFQ and the 4DDD within 30 weeks; 42 (76%) were diagnosed with simple steatosis, whereas 13 (24%) had biopsy-proven steatohepatitis; the majority were overweight or obese, with a median (25th; 75th percentile) BMI of 33.2 kg/m〈sup〉2〈/sup〉 (29.3; 36.0). Reported energy intakes were well below EER with a median intake of 73% of requirements, suggesting widespread under-reporting. Significant correlations were observed between sugar (〈em〉r〈/em〉 = 0.408, 〈em〉P〈/em〉 = 0.002), fat (〈em〉r〈/em〉 = 0.44, 〈em〉P〈/em〉 = 0.001), fruits (〈em〉r〈/em〉 = 0.51, 〈em〉P〈/em〉 = 0.0001) and vegetables (〈em〉r〈/em〉 = 0.40, 〈em〉P〈/em〉 = 0.0024) measurements by the SFFQ and 4DDD. Bland Altman plots with regression analysis demonstrated broad comparability with the 4DDD for intakes of fat (bias − 13.8 g/day) and sugar (bias  + 12.9 g/day).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉A novel SFFQ designed to be minimally burdensome to participants was effective at assessing dietary intakes in NAFLD patients.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Cognitive decline is commonly reported during the menopausal transition, with memory and attention being particularly affected. The aim of this study was to investigate the effects of a commercially available soy drink on cognitive function and menopausal symptoms in post-menopausal women.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉101 post-menopausal women, aged 44–63 years, were randomly assigned to consume a volume of soy drink providing a low (10 mg/day; control group), medium (35 mg/day), or high (60 mg/day) dose of isoflavones for 12 weeks. Cognitive function (spatial working memory, spatial span, pattern recognition memory, 5-choice reaction time, and match to sample visual search) was assessed using CANTAB pre- and post-the 12 week intervention. Menopausal symptoms were assessed using Greene’s Climacteric Scale.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉No significant differences were observed between the groups for any of the cognitive function outcomes measured. Soy drink consumption had no effect on menopausal symptoms overall; however, when women were stratified according to the severity of vasomotor symptoms (VMS) at baseline, women with more severe symptoms at baseline in the medium group had a significant reduction (〈em〉P〈/em〉 = 0.001) in VMS post-intervention (mean change from baseline score: − 2.15 ± 1.73) in comparison to those with less severe VMS (mean change from baseline score: 0.06 ± 1.21).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Soy drink consumption had no effect on cognitive function in post-menopausal women. Consumption of ~ 350 ml/day (35 mg IFs) for 12 weeks significantly reduced VMS in those with more severe symptoms at baseline. This finding is clinically relevant as soy drinks may provide an alternative, natural, treatment for alleviating VMS, highly prevalent among western women.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Homocysteine (Hcy) in humans represents a blood-borne biomarker which predicts the risk of age-related diseases and mortality. Using the nematode 〈em〉Caenorhabditis elegans〈/em〉, we tested whether feeding betaine-rich sugar beet molasses affects the survival under heat stress in the presence of Hcy, in spite of a gene loss in betaine–homocysteine methyltransferase.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Knockdown of the genes relevant for remethylation or transsulfuration of Hcy was achieved by RNA interference (RNAi). Survival assay was conducted under heat stress at 37 °C and Hcy levels were determined by enzyme-linked immunosorbent assay.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Addition of 500 mg/l betaine-rich sugar beet molasses (SBM) prevented the survival reduction that was caused by exposure to Hcy at 37 °C. Although SBM was no longer capable of reducing Hcy levels under RNAi versus homologues for 5, 10-methylenetetrahydrofolate reductase or cystathionine-β-synthase, it still enabled the survival extension by SBM under exposure to Hcy. In contrast, RNAi for the small heat shock protein 〈em〉hsp-16.2〈/em〉 or the foxo transcription factor 〈em〉daf-16〈/em〉 both prevented the extension of survival by betaine-rich molasses in the presence of Hcy.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our studies demonstrate that betaine-rich SBM is able to prevent survival reduction caused by Hcy in 〈em〉C. elegans〈/em〉 in dependence on 〈em〉hsp-16.2〈/em〉 and 〈em〉daf-16〈/em〉 but independent of the remethylation pathway.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Type 2 diabetes mellitus (T2DM) was associated with gut microbial impairment (dysbiosis) and neurological and behavioral disorders. The role of the gut–brain axis in the management of many diseases including T2DM has been the focus of much research activity in the recent years. However, a wide knowledge gap exists about the gut microbial effects on the function of glia cells. Hence, the present study was aimed to examine the effects of psychobatics on dysbiosis and glia cells function in enteric and central nervous system with an inflammatory insight in T2DM.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Thirty rats were treated by 〈em〉Lactobacillus〈/em〉 (〈em〉L〈/em〉.) 〈em〉plantarum〈/em〉, inulin, or their combination (synbiotic) for 8 weeks after inducing T2DM. Fecal sample was collected to evaluate gut microbial composition. Then, the rats were sacrificed, and the colon, amygdala, and prefrontal cortex (PFC) were studied.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉T2DM resulted in dysbiosis and increased levels of glial cell-derived neurotrophic factor (GDNF), glial fibrillary acidic protein (GFAP), and inflammatory markers (IL-17, IL-6, and TLR-2) in the colon and brain. However, concurrent supplementation of 〈em〉L. plantarum〈/em〉 and inulin could improve the gut microbial composition as well as reduce the levels of inflammatory cytokines. While the administration of 〈em〉L. plantarum〈/em〉 led to a significant decrease in TLR-2 as well as GDNF and GFAP only in the amygdala, the synbiotic intake could make such changes in the colon, amygdala, and PFC.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our findings demonstrated an innovative approach to the beneficial effects of psychobiotics in neuroinflammation and behavioral performance through gut microbiota changes, focusing on possible role of glial cells in gut–brain axis.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Background〈/h3〉 〈p〉Brown seaweeds are known to be a rich source of fiber with the presence of several non-digestible polysaccharides including laminarin, fucoidan and alginate. These individual polysaccharides have previously been shown to favorably alter the gut microbiota composition and activity albeit the effect of the collective brown seaweed fiber component on the microbiota remains to be determined.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉This study investigated the effect of a crude polysaccharide-rich extract obtained from 〈em〉Laminaria digitata〈/em〉 (CE) and a depolymerized CE extract (DE) on the gut microbiota composition and metabolism using an in vitro fecal batch culture model though metagenomic compositional analysis using 16S rRNA FLX amplicon pyrosequencing and short-chain fatty acid (SCFA) analysis using GC-FID.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Selective culture analysis showed no significant changes in cultured lactobacilli or bifidobacteria between the CE or DE and the cellulose-negative control at any time point measured (0, 5, 10, 24, 36, 48 h). Following metagenomic analysis, the CE and DE significantly altered the relative abundance of several families including 〈em〉Lachnospiraceae〈/em〉 and genera including 〈em〉Streptococcus, Ruminococcus〈/em〉 and 〈em〉Parabacteroides〈/em〉 of human fecal bacterial populations in comparison to cellulose after 24 h. The concentrations of acetic acid, propionic acid, butyric acid and total SCFA were significantly higher for both the CE and DE compared to cellulose after 10, 24, 36 and 48 h fermentation (〈em〉p〈/em〉 〈 0.05). Furthermore, the acetate:propionate ratio was significantly reduced (〈em〉p〈/em〉 〈 0.05) for both CD and DE following 24, 36 and 48 h fermentation.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉The microbiota-associated metabolic and compositional changes noted provide initial indication of putative beneficial health benefits of 〈em〉L. digitata〈/em〉 in vitro; however, research is needed to clarify if 〈em〉L. digitata〈/em〉-derived fiber can favorably alter the gut microbiota and confer health benefits in vivo.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Objective〈/h3〉 〈p〉To analyze the contribution of ultra-processed foods to the intake of free sugars among different age groups in Australia.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Dietary intakes of 12,153 participants from the National Nutrition and Physical Activity Survey (2011–12) aged 2+ years were evaluated. Food items collected through two 24-h recalls were classified according to the NOVA system. The contribution of each NOVA food group and their subgroups to total energy intake was determined by age group. Mean free sugar content in diet fractions made up exclusively of ultra-processed foods, or of processed foods, or of a combination of un/minimally processed foods and culinary ingredients (which includes table sugar and honey) were compared. Across quintiles of the energy contribution of ultra-processed foods, differences in the intake of free sugars, as well as in the prevalence of excessive free sugar intake (≥ 10% of total energy) were examined.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Ultra-processed foods had the highest energy contribution among children, adolescents and adults in Australia, with older children and adolescents the highest consumers (53.1% and 54.3% of total energy, respectively). The diet fraction restricted to ultra-processed items contained significantly more free sugars than the two other diet fractions. Among all age groups, a positive and statistically significant linear association was found between quintiles of ultra-processed food consumption and both the average intake of free sugars and the prevalence of excessive free sugar intake.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Ultra-processed food consumption drives excessive free sugar intake among all age groups in Australia.