ALBERT

Description: The Foundation Fighting Blindness leads a collaborative effort among patients and families, scientists, and the commercial sector to drive the development of preventions, treatments, and cures for inherited retinal diseases (IRDs). When the nonprofit was established in 1971, it sought the knowledge and insights of leaders in the retinal research field to guide its research funding decisions. While the Foundation’s early investments focused on gaining a better understanding of the genetic causes of IRDs, its portfolio of projects would come to include some of the most innovative approaches to saving and restoring vision, including gene replacement/augmentation therapies, gene editing, RNA modulation, optogenetics, and gene-based neuroprotection. In recent years, the Foundation invested in resources such as its patient registry, natural history studies, and genetic testing program to bolster clinical development and trials for emerging genetic therapies. Though the number of clinical trials for such therapies has surged over the last decade, the Foundation remains steadfast in its commitment to funding the initiatives that hold the most potential for eradicating the entire spectrum of IRDs.

Description: A conspicuous cell-shape phenotype known as “screwy” was reported to result from mutations at two or three uncharacterized loci in the ciliate Paramecium tetraurelia. Here, we describe a new screwy mutation, Spinning Top, which appeared spontaneously in the cross of an unrelated mutant with reference strain 51. The macronuclear (MAC) genome of the Spinning Top mutant is shown to lack a ~28.5-kb segment containing 18 genes at the end of one chromosome, which appears to result from a collinear deletion in the micronuclear (MIC) genome. We tested several candidate genes from the deleted locus by dsRNA-induced silencing in wild-type cells, and identified a single gene responsible for the phenotype. This gene, named Spade, encodes a 566-aa glutamine-rich protein with a C2HC zinc finger. Its silencing leads to a fast phenotype switch during vegetative growth, but cells recover a wild-type phenotype only 5–6 divisions after silencing is stopped. We analyzed 5 independently-obtained mutant alleles of the Sc1 locus, and concluded that all of them also lack the Spade gene and a number of neighboring genes in the MAC and MIC genomes. Mapping of the MAC deletion breakpoints revealed two different positions among the 5 alleles, both of which differ from the Spinning Top breakpoint. These results suggest that this MIC chromosome region is intrinsically unstable in strain 51.

Description: Extracellular vesicles (EVs) have received increasing attention over the last two decades. Initially, they were considered as just a garbage disposal tool; however, it has progressively become clear that their protein, nucleic acid (namely miRNA and mRNA), and lipid contents have signaling functions. Besides, it has been established that cells release different types of vesicular structures for which characterization is still in its infancy. Many stress conditions, such as hypoxia, senescence, and oncogene activation have been associated with the release of higher levels of EVs. Further, evidence has shown that autophagic–lysosomal pathway abnormalities also affect EV release. In fact, in neurodegenerative diseases characterized by the accumulation of toxic proteins, although it has not become clear to what extent the intracellular storage of undigested materials itself has beneficial/adverse effects, these proteins have also been shown to be released extracellularly via EVs. Lysosomal storage disorders (LSDs) are characterized by accumulation of undigested substrates within the endosomal–lysosomal system, due either to genetic mutations in lysosomal proteins or to treatment with pharmacological agents. Here, we review studies investigating the role of lysosomal and autophagic dysfunction on the release of EVs, with a focus on studies exploring the release of EVs in LSD models of both genetic and pharmacological origin. A better knowledge of EV-releasing pathways activated in lysosomal stress conditions will provide information on the role of EVs in both alleviating intracellular storage of undigested materials and spreading the pathology to the neighboring tissue.

Description: Previous study has demonstrated that the riboflavin treatment promoted the early ripening of the ‘Kyoho’ grape berry. However, the molecular mechanism causing this was unclear. In order to reveal the regulation mechanism of riboflavin treatment on grape berry development and ripening, the different berry developmental stages of the ‘Kyoho’ berry treated with 0.5 mmol/L of riboflavin was sampled for transcriptome profiling. RNA-seq revealed that 1526 and 430 genes were up-regulated and down-regulated, respectively, for the comparisons of the treatment to the control. TCseq analysis showed that the expression patterns of most of the genes were similar between the treatment and the control, except for some genes that were related to the chlorophyll metabolism, photosynthesis–antenna proteins, and photosynthesis, which were revealed by the enrichment analysis of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). The differentially expressed genes and weighted gene co-expression network analysis (WGCNA) analysis identified some significantly differentially expressed genes and some hub genes, including up-regulation of the photosynthesis-related ELIP1 and growth and development-related GDSL; and down-regulation of the oxidative stress-related ATHSP22 and berry softening-related XTH32 and GH9B15. The results suggested that the riboflavin treatment resulted in the variations of the expression levels of these genes, and then led to the early ripening of the ‘Kyoho’ berry.