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Phytosterols reduce intestinal cholesterol absorption and help to lower LDL-cholesterol. Many Chinese adults are lactose-intolerant and cannot tolerate bovine milk enriched with phytosterol. Soya-milk is a common beverage in Asia and it has beneficial effects on general health. We therefore conducted a randomized double-blind controlled trial to assess the effectiveness of a phytosterols-enriched soya drink in lowering serum LDL-cholesterol level (primary outcome) and other cardiovascular parameters (secondary outcomes).〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉One hundred and fifty-nine normocholesterolaemic participants (85 men and 74 women; aged 19–79) were randomized to daily intake of one serving of phytosterols-enriched soya drink (〈em〉N〈/em〉 = 82), equivalent to 2 g of phytosterol per day, or a matched soya drink without phytosterols (〈em〉N〈/em〉 = 77) for 3 weeks. Adverse events, withdrawal and compliance were documented.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Among the treatment group (〈em〉N〈/em〉 = 82), phytosterols-enriched soya drink significantly decreased LDL-cholesterol by 5.96% (SE 1.48, 95% CI − 8.91%, − 3.00%) with a median of 6.74% compared with baseline, resulting in a significant reduction of 4.70% (95% CI − 8.89%, − 0.51%; 〈em〉p〈/em〉 = 0.028) with a median of 5.20% compared with placebo (〈em〉N〈/em〉 = 77). In contrast, there were no significant changes in other lipid parameters, blood glucose, blood pressure, body weight or waist circumference. Remarkably, 95% of the participants randomized to the fortified drink reported no adverse events at all.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Daily consumption of a phytosterols-enriched soya drink may be a simple and cost-neutral means of lowering LDL-cholesterol in individuals in China, with massive population and rising incidence of coronary heart disease (ClinicalTrials.gov identifier: NCT02881658; date of registration: 14 Aug 2016).〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Food-based dietary guidelines are proposed to not only improve diet quality, but to also reduce the environmental impact of diets. The aim of our study was to investigate whether food-related behavioral activation therapy (F-BA) applying Mediterranean-style dietary guidelines altered food intake and the environmental impact of the diet in overweight adults with subsyndromal symptoms of depression.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In total 744 adults who either received the F-BA intervention (F-BA group) or no intervention (control group) for 12 months were included in this analysis. Food intake data were collected through a food frequency questionnaire at baseline and after 6 and 12 months. Greenhouse gas emissions (GHGE), land use (LU), and fossil energy use (FEU) estimates from life-cycle assessments and a weighted score of the three (〈em〉p〈/em〉ReCiPe score) were used to estimate the environmental impact of each individual diet at each timepoint.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The F-BA group reported increased intakes of vegetables (19.7 g/day; 95% CI 7.8–31.6), fruit (23.0 g/day; 9.4–36.6), fish (7.6 g/day; 4.6–10.6), pulses/legumes (4.0 g/day; 1.6–6.5) and whole grains (12.7 g/day; 8.0–17.5), and decreased intake of sweets/extras (− 6.8 g/day; − 10.9 to − 2.8) relative to control group. This effect on food intake resulted in no change in GHGE, LU, and 〈em〉p〈/em〉ReCiPe score, but a relative increase in FEU by 1.6 MJ/day (0.8, 2.4).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉A shift towards a healthier Mediterranean-style diet does not necessarily result in a diet with reduced environmental impact in a real-life setting.〈/p〉 〈/span〉 〈span〉 〈h3〉Trial registration〈/h3〉 〈p〉ClinicalTrials.gov. Number of identification: NCT02529423. August 2015.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The health-promoting potential of food-derived plant bioactive compounds is evident but not always consistent across studies. Large inter-individual variability may originate from differences in digestion, absorption, distribution, metabolism and excretion (ADME). ADME can be modulated by age, sex, dietary habits, microbiome composition, genetic variation, drug exposure and many other factors. Within the recent COST Action POSITIVe, large-scale literature surveys were undertaken to identify the reasons and extent of inter-individual variability in ADME of selected plant bioactive compounds of importance to cardiometabolic health. The aim of the present review is to summarize the findings and suggest a framework for future studies designed to investigate the etiology of inter-individual variability in plant bioactive ADME and bioefficacy.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Few studies have reported individual data on the ADME of bioactive compounds and on determinants such as age, diet, lifestyle, health status and medication, thereby limiting a mechanistic understanding of the main drivers of variation in ADME processes observed across individuals. Metabolomics represent crucial techniques to decipher inter-individual variability and to stratify individuals according to metabotypes reflecting the intrinsic capacity to absorb and metabolize bioactive compounds.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉A methodological framework was developed to decipher how the contribution from genetic variants or microbiome variants to ADME of bioactive compounds can be predicted. Future study design should include (1) a larger number of study participants, (2) individual and full profiling of all possible determinants of internal exposure, (3) the presentation of individual ADME data and (4) incorporation of omics platforms, such as genomics, microbiomics and metabolomics in ADME and efficacy studies.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Research has identified plant-based diets as the most protective for our health; it is now essential to focus on good food associations and the beneficial constituents in plant foods. From a growing body of evidence, some categories of food phytochemicals are increasingly considered to play a crucial role in the cardiometabolic health effects associated with plant food consumption. However, the heterogeneity in responsiveness to plant food bioactive intake that is frequently observed in clinical trials can hinder the identification of the effects of these compounds in specific subpopulations and likely lead to underestimating their actual contribution to the health effects of their food sources.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The magnitude and the main factors responsible for this between-subject variation in response to the consumption of the major families of food phytochemicals have been poorly documented so far. Thus, research efforts in this area must be developed. More importantly, capturing the interindividual variability in response to plant food bioactive intake, together with identifying the main determinants involved, is a crucial step that will enable the development and production of plant food products, thereby satisfying the nutritional needs and conferring benefits to different categories of populations.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉The development of a science-based personalised nutrition approach focusing on plant foods rich in specific bioactive compounds could contribute to alleviating the dramatic burden of metabolic and cardiovascular diseases.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Modern food technology allows designing products aiming to simulate and replace traditional food. In affluent societies there is a rising tendency to consume foods derived from plants including milk imitations or plant drinks based on cereals, nuts, legumes, oil seeds or other plant families. Herein we review production and composition of such drinks, summarize consumers’ motivations to change from milk to plant drinks and highlight nutritional and health implications of consuming plant drinks instead of milk, in particular if non-fortified and if consumed by infants, children, adolescents and the elderly.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Whereas the macronutrient concentrations of some plant drinks (soy) may approach in some cases (protein) that of cow’s milk, the nutritional quality of most plant drinks, e.g., the biological value of protein and the presence and amount of vitamins and essential minerals with high bioavailability does not. If cow’s milk is exchanged for non-fortified and non-supplemented plant drinks consumers may risk deficiencies of calcium, zinc, iodine, vitamins B2, B12, D, A, and indispensable amino acids, particularly in infants and toddlers who traditionally consume significant portions of milk. The vegetable nature, appearance and taste of such plant drinks may be appealing to adult consumers and be chosen for adding variety to the menu. However, in young children fed exclusively such plant drinks severe metabolic disturbances may occur.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Parents, dietitians, physicians and consumers should be aware of such potential risks, if non-fortified plant drinks are consumed instead of milk.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Athletes in Olympic combat sports experience body water fluctuations resulting from training and intentional dehydration when making weight. Despite the popularity of urine specific gravity (〈em〉U〈/em〉〈sub〉SG〈/sub〉) and urine osmolality (〈em〉U〈/em〉〈sub〉OSM〈/sub〉) measurement in characterizing fluid fluctuations, their utility remains questioned. This systematic review/meta-analysis examined the utility of urinary hydration indices in laboratory and field settings in Olympic combat sport athletes.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉27 articles met the inclusion criteria for systematic review, 15 studies were included in the meta-analysis; with 〈em〉U〈/em〉〈sub〉SG〈/sub〉 and 〈em〉U〈/em〉〈sub〉OSM〈/sub〉 the main outcome variables. Meta-regression analyses evaluated the interrelationship among body mass (〈em〉B〈/em〉〈sub〉M〈/sub〉), fluid intake, and urine measures.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Significant 〈em〉U〈/em〉〈sub〉SG〈/sub〉 alterations were observed following different sampling time frames: dehydration (ES 0.59; 95% CI 0.46–0.72; 〈em〉p〈/em〉 = 0.001), follow-up period (ES 0.31; 95% CI 0.11–0.50; 〈em〉p〈/em〉 = 0.002) and rehydration (ES − 0.34; 95% CI − 0.56 to − 0.12; 〈em〉p〈/em〉 = 0.003). Direct comparison of laboratory (ES 0.20; 95% CI − 0.19 to 0.59; 〈em〉p〈/em〉 = 0.324) and field (ES 0.35; 95% CI 0.14–0.56; 〈em〉p〈/em〉 = 0.001) sampling showed marginally trivial and small effects. Small effects on 〈em〉U〈/em〉〈sub〉OSM〈/sub〉 were observed following dehydration (ES 0.31; 95% CI 0.12–0.74, 〈em〉p〈/em〉 = 0.15), follow-up period (ES 0.39; 95% CI 0.08–0.70, 〈em〉p〈/em〉 = 0.015) and rehydration (ES − 0.45; 95% CI − 0.60 to 0.30, 〈em〉p〈/em〉 = 0.001). Meta-regression analysis suggests only fluid intake predicts 〈em〉U〈/em〉〈sub〉SG〈/sub〉 alterations (〈em〉p〈/em〉 = 0.044) during rehydration protocols.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉There were likely small changes in both 〈em〉U〈/em〉〈sub〉SG〈/sub〉 and 〈em〉U〈/em〉〈sub〉OSM〈/sub〉 readings across all experimental conditions, with moderate-to-large heterogeneity in all studies, except for 〈em〉U〈/em〉〈sub〉SG〈/sub〉 readings during dehydration protocols. The meta-regression failed to provide conclusive evidence concerning the interrelationship among urine measures, 〈em〉B〈/em〉〈sub〉M〈/sub〉 fluctuations, and fluid intake.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Previous studies have shown that high-dose supplementation with n-3 polyunsaturated fatty acids (PUFAs) may benefit patients with nonalcoholic fatty liver disease (NAFLD), but the association of n-3 PUFAs with NAFLD among individuals with normal diets is only speculative. We investigated the cross-sectional and prospective associations between n-3 PUFAs and NAFLD in Chinese adults.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉This community-based prospective study included 3049 men and women (40–75 years) in Guangzhou, China, whose participants completed an NAFLD ultrasound evaluation and erythrocyte PUFA tests. A total of 2660 participants underwent the second NAFLD evaluation approximately 3 years later. α-Linolenic acid (ALA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in erythrocytes were measured by gas chromatography.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉After adjusting for potential confounders, we observed inverse associations between DHA, DHA + EPA, total n-3 PUFAs and the presence of NAFLD in the cross-sectional analysis. The adjusted odds ratios (95% confidence interval) of NAFLD for the highest (vs. lowest) tertile were 0.74 (0.61, 0.90) for DHA, 0.82 (0.67, 1.00) for EPA, 0.73 (0.60, 0.88) for DHA + EPA and 0.74 (0.61, 0.91) for total n-3 PUFAs  (all 〈em〉P〈/em〉 values≤0.05). Over the average 3.12 years of follow-up, higher levels of DHA was associated with an improvement of NAFLD. The hazard ratio of improved NAFLD for the highest tertile was 1.18 (95% CI 1.09, 1.33) for DHA. Pathway analyses showed that favorable associations may be mediated by improvements in inflammatory markers (e.g., interleukin 1 beta and tumor necrosis factor alpha-like).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Erythrocyte membrane n-3 PUFAs are inversely associated with the presence and progression of NAFLD in Chinese adults.〈/p〉 〈/span〉 〈span〉 〈h3〉Trial registrations〈/h3〉 〈p〉ClinicalTrials.gov NCT03179657.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The main objective of this study is to describe the association between the consumption of either traditional or modern dairy products or calcium intakes and the risk of colorectal cancer (CRC) in the adult Moroccan population.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉A case–control study was conducted in five Moroccan hospital centers. The study was matched on sex, age (± 5 years) and center. Data were collected using validated food frequency questionnaire (FFQ) taking into account different types of Moroccan dairy products. Conditional logistic regression models were used to assess the association between dairy products consumption, calcium intakes and CRC risk subtypes. In all statistical tests, the significance level was set at 0.05.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Among 1453 cases and 1453 matched controls, 50.7% were women and 49.3% were men. Milk OR〈sup〉b〈/sup〉 0.84, 95% CI 0.74–0.96 and yogurt OR〈sup〉b〈/sup〉 0.74, 95% CI 0.64–0.86 were inversely associated with CRC risk. Similar inverse associations were observed for traditional dairy products namely Lben OR〈sup〉b〈/sup〉 0.77, 95% CI 0.67–0.88, Raib OR〈sup〉b〈/sup〉 0.86, 95% CI 0.76–0.96 and Jben OR〈sup〉b〈/sup〉 0.77, 95% CI 0.67–0.88. The dairy calcium intake was inversely associated to CRC overall OR〈sup〉b〈/sup〉 0.83, 95% CI 0.74–0.93.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our study supports previous international evidence and suggests that individuals who have a high intake of either modern or traditional dairy products are at lower risk for CRC. These findings should be further confirmed by longitudinal data and studies investigating potential pathways involved.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉We aimed to evaluate the effectiveness of consuming iodine-fortified toddler milk for improving dietary iodine intakes and biochemical iodine status in toddlers.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In a 20-week parallel randomised controlled trial, healthy 12–20-month-old children were assigned to: Fortified Milk [〈em〉n〈/em〉 = 45; iodine-fortified (21.1 µg iodine/100 g prepared drink) cow’s milk], or Non-Fortified Milk (〈em〉n〈/em〉 = 90; non-fortified cow’s milk). Food and nutrient intakes were assessed with 3-day weighed food records at baseline, and weeks 4 and 20. Urinary iodine concentration (UIC) was measured at baseline and 20 weeks.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉At baseline, toddlers’ median milk intake was 429 g/day. There was no evidence that milk intakes changed within or between the groups during the intervention. Toddlers’ baseline geometric mean iodine intake was 46.9 µg/day, and the median UIC of 43 µg/L in the Fortified Milk group and 55 µg/L in the Non-Fortified Milk group indicated moderate and mild iodine deficiency, respectively, with this difference due to chance. During the intervention, iodine intakes increased by 136% (〈em〉p〈/em〉 〈 0.001) and UIC increased by 85 µg/L (〈em〉p〈/em〉 〈 0.001) in the Fortified Milk group compared to the Non-Fortified Milk group. The 20-week median UIC was 91 µg/L in the Fortified Milk group and 49 µg/L in the Non-Fortified Milk group.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Consumption of ≈ 1.7 cups of iodine-fortified toddler milk per day for 20 weeks can increase dietary iodine intakes and UIC in healthy iodine-deficient toddlers. This strategy alone is unlikely to provide sufficient intake to ensure adequate iodine status in toddlers at risk of mild-to-moderate iodine deficiency.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Previously, the nutritional contribution, environmental and financial costs of dairy products have been examined independently. Our aim was to determine the nutritional adequacy, financial cost and environmental impact of UK diets according to dairy content.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In this cross-sectional study of adults (19–64 years) from the UK National Diet and Nutrition Survey years 1–4 (〈em〉n〈/em〉 = 1655), dietary intakes assessed from 4-day estimated food diaries were organized into quartiles (Q) total grams of dairy (milk, cheese, yogurt, dairy desserts) and analyzed using ANCOVA controlling for age, sex and energy intake with Bonferroni post hoc test for nutritional adequacy, Alternative Healthy Eating Index (AHEI-2010), environmental impact [greenhouse gas emissions (GHGE), eutrophication and acidification potentials], financial cost, markers of health and cardio-metabolic diseases.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Nutritional adequacy, particularly for protein, calcium and iodine (+ 18 g, + 533 mg, + 95 g, respectively, all 〈em〉P〈/em〉 〈 0.0001) and AHEI-2010 (〈em〉P〈/em〉 〈 0.0001) were significantly higher and systolic BP (− 2 mmHg, 〈em〉P〈/em〉 = 0.019) was significantly lower for the higher-dairy diets (Q4, 274–1429 g/day dairy), compared with diets containing lower dairy (Q1, 0–96 g/day dairy). Diets in Q4 had lower financial cost (− 19%, 〈em〉P〈/em〉 〈 0.0001) and the greatest eutrophication potential, compared with Q1 (+ 29%, 〈em〉P〈/em〉 〈 0.0001). Yet the environmental (GHGE) and financial costs per unit nutrient (riboflavin, zinc, iodine, magnesium, calcium, potassium) were lower in Q4 than Q1 (all 〈em〉P〈/em〉 〈 0.0001).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Diets with the highest dairy content had higher nutrient composition, better diet quality, were associated with lower BP and financial cost, but with higher eutrophication potential. Robust environmental data for many of food groups are limited and this needs an urgent addressing.〈/p〉 〈/span〉 〈span〉 〈h3〉Trial registration〈/h3〉 〈p〉This trial was registered on clinicaltrials.gov as NCT03407248.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The role of polyphenol intake during adolescence to prevent metabolic syndrome (MetS) is little explored. This study aimed to evaluate the association between intake of total polyphenols, polyphenol classes and the 10 most consumed individual polyphenols with MetS risk in European adolescents.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Of the cross-sectional HELENA study, 657 adolescents (54% girls; 14.8% overweight; 12.5–17.5 year) had a fasting blood sample and polyphenol intake data from two non-consecutive 24-h recalls matched with the Phenol-Explorer database. MetS was defined via the pediatric American Heart Association definition. Multilevel linear regressions examined the associations of polyphenol quartiles with MetS components, while logistic regression examined the associations with MetS risk.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉After adjusting for all potential confounders (socio-demographics and nine nutrients), total polyphenol intake, polyphenol classes and individual polyphenols were not associated with MetS risk. From all MetS components, only BMI 〈em〉z〈/em〉-score was modestly inversely associated with total polyphenol intake. Further sub analyses on polyphenol classes revealed that flavonoid intake was significantly associated with higher diastolic blood pressure and lower BMI, and phenolic acid intake was associated with higher low-density cholesterol. For individual polyphenols, the above BMI findings were often confirmed (not independent from dietary intake) and a few associations were found with insulin resistance.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Higher intakes of total polyphenols and flavonoids were inversely associated with BMI. No consistent associations were found for other MetS components.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Introduction〈/h3〉 〈p〉Chronic inflammation plays a critical role in lymphomagenesis and several dietary factors seem to be involved its regulation. The aim of the current study was to assess the association between the inflammatory potential of the diet and the risk of lymphoma and its subtypes in the European Investigation into Cancer and Nutrition (EPIC) study.