Description: The taxonomical identification merely based on morphology is often difficult for ancient remains. Therefore, universal or specific PCR amplification followed by sequencing and BLAST (basic local alignment search tool) search has become the most frequently used genetic-based method for the species identification of biological samples, including ancient remains. However, it is challenging for these methods to process extremely ancient samples with severe DNA fragmentation and contamination. Here, we applied whole-genome sequencing data from 12 ancient samples with ages ranging from 2.7 to 700 kya to compare different mapping algorithms, and tested different reference databases, mapping similarities and query coverage to explore the best method and mapping parameters that can improve the accuracy of ancient mammal species identification. The selected method and parameters were tested using 152 ancient samples, and 150 of the samples were successfully identified. We further screened the BLAST-based mapping results according to the deamination characteristics of ancient DNA to improve the ability of ancient species identification. Our findings demonstrate a marked improvement to the normal procedures used for ancient species identification, which was achieved through defining the mapping and filtering guidelines to identify true ancient DNA sequences. The guidelines summarized in this study could be valuable in archaeology, paleontology, evolution, and forensic science. For the convenience of the scientific community, we wrote a software script with Perl, called AncSid, which is made available on GitHub.

Description: Taenia pisiformis is a tapeworm causing economic losses in the rabbit breeding industry worldwide. Due to the absence of genomic data, our knowledge on the developmental process of T. pisiformis is still inadequate. In this study, to better characterize differential and specific genes and pathways associated with the parasite developments, a comparative transcriptomic analysis of the larval stage (TpM) and the adult stage (TpA) of T. pisiformis was performed by Illumina RNA sequencing (RNA-seq) technology and de novo analysis. In total, 68,588 unigenes were assembled with an average length of 789 nucleotides (nt) and N50 of 1485 nt. Further, we identified 4093 differentially expressed genes (DEGs) in TpA versus TpM, of which 3186 DEGs were upregulated and 907 were downregulated. Gene Ontology (GO) and Kyoto Encyclopedia of Genes (KEGG) analyses revealed that most DEGs involved in metabolic processes and Wnt signaling pathway were much more active in the TpA stage. Quantitative real-time PCR (qPCR) validated that the expression levels of the selected 10 DEGs were consistent with those in RNA-seq, indicating that the transcriptomic data are reliable. The present study provides comparative transcriptomic data concerning two developmental stages of T. pisiformis, which will be of great value for future functional studies on the regulatory mechanisms behind adult worm pathogenesis and for developing drugs and vaccines against this important parasite.

Description: Background: Genomes are non-randomly organized within the interphase nucleus; and spermatozoa are proposed to have a unique hairpin-loop configuration, which has been hypothesized to be critical for the ordered exodus of the paternal genome following fertilization. Recent studies suggest that the hairpin-loop model of sperm chromatin organization is more segmentally organized. The purpose of this study is to examine the 3D organization and hairpin-loop configurations of chromosomes in human spermatozoa. Methods: Three-color sperm-fluorescence in-situ hybridization was utilized against the centromeres, and chromosome p- and q-arms of eight chromosomes from five normozoospermic donors. Wide-field fluorescence microscopy and 3D modelling established the radial organization and hairpin-loop chromosome configurations in spermatozoa. Results: All chromosomes possessed reproducible non-random radial organization (p 〈 0.05) and formed discrete hairpin-loop configurations. However, chromosomes preferentially formed narrow or wide hairpin-loops. We did not find evidence to support the existence of a centralized chromocenter(s) with centromeres being more peripherally localized than one or both of their respective chromosome arms. Conclusion: This provides further evidence to support a more segmental organization of chromatin in the human sperm nucleus. This may be of significance for fertilization and early embryogenesis as specific genomic regions are likely to be exposed, remodeled, and activated first, following fertilization.

Description: Increasing evidence suggests that overlapping genes are much more common in eukaryotic genomes than previously thought. These different-strand overlapping genes are potential sense–antisense (SAS) pairs, which might have regulatory effects on each other. In the present study, we identified the SAS loci in the equine genome using previously generated stranded, paired-end RNA sequencing data from the equine chorioallantois. We identified a total of 1261 overlapping loci. The ratio of the number of overlapping regions to chromosomal length was numerically higher on chromosome 11 followed by chromosomes 13 and 12. These results show that overlapping transcription is distributed throughout the equine genome, but that distributions differ for each chromosome. Next, we evaluated the expression patterns of SAS pairs during the course of gestation. The sense and antisense genes showed an overall positive correlation between the sense and antisense pairs. We further provide a list of SAS pairs with both positive and negative correlation in their expression patterns throughout gestation. This study characterizes the landscape of sense and antisense gene expression in the placenta for the first time and provides a resource that will enable researchers to elucidate the mechanisms of sense/antisense regulation during pregnancy.

Description: Childhood acute lymphoblastic leukemia (ALL) peaks around age 2–4, and in utero genetic epigenetic mother-fetus crosstalk might tune ALL onset during childhood life. Folate genes variably interact with vitamin status on ALL risk and prognosis. We investigated DHFR and MTHFR gene variants in 235 ALL children and their mothers to disclose their role in determining ALL onset age and survival. Pyrosequence of DHFR 19bp ins/del (rs70991108; W/D), MTHFR C677T (rs1801133; C〉T), and MTHFR A1298C (rs1801131; A〉C) was assessed in children and in 72% of mothers for dyad-analysis comparison. DHFR DD-children had delayed ALL onset compared to WW-children (7.5 ± 4.8 vs. 5.2 ± 3.7 years; P = 0.002) as well as MTHFR 1298 CC-children compared to AA-children (8.03 ± 4.8 vs. 5.78 ± 4.1 years; P = 0.006), and according to the strong linkage disequilibrium between MTHFR 677 T-allele and 1298C-allele, MTHFR TT-children showed early mean age of onset though not significant. Offspring of MTHFR 677 TT-mothers had earlier ALL onset compared to offspring of 677 CC-mothers (5.4 ± 3.3 vs. 7 ± 5.3 years; P = 0.017). DHFR/MTHFR 677 polymorphism combination influenced onset age by comparing DD/CC vs. WW/TT children (8.1 ± 5.7 vs. 4.7 ± 2.1 years; P = 0.017). Moreover, mother-child genotype combination gave 5.5-years delayed onset age in favor of DD-offspring of 677 CC-mothers vs. WW-offspring of 677 TT-mothers, and it was further confirmed including any D-carrier children and any 677 T-carrier mothers (P = 0.00052). Correction for multiple comparisons maintained statistical significance for DHFR ins/del and MTHFR A1298C polymorphisms. Unexpectedly, among the very-early onset group (〈2.89 years; 25th), DD-genotype inversely clustered in children and mothers (4.8% vs. 23.8% respectively), and accordingly ALL offspring of homozygous DD-mothers had increased risk to have early-onset (adjusted OR (odds ratio) = 3.08; 1.1–8.6; P = 0.03). The opposite effect DHFR promoter variant has in tuning ALL onset-time depending on who is the carrier (i.e., mother or child) might suggest a parent-origin-effect of the D-allele or a two-faced epigenetic role driven by unbalanced folate isoform availability during the in-utero leukemogenesis responsible for the wide postnatal childhood ALL latency.

Description: In this case study we successfully teamed the PDQeX DNA purification technology developed by MicroGEM, New Zealand, with the MinION and MinIT mobile sequencing devices developed by Oxford Nanopore Technologies to produce an effective point-of-need field diagnostic system. The PDQeX extracts DNA using a cocktail of thermophilic proteinases and cell wall-degrading enzymes, thermo-responsive extractor cartridges and a temperature control unit. This closed system delivers purified DNA with no cross-contamination. The MinIT is a newly released data processing unit that converts MinION raw signal output into nucleotide base called data locally in real-time, removing the need for high-specification computers and large file transfers from the field. All three devices are battery powered with an exceptionally small footprint that facilitates transport and setup. To evaluate and validate capability of the system for unbiased pathogen identification by real-time sequencing in a farmer’s field setting, we analysed samples collected from cassava plants grown by subsistence farmers in three sub-Sahara African countries (Tanzania, Uganda and Kenya). A range of viral pathogens, all with similar symptoms, greatly reduce yield or destroy cassava crops. Eight hundred (800) million people worldwide depend on cassava for food and yearly income, and viral diseases are a significant constraint to its production. Early pathogen detection at a molecular level has great potential to rescue crops within a single growing season by providing results that inform decisions on disease management, use of appropriate virus-resistant or replacement planting. This case study presented conditions of working in-field with limited or no access to mains power, laboratory infrastructure, Internet connectivity and highly variable ambient temperature. An additional challenge is that, generally, plant material contains inhibitors of downstream molecular processes making effective DNA purification critical. We successfully undertook real-time on-farm genome sequencing of samples collected from cassava plants on three farms, one in each country. Cassava mosaic begomoviruses were detected by sequencing leaf, stem, tuber and insect samples. The entire process, from arrival on farm to diagnosis, including sample collection, processing and provisional sequencing results was complete in under 3 h. The need for accurate, rapid and on-site diagnosis grows as globalized human activity accelerates. This technical breakthrough has applications that are relevant to human and animal health, environmental management and conservation.