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉The analysis included 476,160 subjects with an average follow-up of 13.9 years, during which 3,136 lymphomas (135 Hodgkin lymphoma (HL), 2606 non-Hodgkin lymphoma (NHL) and 395 NOS) were identified. The dietary inflammatory potential was assessed by means of an inflammatory score of the diet (ISD), calculated using 28 dietary components and their corresponding inflammatory weights. The association between the ISD and lymphoma risk was estimated by hazard ratios (HR) and 95% confidence intervals (CI) calculated by multivariable Cox regression models adjusted for potential confounders.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The ISD was not associated with overall lymphoma risk. Among lymphoma subtypes, a positive association between the ISD and mature B-cell NHL (HR for a 1-SD increase: 1.07 (95% CI 1.01; 1.14), 〈em〉p〈/em〉 trend = 0.03) was observed. No statistically significant association was found among other subtypes. However, albeit with smaller number of cases, a suggestive association was observed for HL (HR for a 1-SD increase = 1.22 (95% CI 0.94; 1.57), 〈em〉p〈/em〉 trend 0.13).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our findings suggested that a high ISD score, reflecting a pro-inflammatory diet, was modestly positively associated with the risk of B-cell lymphoma subtypes. Further large prospective studies on low-grade inflammation induced by diet are warranted to confirm these findings.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Results of some epidemiological studies suggest that moderate alcohol consumption may be associated with a decreased risk to develop NAFLD. Here, the effect of the consumption of moderate beer and diluted ethanol, respectively, on the development of NAFLD were assessed.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Female C57BL/6J mice were fed a control diet (C-D) or a diet rich in fructose, fat and cholesterol (FFC) enriched isocalorically and isoalcoholically with beer (FFC + B) or plain ethanol (FFC + E) (2.5 g ethanol/kg body weight/day) for 7 weeks. Liver damage was assessed by histology using NAFLD activity score. Markers of inflammation, insulin resistance and adiponectin signaling were measured at mRNA and protein levels. Using J774A.1 cells as a model of Kupffer cells, the effect of alcoholic beverages on adiponectin receptor 1 (〈em〉Adipor1〈/em〉) was assessed.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Hepatic triglyceride concentration, neutrophil granulocytes, iNOS protein concentrations and early signs of insulin resistance found in FFC-fed mice were significantly attenuated in FFC+ B-fed mice (〈em〉P〈/em〉 〈 0.05 for all). These findings were associated with a super-induction of 〈em〉Adipor1〈/em〉 mRNA expression (+ ~ 18-fold compared to all other groups) and a decrease of markers of lipid peroxidation in liver tissue of FFC + B-fed mice when compared to FFC-fed animals. Similar differences were not found between FFC– and FFC+ E-fed mice. Expression of 〈em〉Adipor1〈/em〉 was also super-induced (7.5-fold) in J774A.1 cells treated with beer (equivalent to 2 mmol/L ethanol).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉These data suggest that moderate intake of fermented alcoholic beverages such as beer at least partially attenuates NAFLD development through mechanisms associated with hepatic AdipoR1 expression.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Introduction〈/h3〉 〈p〉Polycystic ovary syndrome (PCOS) is among the most prevalent endocrine disorders in women and can lead to many other disorders and chronic diseases. Thus, early diagnosis and treatment of this syndrome is important. Using probiotics, prebiotics, and synbiotics supplementations to treat PCOS seems appropriate because of their useful effects and low complications.〈/p〉 〈/span〉 〈span〉 〈h3〉Aims〈/h3〉 〈p〉To assess the effects of probiotics, prebiotics, and synbiotics on hormonal indices such as testosterone, dehydroepiandrosterone sulfate (DHEA-S), sex hormone binding globulin, Free Androgen Index (FAI), and inflammatory indices, such as high sensitive C reactive protein (hsCRP), malondialdehyde (MDA), total glutathione (GSH), nitric oxide (NO), and total antioxidant capacity (TAC) as the primary outcomes and the hirsutism score as the secondary outcome.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉All published articles from the beginning until 10 November 2018 in English (Cochrane Library, Web of Sciences, Google Scholar, PubMed, Scopus, and ProQuest) and Persian (SID and Magiran) databases were searched. The effect of interventions on the outcomes was reported with a standard mean difference (SMD) and confidence interval of 95%. In case of high heterogeneity, the random effect model was used instead of the fixed effect model. The statistical heterogeneity of the included clinical trials was tested using the Chi square test and 〈em〉I〈/em〉〈sup〉2〈/sup〉.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Thirteen studies with 855 participants with PCOS(438 women in the intervention group and 417 women in the control group) were included in the meta-analysis. Results of the meta-analysis showed that the SHBG (SMD: 0.56; 95% CI 0.26–0.86; 〈em〉P〈/em〉 = 0.0002) and NO (SMD: 0.38; 95% CI 0.09–0.68; 〈em〉P〈/em〉 = 0.01) concentration increased significantly in the probiotics and synbiotics groups compared to the placebo group. FAI (SMD: − 0.58; 95% CI − 0.95 to − 0.21; 〈em〉P〈/em〉 = 0.002) and MDA (SMD: − 0.76; 95% CI − 1.46 to − 0.05; 〈em〉P〈/em〉 = 0.03) concentration in the probiotics and synbiotics groups reduced significantly compared to the placebo group. The results of meta-analyses on other hormonal and inflammatory indices such as testosterone, DHEAS, GSH, hsCRP, TAC, and hirsutism score showed that there were no significant differences between the intervention and control groups.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Using synbiotics and probiotics in women with polycystic ovary syndrome improve hormonal (FAI, SHBG) and inflammatory (NO, MDA) indices in these patients.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈p〉Thanks to advances in modern medicine over the past century, the world’s population has experienced a marked increase in longevity. However, disparities exist that lead to groups with both shorter lifespan and significantly diminished health, especially in the aged. Unequal access to proper nutrition, healthcare services, and information to make informed health and nutrition decisions all contribute to these concerns. This in turn has hastened the ageing process in some and adversely affected others’ ability to age healthfully. Many in developing as well as developed societies are plagued with the dichotomy of simultaneous calorie excess and nutrient inadequacy. This has resulted in mental and physical deterioration, increased non-communicable disease rates, lost productivity and quality of life, and increased medical costs. While adequate nutrition is fundamental to good health, it remains unclear what impact various dietary interventions may have on improving healthspan and quality of life with age. With a rapidly ageing global population, there is an urgent need for innovative approaches to health promotion as individual’s age. Successful research, education, and interventions should include the development of both qualitative and quantitative biomarkers and other tools which can measure improvements in physiological integrity throughout life. Data-driven health policy shifts should be aimed at reducing the socio-economic inequalities that lead to premature ageing. A framework for progress has been proposed and published by the World Health Organization in its Global Strategy and Action Plan on Ageing and Health. This symposium focused on the impact of nutrition on this framework, stressing the need to better understand an individual’s balance of intrinsic capacity and functional abilities at various life stages, and the impact this balance has on their mental and physical health in the environments they inhabit.〈/p〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉It has been suggested that restoring gut microbiota alterations with probiotics represents a potential clinical target for the treatment of gut microbiota-related diseases, such as obesity. Here, we apply 16S rDNA microbiota profiling to establish which bacteria in the human gut are associated with obesity and cardiometabolic risk factors, and to evaluate whether probiotic supplementation modulates gut microbiota.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We evaluated the effects of a probiotic mixture (2 × 10〈sup〉10〈/sup〉 CFU/day of 〈em〉Lactobacillus acidophilus〈/em〉 LA-14, 〈em〉Lactobacillus casei〈/em〉 LC-11, 〈em〉Lactococcus lactis〈/em〉 LL-23, 〈em〉Bifidobacterium bifidum〈/em〉 BB-06, and 〈em〉Bifidobacterium lactis〈/em〉 BL-4) in 32 overweight or obese women in a double-blind, randomized, placebo-controlled study. Using 16S rDNA sequencing, we characterized fecal samples and investigated the relationships between microbiome data and diet, body composition, antioxidant enzymes, and inflammatory profile. In addition, we characterized the degree of variation among fecal communities after the intervention.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉BMI, weight, fat mass, lean mass, conicity index, protein intake, monounsaturated fat intake, glycated hemoglobin, TNF-α, and IL6/IL10 were significantly correlated with microbiome composition. The candidate division TM7 was strongly associated with all adiposity markers and 〈em〉Clostridiaceae〈/em〉 associated negatively with TNF-α. The family 〈em〉Clostridiaceae〈/em〉 increased and TM7 tended to decrease after the probiotic mixture supplementation. Subjects were clustered according to body composition, and a higher proportion of TM7 was observed in those with higher adiposity.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Ecosystem-wide analysis of probiotic use effects on the gut microbiota revealed a genera specific influence, and one of which (TM7) represents a promising novel target for obesity treatment.〈/p〉 〈/span〉 〈span〉 〈h3〉Trial registration number〈/h3〉 〈p〉U1111-1137-4566.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Evidence supports a role of whole grains in colorectal cancer (CRC) prevention, but the association between gluten intake and CRC risk in healthy populations is unclear. We examined the association of grain and gluten intake with risk of CRC overall and by subsite among Cancer Prevention Study-II Nutrition Cohort participants.