Description: The term linkeropathies (LKs) refers to a group of rare heritable connective tissue disorders, characterized by a variable degree of short stature, skeletal dysplasia, joint laxity, cutaneous anomalies, dysmorphism, heart malformation, and developmental delay. The LK genes encode for enzymes that add glycosaminoglycan chains onto proteoglycans via a common tetrasaccharide linker region. Biallelic variants in XYLT1 and XYLT2, encoding xylosyltransferases, are associated with Desbuquois dysplasia type 2 and spondylo-ocular syndrome, respectively. Defects in B4GALT7 and B3GALT6, encoding galactosyltransferases, lead to spondylodysplastic Ehlers-Danlos syndrome (spEDS). Mutations in B3GAT3, encoding a glucuronyltransferase, were described in 25 patients from 12 families with variable phenotypes resembling Larsen, Antley-Bixler, Shprintzen-Goldberg, and Geroderma osteodysplastica syndromes. Herein, we report on a 13-year-old girl with a clinical presentation suggestive of spEDS, according to the 2017 EDS nosology, in whom compound heterozygosity for two B3GAT3 likely pathogenic variants was identified. We review the spectrum of B3GAT3-related disorders and provide a comparison of all LK patients reported up to now, highlighting that LKs are a phenotypic continuum bridging EDS and skeletal disorders, hence offering future nosologic perspectives.

Description: Research on longevity and healthy aging promises to increase our lifespan and decrease the burden of degenerative diseases with important social and economic effects. Many aging theories have been proposed, and important aging pathways have been discovered. Model organisms have had a crucial role in this process because of their short lifespan, cheap maintenance, and manipulation possibilities. Yeasts, worms, fruit flies, or mammalian models such as mice, monkeys, and recently, dogs, have helped shed light on aging processes. Genes and molecular mechanisms that were found to be critical in simple eukaryotic cells and species have been confirmed in humans mainly by the functional analysis of mammalian orthologues. Here, we review conserved aging mechanisms discovered in different model systems that are implicated in human longevity as well and that could be the target of anti-aging interventions in human.

Description: Symmetrical lupoid onychodystrophy (SLO) is characterized by inflammation of the nail bed and nail sloughing that causes affected dogs considerable pain. Disease etiology remains unclear, although an autoimmune component is suspected. A genome-wide association study on Bearded Collies revealed regions of association on canine chromosomes (CFA) 12 and 17. The large region of association on CFA12 likely consists of two smaller linked regions, both of which are also linked to the dog leukocyte antigen (DLA) class II genes. Dogs homozygous for the alternate allele at the top CFA12 SNP also carried two DLA class II risk haplotypes for SLO, and this locus explained most of the increased risk for disease seen throughout the CFA12 region of association. A stronger peak was seen on CFA17 when analysis was done solely on dogs that carried DLA class II risk haplotypes for SLO. The majority of SLO dogs carried a homozygous alternate genotype on CFA12 and at least one CFA17 risk haplotype. Our findings offer progress toward uncovering the genetic basis of SLO. While the contribution of the CFA17 region remains unclear, both CFA12 and CFA17 regions are significantly associated with SLO disease expression in the Bearded Collie and contain potential candidate genes for this disease.

Description: In 1990 in Griswold, Connecticut, archaeologists excavated a burial found in a “skull and crossbones” orientation. The lid of the 19th century coffin had brass tacks that spelled “JB55”, the initials of the person lying there and age at death. JB55 had evidence of chronic pulmonary infection, perhaps tuberculosis. It is possible that JB55 was deemed a vampire due to his disease, and therefore had to be “killed” by mutilating his corpse. In an attempt to reveal the identity of JB55, DNA testing was performed. Ancestry informative single nucleotide polymorphism (SNP) analysis using the Precision ID Ancestry Panel indicated European ancestry. A full Y-chromosomal short tandem repeat (Y-STR) profile was obtained, belonging to haplogroup R1b. When the Y-STR profile was searched in the publicly accessible FamilyTreeDNA R1b Project website, the two closest matches had the surname “Barber”. A search of historical records led to a death notice mentioning John Barber, whose son Nathan Barber was buried in Griswold in 1826. The description of Nathan Barber closely fits the burial of “NB13,” found near JB55. By applying modern forensic DNA tools to a historical mystery, the identity of JB55 as John Barber, the 19th century Connecticut vampire, has been revealed.

Description: Neurofibromatosis type 1 (NF1) is an autosomal dominant disease with complete penetrance but high variable expressivity. NF1 is caused by loss-of-function mutations in the NF1 gene, a negative regulator of the RAS-MAPK pathway. The NF1 gene has one of the highest mutation rates in human disorders, which may explain the outbreak of independent de novo variants in the same family. Here, we report the co-occurrence of pathogenic variants in the NF1 and SPRED1 genes in six families with NF1 and Legius syndrome, using next-generation sequencing. In five of these families, we observed the co-occurrence of two independent NF1 variants. All NF1 variants were classified as pathogenic, according to the American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG-AMP) guidelines. In the sixth family, one sibling inherited a complete deletion of the NF1 gene from her mother and carried a variant of unknown significance in the SPRED1 gene. This variant was also present in her brother, who was diagnosed with Legius syndrome, a differential diagnosis of NF1. This work illustrates the complexity of molecular diagnosis in a not-so-rare genetic disease.

Description: Recently, we reported a novel therapeutic probiotic-derived protein, p8, which has anti-colorectal cancer (anti-CRC) properties. In vitro experiments using a CRC cell line (DLD-1), anti-proliferation activity (about 20%) did not improve after increasing the dose of recombinant-p8 (r-p8) to 〉10 μM. Here, we show that this was due to the low penetrative efficiency of r-p8 exogenous treatment. Furthermore, we found that r-p8 entered the cytosol through endocytosis, which might be a reason for the low penetration efficiency. Therefore, to improve the therapeutic efficacy of p8, we tried to improve delivery to CRC cells. This resulted in endogenous expression of p8 and increased the anti-proliferative effects by up to 2-fold compared with the exogenous treatment (40 μM). Anti-migration activity also increased markedly. Furthermore, we found that the anti-proliferation activity of p8 was mediated by inhibition of the p53-p21-Cyclin B1/Cdk1 signal pathway, resulting in growth arrest at the G2 phase of the cell cycle. Taken together, these results suggest that p8 is toxic to cancer cells, shows stable expression within cells, and shows strong cancer suppressive activity by inducing cell cycle arrest. Therefore, p8 is a strong candidate for gene therapy if it can be loaded onto cancer-specific viruses.

Description: Circadian rhythms are biological rhythms with a period of approximately 24 h. While canonical circadian clock genes and their regulatory mechanisms appear highly conserved, the evolution of clock gene families is still unclear due to several rounds of whole genome duplication in vertebrates. The spotted gar (Lepisosteus oculatus), as a non-teleost ray-finned fish, represents a fish lineage that diverged before the teleost genome duplication (TGD), providing an outgroup for exploring the evolutionary mechanisms of circadian clocks after whole-genome duplication. In this study, we interrogated the spotted gar draft genome sequences and found that spotted gar contains 26 circadian clock genes from 11 families. Phylogenetic analysis showed that 9 of these 11 spotted gar circadian clock gene families have the same number of genes as humans, while the members of the nfil3 and cry families are different between spotted gar and humans. Using phylogenetic and syntenic analyses, we found that nfil3-1 is conserved in vertebrates, while nfil3-2 and nfil3-3 are maintained in spotted gar, teleost fish, amphibians, and reptiles, but not in mammals. Following the two-round vertebrate genome duplication (VGD), spotted gar retained cry1a, cry1b, and cry2, and cry3 is retained in spotted gar, teleost fish, turtles, and birds, but not in mammals. We hypothesize that duplication of core clock genes, such as (nfil3 and cry), likely facilitated diversification of circadian regulatory mechanisms in teleost fish. We also found that the transcription factor binding element (Ahr::Arnt) is retained only in one of the per1 or per2 duplicated paralogs derived from the TGD in the teleost fish, implicating possible subfuctionalization cases. Together, these findings help decipher the repertoires of the spotted gar’s circadian system and shed light on how the vertebrate circadian clock systems have evolved.

Description: Cryptomeria fortunei, also known as the Chinese cedar, is an important timber species in southern China. The primary component of its woody tissues is lignin, mainly present in secondary cell walls. Therefore, continuous lignin synthesis is crucial for wood formation. In this study, we aimed to discover key genes involved in lignin synthesis expressed in the vascular cambium of C. fortunei. Through transcriptome sequencing, we detected expression of two genes, 4CL and CCoAOMT, known to be homologous to enzymes involved in the lignin synthesis pathway. We studied the function of these genes through bioinformatics analysis, cloning, vascular cambium expression analysis, and transgenic cross-species functional validation studies. Our results show that Cf4CL and CfCCoAOMT do indeed function in the pathway of lignin synthesis and likely perform this function in C. fortunei. They are prime candidates for future (gene-editing) studies aimed at optimizing C. fortunei wood production.