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In 1999, 50,118 men and 62,031 women completed food frequency questionnaires assessing grain intake. Gluten intake was estimated using the protein content of grain products. Multivariable-adjusted hazards ratio (HR) and 95% confidence interval (CI) of CRC risk were estimated using Cox proportional hazards regression.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉During follow-up through 2013, 1742 verified CRC cases occurred. For the highest vs. lowest quintiles of whole grain intake, HRs (95% CIs) of CRC risk were 0.77 (0.61–0.97; 〈em〉P〈/em〉 trend = 0.03) among men and 1.10 (95% CI 0.88–1.36; 〈em〉P〈/em〉 trend = 0.14) among women (〈em〉P〈/em〉 interaction by sex = 0.01). Men in the highest vs. lowest quintile of whole grain intake had a 43% lower risk of rectal cancer (HR = 0.57, 95% CI 0.35–0.93, 〈em〉P〈/em〉 trend = 0.04). Gluten intake was not associated with CRC risk overall (HR = 1.10, 95% CI 0.93–1.32, 〈em〉P〈/em〉 trend = 0.10), but was associated with risk of proximal colon cancer among men and women, combined (HR = 1.37, 95% CI 1.07–1.75, quintile 5 vs. 1, 〈em〉P〈/em〉 trend = 0.001) and separately. Refined grains and grain-based sweets were not associated with CRC risk.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉We found that higher whole grain intake was associated with lower CRC risk among older US men, but not women. The positive association of gluten intake with the risk of proximal colon cancer deserves further study.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Chronic gastritis is observed in almost half world population. Traditional medications against chronic gastritis might produce adverse effects, so alternative nutritional strategies are needed to prevent the aggravation of gastric mucosal damage. The aim of this study is to evaluate the protective effect of the combination of wheat peptides and fucoidan (WPF) on adults diagnosed with chronic superficial gastritis in a randomized, double-blind, placebo-controlled clinical trial.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Participants were randomized to receive WPF (〈em〉N 〈/em〉= 53) or placebo (〈em〉N 〈/em〉= 53) once daily for 45 days. Pathological grading of gastric mucosal damage was scored using gastroscopy. Fecal samples were collected for the determination of calprotectin, short chain fatty acids (SCFA) levels and metagenomics analysis. Questionnaires for self-reported gastrointestinal discomforts, life quality and food frequency were collected throughout the study.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉WPF intervention reduced gastric mucosal damage in 70% subjects (〈em〉P 〈/em〉〈 0.001). Significantly less stomach pain (〈em〉P 〈/em〉〈 0.001), belching (〈em〉P 〈/em〉= 0.028), bloating (〈em〉P 〈/em〉〈 0.001), acid reflux (〈em〉P 〈/em〉〈 0.001), loss of appetite (〈em〉P 〈/em〉= 0.021), increased food intake (〈em〉P 〈/em〉= 0.020), and promoted life quality (〈em〉P 〈/em〉= 0.014) were reported in the WPF group. WPF intervention significantly decreased fecal calprotectin level (〈em〉P 〈/em〉= 0.003) while slightly increased fecal SCFAs level (〈em〉P 〈/em〉= 0.092). In addition, we found altered microbiota composition post-intervention with increased 〈em〉Bifidobacterium pseudocatenulatum〈/em〉 (〈em〉P 〈/em〉= 0.032), 〈em〉Eubacterium siraeum〈/em〉 (〈em〉P 〈/em〉= 0.036), 〈em〉Bacteroides intestinalis〈/em〉 (〈em〉P 〈/em〉= 0.024) and decreased 〈em〉Prevotella copri〈/em〉 (〈em〉P 〈/em〉= 0.055).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉WPF intervention could be utilized as a nutritional alternative to mitigate the progression of chronic gastritis. Furthermore, WPF played an important role in altering gut microbial profile and SCFA production, which might benefit the lower gastrointestinal tract.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Higher folate and vitamin-B12 have been linked to lower risk of overweight. However, whether this is a causal effect of these B-vitamins on obesity risk remains unclear and evidence in older individuals is scarce. This study aimed to assess the role of B-vitamin supplementation and levels on body composition in older individuals.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉A double-blind, randomized controlled trial in 2919 participants aged ≥ 65 years with elevated homocysteine levels. The intervention comprised a 2-year supplementation with a combination of folic acid (400 µg) and vitamin B12 (500 µg), or with placebo. Serum folate, vitamin-B12, active vitamin-B12 (HoloTC), methylmalonic acid (MMA), and anthropometrics were measured at baseline and after 2 years of follow-up. Dietary intake of folate and vitamin-B12 was measured at baseline in a subsample (〈em〉n〈/em〉 = 603) using a validated food-frequency questionnaire. Fat mass index (FMI) and fat-free mass index (FFMI) were assessed with Dual Energy X-ray absorptiometry (DXA).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Cross-sectional analyses showed that a 1 nmol/L higher serum folate was associated with a 0.021 kg/m〈sup〉2〈/sup〉 lower BMI (95% CI − 0.039; − 0.004). Higher HoloTC (per pmol/L log-transformed) was associated with a 0.955 kg/m〈sup〉2〈/sup〉 higher FMI (95% CI 0.262; 1.647), and higher MMA (per μgmol/L) was associated with a 1.108 kg/m〈sup〉2〈/sup〉 lower FMI (95% CI − 1.899; − 0.316). However, random allocation of B-vitamins did not have a significant effect on changes in BMI, FMI or FFMI during 2 years of intervention.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Although observational data suggested that folate and vitamin B12 status are associated with body composition, random allocation of a supplement with both B-vitamins combined versus placebo did not confirm an effect on BMI or body composition.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Adherence to Mediterranean diet (MedDiet) and physical activity have been associated to lower cardiovascular risk and mortality. Our purpose was to test the modification of advanced glycation end-products (AGEs) as one of the underlying mechanisms explaining this relationship.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Cross-sectional study assessing the adherence to MedDiet (14-item Mediterranean Diet Adherence Screener) and physical activity (International Physical Activity Questionnaire short form) in 2646 middle-aged subjects without known cardiovascular disease and type 2 diabetes from the ILERVAS study. Skin autofluorescence (SAF), a non-invasive assessment of subcutaneous AGEs, was measured. Multivariable logistic regression models were done to study interactions and independent associations with a likelihood ratio test.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Participants with a high adherence to MedDiet had lower SAF than those with low adherence (1.8 [IR 1.6; 2.1] vs. 2.0 [IR 1.7; 2.3] arbitrary units, 〈em〉p〈/em〉 〈 0.001), without differences according to categories of physical activity. There was an independent association between high adherence to MedDiet and the SAF values [OR 0.59 (0.37–0.94), 〈em〉p〈/em〉 = 0.026]. When adherence to MedDiet was substituted by its individual food components, high intake of vegetables, fruits and nuts, and low intake of sugar-sweetened soft beverages were independently associated with a decreased SAF (〈em〉p〈/em〉 ≤ 0.045). No interaction between MedDiet and physical activity on SAF values was observed except for nuts consumption (〈em〉p〈/em〉 = 0.047).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Adherence to the MedDiet, but not physical activity, was negatively associated to SAF measurements. This association can be explained by some typical food components of the MedDiet. The present study offers a better understanding of the plausible biological conditions underlying the prevention of cardiovascular disease with MedDiet.〈/p〉 〈p〉ClinTrials.gov identifier: NCT03228459.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Diabetes is a chronic inflammatory disorder resulting in endothelial dysfunction which contributes to peripheral arterial disease and limb ischemia. Leukocytes play critical roles in vascular and tissue remodelling after ischemia. This study investigated the effects of dietary glutamine (GLN) supplementation on immune cell polarization in diabetic mice subjected to limb ischemia.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Diabetes was induced by an intraperitoneal injection of streptozotocin for 5 consecutive days in C57BL/6J mice. Diabetic mice were fed the AIN-93 diet or an AIN-93 diet in which a part of the casein was replaced by GLN. After 3 weeks of the dietary intervention, mice were subjected to unilateral femoral artery ligation to induce limb ischemia.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉GLN supplementation enhanced the proportion of anti-inflammatory monocytes and regulatory T cells in the blood. Expression of C-C motif chemokine receptor 5 by activated CD4〈sup〉+〈/sup〉 T cells was promoted and prolonged in the GLN-supplemented group. GLN downregulated the percentage of M1 macrophages in muscle tissues which was correlated with lower levels of C-C motif chemokine ligand 2 in plasma. The muscle M1/M2 ratio was also reduced in the GLN group. Gene expression of interleukin-6 was suppressed by GLN supplementation, while expression levels of the peroxisome proliferator-activated receptor γ and myogenic differentiation 1 genes were elevated in post-ischemic muscles. Histological findings also indicated that muscle regeneration was accelerated in the GLN group.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉GLN supplementation in diabetic mice may exert more-balanced polarization of CD4〈sup〉+〈/sup〉 T cells, monocytes, and macrophages, thus attenuating inflammatory responses and contributing to muscle regeneration after limb ischemia.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉A growing body of evidence shows that consumption of ultra-processed foods (UPF) is associated with a higher risk of cardiometabolic diseases, which, in turn, have been linked to depression. This suggests that UPF might also be associated with depression, which is among the global leading causes of disability and disease. We prospectively evaluated the relationship between UPF consumption and the risk of depression in a Mediterranean cohort.