Description: The epithelium represents the first and most extensive line of defence against pathogens, toxins and pollutant agents in humans. In general, pathogens have developed strategies to overcome this barrier and use it as an entrance to the organism. Entamoeba histolytica, Naegleria fowleri and Acanthamoeba spp. are amoebae mainly responsible for intestinal dysentery, meningoencephalitis and keratitis, respectively. These amoebae cause significant morbidity and mortality rates. Thus, the identification, characterization and validation of molecules participating in host-parasite interactions can provide attractive targets to timely intervene disease progress. In this work, we present a compendium of the parasite adhesins, lectins, proteases, hydrolases, kinases, and others, that participate in key pathogenic events. Special focus is made for the analysis of assorted molecules and mechanisms involved in the interaction of the parasites with epithelial surface receptors, changes in epithelial junctional markers, implications on the barrier function, among others. This review allows the assessment of initial host-pathogen interaction, to correlate it to the potential of parasite invasion.

Description: Retinol binding protein 4 (RBP4), mainly secreted by the liver and adipocytes, is a transporter of vitamin A. RBP4 has been shown to be involved in several pathophysiological processes, such as obesity, insulin resistance, and cardiovascular risk. Reports have indicated the high expression levels of RBP4 in cystic follicles. However, the role of RBP4 in mammalian follicular granulosa cells (GCs) remains largely unknown. To illustrate the molecular pathways associated with the effects of RBP4 on GCs, we used high-throughput sequencing to detect differential gene expression in GCs overexpressing RBP4. A total of 113 differentially expressed genes (DEGs) were identified in RBP4-overexpressing GCs, and they included 71 upregulated and 42 downregulated genes. The differential expressions of the top 10 DEGs were further confirmed by real-time quantitative polymerase chain reaction. Pathway analysis indicated that the DEGs are mostly involved in oxidative phosphorylation, Parkinson’s disease, non-alcoholic fatty liver disease, Huntington’s disease, cardiac muscle contraction, Alzheimer’s disease, fatty acid biosynthesis, AMP-activated protein kinase signaling pathway, and insulin signaling pathway. Genes in these pathways should be useful for future studies on GCs. Altogether, the results of our study establish a framework for understanding the potential functions of RBP4 in porcine GCs.

Description: Potassium (K) is one of the most important mineral nutrients for wheat. In this study, the effects of low K (LK) treatments and the quantitative trait loci (QTLs) for K, calcium (Ca), and magnesium (Mg) use efficiency traits, both at the seedling and maturity stages of wheat, were investigated. The set of “Tainong 18 × Linmai 6” recombinant inbred lines (RILs) were used to identify the QTLs under different K treatments using hydroponic culture and field trials. The majority of K concentrations and content-related traits at seedling and maturity stages decreased with reduced K supply, but the K use efficiency-related traits increased. In contrast, with reduced K supply, the contents of Ca and Mg increased, while the Ca and Mg use efficiency decreased. A total of 217 QTLs for seedling traits and 89 QTLs for adult traits were detected. Four relatively high-frequency QTLs (RHF-QTLs) and 18 QTL clusters (colocation of QTLs for more than two traits) were detected. Eight clusters were detected for K-, Ca-, and Mg-related traits simultaneously. This means that these traits might be controlled by the same QTL. In addition, we highlight that 4B might be an important chromosome regulating the nutrition of K, Ca, and Mg in wheat. The 4B chromosome and four hot QTL clusters, which located 45 QTLs, might be important potential targets for further investigation.

Description: Identifying associations between lncRNAs and diseases can help understand disease-related lncRNAs and facilitate disease diagnosis and treatment. The dual-network integrated logistic matrix factorization (DNILMF) model has been used for drug–target interaction prediction, and good results have been achieved. We firstly applied DNILMF to lncRNA–disease association prediction (DNILMF-LDA). We combined different similarity kernel matrices of lncRNAs and diseases by using nonlinear fusion to extract the most important information in fused matrices. Then, lncRNA–disease association networks and similarity networks were built simultaneously. Finally, the Gaussian process mutual information (GP-MI) algorithm of Bayesian optimization was adopted to optimize the model parameters. The 10-fold cross-validation result showed that the area under receiving operating characteristic (ROC) curve (AUC) value of DNILMF-LDA was 0.9202, and the area under precision-recall (PR) curve (AUPR) was 0.5610. Compared with LRLSLDA, SIMCLDA, BiwalkLDA, and TPGLDA, the AUC value of our method increased by 38.81%, 13.07%, 8.35%, and 6.75%, respectively. The AUPR value of our method increased by 52.66%, 40.05%, 37.01%, and 44.25%. These results indicate that DNILMF-LDA is an effective method for predicting the associations between lncRNAs and diseases.

Description: We reported changes in the co-regulated mRNA expression in iron walnut (Juglans sigillata) in response to soil pH treatments and identified mRNAs specific to acidic soil conditions. Phenotypic and physiological analyses revealed that iron walnut growth was greater for the pH 4–5 and pH 5–6 treatments than for the pH 3–4 and pH 6–7 treatments. A total of 2768 differentially expressed genes were detected and categorized into 12 clusters by Short Time-series Expression Miner (STEM). The 994 low-expression genes in cluster III and 255 high-expression genes in cluster X were classified as acid-responsive genes on the basis of the relationships between phenotype, physiology, and STEM clustering, and the two gene clusters were analyzed by a maximum likelihood (ML) evolutionary tree with the greatest log likelihood values. No prominent sub-clusters occurred in cluster III, but three occurred in cluster X. The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis indicated that acid-responsive genes were related primarily to arginine biosynthesis and the arginine/proline metabolism pathway, implying that polyamine accumulation may enhance iron walnut acid stress tolerance. Overall, our results revealed 1249 potentially acid-responsive genes in iron walnut, indicating that its response to acid stress involves different pathways and activated genes.

Description: Prostate cancer is the fifth leading cause of male cancer death worldwide. Although docetaxel chemotherapy has been used for more than fifteen years to treat metastatic castration resistant prostate cancer, the high inter-individual variability of treatment efficacy and toxicity is still not well understood. Since prostate cancer has a high heritability, inherited biomarkers of the genomic signature may be appropriate tools to guide treatment. In this review, we provide an extensive overview and discuss the current state of the art of pharmacogenomic biomarkers modulating docetaxel treatment of prostate cancer. This includes (1) research studies with a focus on germline genomic biomarkers, (2) clinical trials including a range of genetic signatures, and (3) their implementation in treatment guidelines. Based on this work, we suggest that one of the most promising approaches to improve clinical predictive capacity of pharmacogenomic biomarkers in docetaxel treatment of prostate cancer is the use of compound, multigene pharmacogenomic panels defined by specific clinical outcome measures. In conclusion, we discuss the challenges of integrating prostate cancer pharmacogenomic biomarkers into the clinic and the strategies that can be employed to allow a more comprehensive, evidence-based approach to facilitate their clinical integration. Expanding the integration of pharmacogenetic markers in prostate cancer treatment procedures will enhance precision medicine and ultimately improve patient outcomes.

Description: Amaryllidaceae alkaloids (AAs) have multiple biological effects, which are of interest to the pharmaceutical industry. To unleash the potential of Amaryllidaceae plants as pharmaceutical crops and as sources of AAs, a thorough understanding of the AA biosynthetic pathway is needed. However, only few enzymes in the pathway are known. Here, we report the transcriptome of AA-producing paperwhites (Narcissus papyraceus Ker Gawl). We present a list of 21 genes putatively encoding enzymes involved in AA biosynthesis. Next, a cDNA library was created from 24 different samples of different parts at various developmental stages of N. papyraceus. The expression of AA biosynthetic genes was analyzed in each sample using RT-qPCR. In addition, the alkaloid content of each sample was analyzed by HPLC. Leaves and flowers were found to have the highest abundance of heterocyclic compounds, whereas the bulb, the lowest. Lycorine was also the predominant AA. The gene expression results were compared with the heterocyclic compound profiles for each sample. In some samples, a positive correlation was observed between the gene expression levels and the amount of compounds accumulated. However, due to a probable transport of enzymes and alkaloids in the plant, a negative correlation was also observed, particularly at stage 2.