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We included 14,907 Spanish university graduates [mean (SD) age: 36.7 year (11.7)] initially free of depression who were followed up for a median of 10.3 years. Consumption of UPF (industrial formulations made mostly or entirely from substances derived from foods and additives, with little, if any, intact food), as defined by the NOVA food classification system, was assessed at baseline through a validated semi-quantitative 136-item food-frequency questionnaire. Participants were classified as incident cases of depression if they reported a medical diagnosis of depression or the habitual use of antidepressant medication in at least one of the follow-up assessments conducted after the first 2 years of follow-up. Cox regression models were used to assess the relationship between UPF consumption and depression incidence.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉A total of 774 incident cases of depression were identified during follow-up. Participants in the highest quartile of UPF consumption had a higher risk of developing depression [HR (95% CI) 1.33 (1.07–1.64); 〈em〉p〈/em〉 trend = 0.004] than those in the lowest quartile after adjusting for potential confounders.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉In a prospective cohort of Spanish university graduates, we found a positive association between UPF consumption and the risk of depression that was strongest among participants with low levels of physical activity.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉The tryptophan-containing dipeptides isoleucine–tryptophan (IW) and tryptophan–leucine (WL) are angiotensin-converting enzyme (ACE)-inhibitors in vitro. These peptides are released by enzymatic hydrolysis of bovine whey protein. To exhibit ACE inhibition in vivo, peptides need to be absorbed into the circulatory system. This study aimed to determine the in vivo ACE-inhibitory potency of a whey protein hydrolysate (MPH), containing IW and WL, and to quantify plasma concentrations of these peptides after oral administration of MPH in healthy volunteers. Additionally, changes in blood pressure were investigated.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉After intake of 5 and 50 g MPH, plasma ACE activity was reduced to 86.4 ± 5.9 and 75.1 ± 6.9% of baseline activity, respectively. Although a clear ACE inhibition was measured, no effect on blood pressure was seen. Basal plasma concentrations of the tryptophan-containing dipeptides were 2.8 ± 0.7 nM for IW and 10.1 ± 1.8 nM for WL. After intake of 5–50 g MPH, peptide concentrations were dose dependently elevated to values between 12.5 ± 8.4 and 99.1 ± 58.7 nM for IW and 15.0 ± 4.3–34.9 ± 19.4 nM for WL. Administration of intact whey protein showed a minor ACE inhibition, probably caused by release of inhibitory peptides during gastrointestinal digestion. The increase of WL in plasma after intake of intact protein was similar to that determined after intake of MPH. In contrast, resulting IW concentrations were much lower after intake of intact whey protein when compared to MPH administration.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉After intake of MPH, plasma ACE activity decreased in parallel to the increase of IW and WL plasma concentrations. However, the resulting peptide concentrations cannot fully explain the reduction of ACE activity in plasma with a direct enzyme inhibition. Therefore, this study points to a gap in the understanding of the inhibitory action of these peptides in vivo. Thus, to further develop innovative food additives with ACE activity diminishing capabilities, it appears mandatory to better characterize the mode of action of these peptides.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Several clinical studies suggested that light-to-moderate alcohol intake could alleviate nonalcoholic fatty liver disease (NAFLD), but the underlying mechanism is still poorly understood.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Mice fed a high-fat diet (HFD) were submitted or not to moderate ethanol intake for 3 months (ca. 10 g/kg/day) via drinking water. Biochemical, analytical and transcriptomic analyses were performed in serum and liver.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Serum ethanol concentrations in ethanol-treated HFD mice comprised between 0.5 and 0.7 g/l throughout the experiment. NAFLD improvement was observed in ethanol-treated HFD mice as assessed by reduced serum transaminase activity. This was associated with less microvesicular and more macrovacuolar steatosis, the absence of apoptotic hepatocytes and a trend towards less fibrosis. Liver lipid analysis showed increased amounts of fatty acids incorporated in triglycerides and phospholipids, reduced proportion of palmitic acid in total lipids and higher desaturation index, thus suggesting enhanced stearoyl-coenzyme A desaturase activity. mRNA expression of several glycolytic and lipogenic enzymes was upregulated. Genome-wide expression profiling and gene set enrichment analysis revealed an overall downregulation of the expression of genes involved in collagen fibril organization and leukocyte chemotaxis and an overall upregulation of the expression of genes involved in oxidative phosphorylation and mitochondrial respiratory chain complex assembly. In addition, mRNA expression of several proteasome subunits was upregulated in ethanol-treated HFD mice.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Moderate chronic ethanol consumption may alleviate NAFLD by several mechanisms including the generation of non-toxic lipid species, reduced expression of profibrotic and proinflammatory genes, restoration of mitochondrial function and possible stimulation of proteasome activity.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉We aimed to evaluate associations between compliance with recommendations for total water intake (TWI) and total water intake from fluids (TWIF), and some socio-demographic and lifestyle factors of a senior Mediterranean population at high cardiovascular risk.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Cross-sectional analysis with data of 1902 participants from the PREDIMED-Plus study. A validated 32-item Spanish fluid-intake questionnaire was used to assess beverage consumption and water intake. Multivariable logistic regression models were used to assess the odds ratio (OR) and the 95% confidence interval (CI) for complying with European Food Safety Agency recommendations for TWI and TWIF according to various socio-demographic and lifestyle factors, and for the joint associations of Mediterranean diet (MedDiet) adherence and moderate–vigorous physical activity (MVPA).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉The mean total volume of fluid intake in the population studied was 1934 ± 617 mL/day. Water was the most frequently consumed beverage. Significant differences between sex were only observed in alcoholic and hot beverage consumption. Compliance with TWIF was associated with being women (OR 3.02; 2.40, 3.80), high adherence to MedDiet (OR 1.07; 1.02, 1.12), and participants who were more engaged in physical activity (PA) (OR 1.07; 1.02, 1.13). Age was inversely associated (OR 0.96; 0.94, 0.98). Similar results for TWI recommendations compliance were observed in relation to being women (OR 5.34; 3.85, 7.42), adherence to MedDiet (OR 1.16; 1.02, 1.31) and PA (OR 1.07; 1.00, 1.15). The joint association of PA and MedDiet, showed that participants with higher adherence to MedDiet and meeting WHO recommendations for MVPA complied better with the TWI recommendations (OR 1.66; 1.19, 2.32).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉High compliance with recommendations for TWI was associated with being a woman, and a healthy lifestyle characterized by high adherence to the MedDiet and PA.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Previous studies suggest that coffee and caffeine intake may be associated with reduced breast cancer risk. To date, there is limited and inconsistent epidemiologic evidence for associations of adolescent diet with mammographic breast density, a strong and consistent predictor of breast cancer. We investigated the association of adolescent caffeine intake with mammographic density in premenopausal women.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉This study included 751 cancer-free women within the Nurses’ Health Study II cohort. Percent breast density (PD), absolute dense (DA) and non-dense areas (NDA) were measured from digitized film mammograms using a computer-assisted thresholding technique; all measures were square root-transformed. Energy-adjusted adolescent caffeine intake was estimated using the data from a food frequency questionnaire. Information regarding breast cancer risk factors was obtained from questionnaires closest to the mammogram date. We used generalized linear regression to quantify associations of caffeine intake with breast density measures.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉In multivariable analyses, adolescent caffeine intake was not associated with any of the density phenotypes (caffeine 4th vs. 1st quartile: 〈em〉β〈/em〉 = − 1.27, 95% CI − 4.62; 2.09, 〈em〉p〈/em〉-trend = 0.55 for percent density; 〈em〉β〈/em〉 = − 0.21, 95% CI − 0.76, 0.34, 〈em〉p〈/em〉-trend = 0.65 for absolute dense area, and 〈em〉β〈/em〉 = 0.23, 95% CI − 0.28, 0.74, 〈em〉p〈/em〉-trend = 0.50 for non-dense area). Additional adjustment of the models for body mass index at age 18 resulted in attenuation of the risk estimates.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our findings do not support the hypothesis that adolescent caffeine intake is associated with premenopausal mammographic breast density.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Diets with increased protein content are popular strategies for body weight regulation, but the effect of such diets for the colonic luminal environment is unclear. We aimed to investigate the associations between putative colorectal cancer-related markers and total protein intake, plant and animal proteins, and protein from red and processed meat in pre-diabetic adults (〉 25 years).〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Analyses were based on clinical and dietary assessments at baseline and after 1 year of intervention. Protein intake was assessed from 4-day dietary records. Putative colorectal cancer-related markers identified from 24-h faecal samples collected over three consecutive days were: concentration of short-chain fatty acids, phenols, ammonia, and pH.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉In total, 79 participants were included in the analyses. We found a positive association between change in total protein intake (slope: 74.72 ± 28.84 µmol per g faeces/〈em〉E〈/em〉%, 〈em〉p〈/em〉 = 0.01), including animal protein intake (slope: 87.63 ± 32.04 µmol per g faeces/〈em〉E〈/em〉%, 〈em〉p〈/em〉 = 0.009), and change in faecal ammonia concentration. For change in ammonia, there was a dose–response trend from the most negative (lowest tertile) to the most positive (highest tertile) association (〈em〉p〈/em〉 = 0.01): in the high tertile, a change in intake of red meat was positively associated with an increase in ammonia excretion (slope: 2.0 ± 0.5 µmol per g faeces/g/day, 〈em〉p〈/em〉 〈 0.001), whereas no such association was found in the low and medium tertile groups.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉Increases in total and animal protein intakes were associated with higher excretion of ammonia in faeces after 1 year in overweight pre-diabetic adults undertaking a weight-loss intervention. An increase in total or relative protein intake, or in the ratio of animal to plant protein, was not associated with an increase in faeces of any of the other putative colorectal cancer risk markers.〈/p〉 〈/span〉 〈span〉 〈h3〉Trial registration〈/h3〉 〈p〉ClinicalTrials.gov Identifier: NCT01777893.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Isothiocyanates (ITCs) are compounds derived from 〈em〉Brassica〈/em〉 plants with documented anticancer activity. Molecular mechanisms of their selective activity against cancer cells are still underexplored. In this work, the impact of ITC on DNA replication and damage was compared between PC-3 prostate cancer cells and HDFa normal fibroblasts as well as PNT2 prostate epithelial cells.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Cells were treated with sulforaphane or phenethyl isothiocyanate. [〈sup〉3〈/sup〉H]thymidine incorporation and the level of histone γH2A.X were estimated as indicators of DNA replication and double-strand breaks (DSB), respectively. Levels of HDAC3, CtIP, and p-RPA were investigated by immunoblotting. Comet assay was performed to visualize DNA damage.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉ITCs inhibited DNA replication in all tested cell lines, and this activity was independent of reactive oxygen species of mitochondrial origin. It was followed by DSB which were more pronounced in cancer than noncancerous cells. This difference was independent of HDAC activity which was decreased in both cell lines when treated with ITCs. On the other hand, it correlated with faster removal of DSB, and thus, transient activation of repair proteins in normal cells, while in PC-3 prostate cancer, cell DNA repair was significantly less effective.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉DNA damage induced by ITCs is a consequence of the block in DNA replication which is observed in both, cancer and normal cells. Selective antiproliferative activity of ITCs towards cancer cells results from less efficient DNA repair in cancer cells relative to normal cells.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Short telomeres and B vitamin deficiencies have been proposed as risk factors for age-related diseases and mortality that interact through oxidative stress and inflammation. However, available data to support this concept are insufficient. We aimed to investigate the predictive role of B vitamins and homocysteine (HCY) for mortality in cardiovascular patients. We explored potential relationships between HCY, B vitamins, relative telomere length (RTL), and indices of inflammation.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Vitamin B6, HCY, interleukin-6 (IL-6), high-sensitive-C-reactive protein (hs-CRP), and RTL were measured in participants of the Ludwigshafen Risk and Cardiovascular Health Study. Death events were recorded over a median follow-up of 9.9 years.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉All-cause mortality increased with higher concentrations of HCY and lower vitamin B6. Patients in the 4th quartile of HCY and vitamin B6 had hazard ratios (HR) for all-cause mortality of 2.77 (95% CI 2.28–3.37) and 0.41(95% CI 0.33–0.49), respectively, and for cardiovascular mortality of 2.78 (95% CI 2.29–3.39) and 0.40 (95% CI 0.33–0.49), respectively, compared to those in the 1st quartile. Multiple adjustments for confounders did not change these results. HCY and vitamin B6 correlated with age-corrected RTL (〈em〉r〈/em〉 = − 0.086, 〈em〉p〈/em〉 〈 0.001; 〈em〉r〈/em〉 = 0.04, 〈em〉p〈/em〉 = 0.031, respectively), IL-6 (〈em〉r〈/em〉 = 0.148, 〈em〉p〈/em〉 〈 0.001; 〈em〉r〈/em〉 = − 0.249, 〈em〉p〈/em〉 〈 0.001, respectively), and hs-CRP (〈em〉r〈/em〉 = 0.101, 〈em〉p〈/em〉 〈 0.001; 〈em〉r〈/em〉 = − 0.320, 〈em〉p〈/em〉 〈 0.001, respectively). Subjects with the longest telomeres had a significantly higher concentration of vitamin B6, but lower concentrations of HCY, IL-6, and hs-CRP. Multiple regression analyses identified HCY as an independent negative predictor of age-corrected RTL.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉In conclusion, hyperhomocysteinemia and vitamin B6 deficiency are risk factors for death from any cause. Hyperhomocysteinemia and vitamin B6 deficiency correlate with increased mortality. This correlation might, at least partially, be explained by accelerated telomere shortening induced by oxidative stress and systemic inflammation in these circumstances.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Coffee is widely consumed and implicated in numerous health outcomes but the mechanisms by which coffee contributes to health is unclear. The purpose of this study was to test the effect of coffee drinking on candidate proteins involved in cardiovascular, immuno-oncological and neurological pathways.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We examined fasting serum samples collected from a previously reported single blinded, three-stage clinical trial. Forty-seven habitual coffee consumers refrained from drinking coffee for 1 month, consumed 4 cups of coffee/day in the second month and 8 cups/day in the third month. Samples collected after each coffee stage were analyzed using three multiplex proximity extension assays that, after quality control, measured a total of 247 proteins implicated in cardiovascular, immuno-oncological and neurological pathways and of which 59 were previously linked to coffee exposure. Repeated measures ANOVA was used to test the relationship between coffee treatment and each protein.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Two neurology-related proteins including carboxypeptidase M (CPM) and neutral ceramidase (N-CDase or ASAH2), significantly increased after coffee intake (〈em〉P〈/em〉 〈 0.05 and 〈em〉Q〈/em〉 〈 0.05). An additional 46 proteins were nominally associated with coffee intake (〈em〉P〈/em〉 〈 0.05 and 〈em〉Q〈/em〉 〉 0.05); 9, 8 and 29 of these proteins related to cardiovascular, immuno-oncological and neurological pathways, respectively, and the levels of 41 increased with coffee intake.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉CPM and N-CDase levels increased in response to coffee intake. These proteins have not previously been linked to coffee and are thus novel markers of coffee response worthy of further study.〈/p〉 〈/span〉 〈span〉 〈h3〉Clinical trial registry〈/h3〉 〈p〉〈a href="http://www.isrctn.com/ISRCTN12547806"〉http://www.isrctn.com/ISRCTN12547806〈/a〉.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Processed meat intake may adversely affect lung health, but data on asthma remains sparse. The magnitude of the processed meat–asthma association may also depend on other unhealthy behaviors. We investigated the association between processed meat intake and the asthma symptom score, and the combined role of unhealthy weight, smoking, low diet quality, and high processed meat intake on the asthma score.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉In 2017, 35,380 participants to the NutriNet-Santé cohort answered a detailed respiratory web-questionnaire. Asthma was defined by the asthma symptom score (sum of 5 questions; continuous variable). Based on repeated 24-h dietary records collected on a dedicated website, processed meat consumption was classified as 0, 〈 2, 2–5, 〉 5 servings/week. We examined the combined role of body mass index (BMI) (〈 25 vs. ≥ 25 kg/m〈sup〉2〈/sup〉), smoking (never vs. ever), diet quality score (highest vs. lowest), and processed meat (≤ 5 vs. 〉 5 servings/week) on the asthma symptom score.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Participants were aged 54 on average (women: 75%, smokers: 49%, BMI ≥ 25: 32%, ≥ 1 asthma symptoms: 27%). After adjustment for confounders, processed meat intake was positively and significantly associated with asthma symptom score: odds ratios (ORs) (95% CI) for 〉 5 vs. 0 servings/week were 1.15 (1.04–1.27) in women; 1.23 (1.01–1.50) in men. Compared to participants with 0 unhealthy behaviors, ORs for the asthma symptom score among participants with the 4 combined unhealthy behaviors were 2.18 (1.91–2.48) in women; 2.70 (2.10–3.45) in men.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉High processed meat consumption was associated with higher asthma symptoms, and combining overweight/obesity, smoking, low diet quality, with high processed meat intake was strongly associated with asthma symptoms.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Celiac disease (CD) is a multifactorial, autoimmune, gluten-sensitive inflammatory disorder of the small intestine. Taking into account the pathogenesis of CD, a strict gluten-free diet (GFD) is the only treatment able to restore epithelium integrity and eliminate complications. The current study was designed to assess whether the use of a GFD is sufficient for maintaining a correct oxidative/antioxidant balance and ameliorating the evoked inflammatory signaling in young patients with CD.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉The study covered 80 children, aged between 7 and 18 years, attending the Gastroenterology Service of the Gastroenterology, Hepatology and Child Nutrition Service from the Virgen de las Nieves Hospital in Granada. Children with CD diagnosed were included in the celiac group who followed a strict GFD for 2 years (〈em〉n〈/em〉 = 40) and the control group (〈em〉n〈/em〉 = 40) included healthy children, with negative serological screening. Soluble superoxide dismutase 1 and 2, total antioxidant status, 8-hydroxy-2′-deoxyguanosine, cortisol, melatonin and inflammatory parameters in plasma, 15-F2t-isoprostanes in urine, and DNA breaks in peripheral blood lymphocytes were analysed.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉No differences were found in oxidative stress between CD patients and controls; however, IFN-γ, IL-1α, IP-10 and TNF-β were higher in the CD patients. VEGF was also higher than in the control group.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉The GFD in the CD patients is enough to reduce the oxidative stress; however, in the case of the inflammatory signaling, the initial exposure to gluten prior to stablish the GFD is strong enough to induce an inflammatory state which is maintained (even when consuming the GFD); meanwhile the increase in VEGF recorded in the CD group could be a compensatory mechanism to restore the damaged mucosa and duodenal villous atrophy, due to its role in endothelial activation and generation of new functional and stable vascular networks.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Bovine colostrum is available in health food shops and as a sports food supplement and is rich in antibodies and growth factors including IGF-1. World Anti-Doping Agency advises athletes against taking colostrum for fear of causing increased plasma IGF-1. There are also concerns that colostrum may theoretically stimulate malignancy in organs which express IGF-1 receptors. We, therefore, determined changes in plasma IGF-1 levels in subjects taking colostrum or placebo for 1 day, 4 weeks, and 12 weeks.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Plasma IGF1 levels were determined in healthy males (〈em〉n〈/em〉 = 16) who ingested 40 g bovine colostrum or placebo along with undertaking moderate exercise for total period of 4.5 h. Two further studies followed changes in IGF1 using double-blind, parallel group, placebo-controlled, randomized trials of colostrum or placebo (〈em〉N〈/em〉 = 10 per arm, 20 g/day for 4 weeks and 〈em〉N〈/em〉 = 25 colostrum, 〈em〉N〈/em〉 = 29 placebo arm 20 g/day for 12 weeks).〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Baseline IGF1 levels 130 ± 36 ng/ml. 4.5 h protocol showed no effect of colostrum on plasma IGF1 (ANOVA, treatment group: 〈em〉p〈/em〉 = 0.400, group × time: 〈em〉p〈/em〉 = 0.498, time 〈em〉p〈/em〉 = 0.602). Similarly, no effect of colostrum ingestion was seen following 4 week (ANOVA, group: 〈em〉p〈/em〉 = 0.584, group × time interaction: 〈em〉p〈/em〉 = 0.083, time 〈em〉p〈/em〉 = 0.243) or 12 week (ANOVA, group: 〈em〉p〈/em〉 = 0.400, group × time interaction: 〈em〉p〈/em〉 = 0.498, time 〈em〉p〈/em〉 = 0.602) protocol.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Ingestion of standard recommended doses of colostrum does not increase IGF-1 levels in healthy adults, providing additional support for the safety profile of colostrum ingestion.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉A high intake of marine n-3 polyunsaturated fatty acids (PUFAs) might improve cardiovascular (CV) health. We conducted a cross-sectional study to investigate associations between plasma phospholipid levels of marine n-3 PUFAs and CV risk factors, educational level, physical activity and smoking habits.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉A total of 3706 individuals from a general population, all born in 1950 and residing in Akershus County, Norway, were included in this study. The main statistical approach was multivariable adjusted linear regression.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Plasma marine n-3 PUFA levels ranged from 2.7 to 20.3 wt%, with a median level of 7.7 wt% (interquartile range 4.3–11.1 wt%). High levels of plasma marine n-3 PUFAs were associated with lower serum triglycerides [Standardized regression coefficient (Std.〈em〉β〈/em〉-coeff.) − 0.14, 〈em〉p〈/em〉 〈 0.001], body mass index (Std. 〈em〉β〈/em〉-coeff. −0.08, 〈em〉p〈/em〉 〈 0.001), serum creatinine (Std. 〈em〉β〈/em〉-coeff. -0.03, 〈em〉p〈/em〉 = 0.05), C-reactive protein levels (Std. 〈em〉β〈/em〉-coeff. – 0.03, 〈em〉p〈/em〉 = 0.04), higher levels of serum high-density lipoprotein cholesterol (Std. 〈em〉β〈/em〉-coeff. 0.08, 〈em〉p〈/em〉 〈 0.001) and low-density lipoprotein cholesterol (Std. 〈em〉β〈/em〉-coeff. 0.04, 〈em〉p〈/em〉 = 0.003). High levels of plasma marine n-3 PUFAs were also associated with lower glycated hemoglobin (Std. 〈em〉β〈/em〉-coeff. – 0.04, 〈em〉p〈/em〉 = 0.01), however, only in individuals without diabetes. We found no associations between plasma marine n-3 PUFA levels and fasting plasma glucose or carotid intima-media thickness. High levels of plasma marine n-3 PUFAs were associated with higher educational level, more physical activity and lower prevalence of smoking.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusion〈/h3〉 〈p〉In this cross-sectional study of Norwegian individuals born in 1950, high levels of plasma marine n-3 PUFAs were favourably associated with several CV risk factors, suggesting that fish consumption might improve CV health.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉In this study, we aimed to study the correlation between acute and habitual intakes of flavonols, their main food sources and their 24-h urinary concentrations in an European population.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉A 24-h dietary recall (24-HDR) and 24-h urine samples were collected on the same day from a convenience subsample of 475 men and women from four countries (France, Italy, Greece and Germany) of the European Prospective Investigation into Cancer and Nutrition (EPIC) study. A standardized 24-HDR software and a country/centre-specific validated dietary questionnaire (DQ) were used to collect acute and habitual dietary data, respectively. The intake of dietary flavonols was estimated using the Phenol-Explorer database. Urinary flavonols (quercetin, isorhamnetin, and kaempferol) were analysed using tandem mass spectrometry with a previous enzymatic hydrolysis.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Weak partial Spearman correlations between both dietary acute and habitual intake and urinary concentrations of quercetin (both 〈em〉R〈/em〉〈sub〉partial〈/sub〉 ~ 0.3) and total flavonols (both 〈em〉R〈/em〉〈sub〉partial〈/sub〉 ~ 0.2) were observed. No significant correlations were found for kaempferol and isorhamentin. Regarding flavonol-rich foods, weak correlations were found between urinary concentrations of quercetin and total flavonols and the acute intake of onions and garlics, fruits, tea, and herbal tea (all 〈em〉R〈/em〉〈sub〉partial〈/sub〉 ~ 0.2). For habitual intake, statistically significant correlations were only found between urinary quercetin concentration and herbal tea (〈em〉R〈/em〉〈sub〉partial〈/sub〉 = 0.345) and between urinary total flavonol concentration and tea, and herbal tea consumption (〈em〉R〈/em〉〈sub〉partial〈/sub〉 ~ 0.2).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our results suggest that urinary quercetin level can be used as potential concentration biomarkers of both acute and habitual quercetin intake, while urinary concentrations of flavonols are unlikely to be useful biomarkers of individual flavonol-rich foods.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉Aim of this study was to identify a possible relationship among dietary fatty acids (FA) intake, FA adipose tissue (AT) profile and cancer condition in lean vs obese subjects affected or not by colorectal cancer (CRC). Actually, inadequate dietary habits together with physical inactivity are primary determinants of obesity and cancer risk. Changes in lipid metabolism play a crucial role in different types of cancer and key enzymes involved in lipid-metabolic pathways, such as stearoyl-coA-desaturase 1 (SCD-1), are differentially expressed in normal and cancer tissues.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉Food frequency questionnaires (FFQ) were analyzed by Winfood software. FA were assessed by gas–liquid chromatography in visceral AT samples. Estimated desaturase activities were calculated as precursor FA/product FA ratio. Desaturase gene expressions were evaluated by RT-qPCR.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Lean and obese CRC subjects showed inadequate dietary habits. In particular, lean CRC subjects showed increase in the intake of saturated FA, specifically palmitic (〈em〉p〈/em〉 = 0.0042) and stearic acid (〈em〉p〈/em〉 = 0.0091), and a corresponding reduction of monounsaturated FA consumption, in particular oleic acid (〈em〉p〈/em〉 = 0.002) with respect to lean without CRC. Estimated SCD-1 activity in AT was increased in all the groups vs lean without CRC (〈em〉p〈/em〉ANOVA = 0.029).〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Unhealthy eating habits, characterizing obese and CRC subjects, may influence the visceral AT profile and contribute to the alteration of the metabolic pathways. The quality of the diet, other than the quantity, can have a main role in the establishment of inflammatory microenvironment and in metabolic changes favouring CRC.〈/p〉 〈/span〉

Description: 〈h3〉Abstract〈/h3〉 〈span〉 〈h3〉Purpose〈/h3〉 〈p〉We conducted a meta-analysis to systematically assess the prospective association between vitamin K and cardiovascular disease (CVD) events and all-cause mortality.〈/p〉 〈/span〉 〈span〉 〈h3〉Methods〈/h3〉 〈p〉We searched PubMed and EMBASE through January 2019 for prospective studies that reported the association of vitamin K (assessed by dietary intake or circulating concentration) with CVD events [including total CVD, CVD mortality, total coronary heart disease (CHD), fatal CHD, nonfatal myocardial infarction (MI), and stroke] and all-cause mortality. Multivariable-adjusted hazard ratios (HRs) comparing top versus bottom tertiles of vitamin K were combined using random-effects meta-analysis.〈/p〉 〈/span〉 〈span〉 〈h3〉Results〈/h3〉 〈p〉Twenty-one articles were included with 222,592 participants. A significant association was found between dietary phylloquinone and total CHD (pooled HR 0.92; 95% CI 0.84, 0.99; 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 0%; four studies), as well as menaquinone and total CHD (0.70; 95% CI 0.53, 0.93; 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 32.1%; two studies). No significant association was observed between dietary vitamin K and all-cause mortality, CVD mortality, or stroke. Elevated plasma desphospho-uncarboxylated MGP (dp-ucMGP), a marker of vitamin K deficiency, was associated with an increased risk of all-cause mortality (1.84; 95% CI 1.48, 2.28; 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 16.8%; five studies) and CVD mortality (1.96; 95% CI 1.47, 2.61; 〈em〉I〈/em〉〈sup〉2〈/sup〉 = 0%; two studies). No significant association was observed between circulating total osteocalcin and all-cause mortality or total CVD.〈/p〉 〈/span〉 〈span〉 〈h3〉Conclusions〈/h3〉 〈p〉Our findings showed that higher dietary vitamin K consumption was associated with a moderately lower risk of CHD, and higher plasma dp-ucMGP concentration, but not total circulating osteocalcin, was associated with increased risks of all-cause and CVD mortality. However, causal relations cannot be established because of limited number of available studies, and larger prospective studies and randomized clinical trials are needed to validate the findings.〈/p〉 〈/span〉