Description: Plant growth responds to various environmental and developmental cues via signaling cascades that influence gene expression at the level of transcription and pre-mRNA splicing. Alternative splicing of pre-mRNA increases the coding potential of the genome from multiexon genes and regulates gene expression through multiple mechanisms. Serine/arginine-rich (SR) proteins, a conserved family of splicing factors, are the key players of alternative splicing and regulate pre-mRNA splicing under stress conditions. The rice (Oryza sativa) genome encodes 22 SR proteins categorized into six subfamilies. Three of the subfamilies are plant-specific with no mammalian orthologues, and the functions of these SR proteins are not well known. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is a genome engineering tool that cleaves the target DNA at specific locations directed by a guide RNA (gRNA). Recent advances in CRISPR/Cas9-mediated plant genome engineering make it possible to generate single and multiple functional knockout mutants in diverse plant species. In this study, we targeted each rice SR locus and produced single knockouts. To overcome the functional redundancy within each subfamily of SR genes, we utilized a polycistronic tRNA-gRNA multiplex targeting system and targeted all loci of each subfamily. Sanger sequencing results indicated that most of the targeted loci had knockout mutations. This study provides useful resource materials for understanding the molecular role of SR proteins in plant development and biotic and abiotic stress responses.

Description: Whole-genome sequences of four EMS (ethyl methanesulfonate)-induced eggplant mutants were analyzed to identify genome-wide mutations. In total, 173.01 GB of paired-end reads were obtained for four EMS-induced mutants and (WT) wild type and 1,076,010 SNPs (single nucleotide polymorphisms) and 183,421 indels were identified. The most common mutation type was C/G to T/A transitions followed by A/T to G/C transitions. The mean densities were one SNP per 1.3 to 2.6 Mb. The effect of mutations on gene function was annotated and only 7.2% were determined to be deleterious. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis showed 10 and 11 genes, which were nonsynonymous mutation or frameshift deletion in 48-5 and L6-5 involved in the anthocyanin biosynthesis or flavone and flavonol biosynthesis. QRT-PCR results showed that only the Sme2.5_06210.1_g00004.1, which was annotated as UFGT (Flavonoid galactosidase transferase), expression significantly decreased in the L6-5 mutant compared with the WT. Also, the Sme2.5_06210.1_g00004.1 expression was lower in the colorless eggplant compared with colorful eggplant in the natural eggplant cultivar. These results suggest that Sme2.5_06210.1_g00004.1 may play a key role in eggplant anthocyanin synthesis.

Description: Oilseed rape (Brassica napus) is the second largest oilseed crop worldwide. As an architecture component of B. napus, thickness of pod canopy (TPC) plays an important role in yield formation, especially under high-density cultivation conditions. However, the mechanisms underlying the regulation of TPC remain unclear. RNA and microRNA (miRNA) profiling of two groups of B. napus lines with significantly different TPC at the bolting with a tiny bud stage revealed differential expressions of numerous genes involved in nitrogen-related pathways. Expression of several nitrogen-related response genes, including ASP5, ASP2, ASN3, ATCYSC1, PAL2, APT2, CRTISO, and COX15, was dramatically changed in the thick TPC lines compared to those in the thin TPC lines. Differentially expressed miRNAs also included many involved in nitrogen-related pathways. Expression of most target genes was negatively associated with corresponding miRNAs, such as miR159, miR6029, and miR827. In addition, 12 (including miR319, miR845, and miR158) differentially expressed miRNAs between two plant tissues sampled (stem apex and flower bud) were identified, implying that they might have roles in determining overall plant architecture. These results suggest that nitrogen signaling may play a pivotal role in regulating TPC in B. napus.

Description: In this study, we analyzed the effects of breed, diet energy source, and their interaction on adipose tissue transcriptome in growing Iberian and Duroc pigs. The study comprised 29 Iberian and 19 Duroc males, which were kept under identical management conditions except the nutritional treatment. Two isoenergetic diets were used with 6% high oleic sunflower oil (HO) or carbohydrates (CH) as energy sources. All animals were slaughtered after 47 days of treatment at an average live weight of 51.2 kg. Twelve animals from each breed (six fed each diet) were employed for ham subcutaneous adipose tissue RNA-Seq analysis. The data analysis was performed using two different bioinformatic pipelines. We detected 837 and 1456 differentially expressed genes (DEGs) according to breed, depending on the pipeline. Due to the strong effect of breed on transcriptome, the effect of the diet was separately evaluated in the two breeds. We identified 207 and 57 DEGs depending on diet in Iberian and Duroc pigs, respectively. A joint analysis of both effects allowed the detection of some breed–diet interactions on transcriptome, which were inferred from RNA-Seq and quantitative PCR data. The functional analysis showed the enrichment of functions related to growth and tissue development, inflammatory response, immune cell trafficking, and carbohydrate and lipid metabolism, and allowed the identification of potential regulators. The results indicate different effects of diet on adipose tissue gene expression between breeds, affecting relevant biological pathways.

Description: Alternative splicing (AS) is the process of combining different parts of the pre-mRNA to produce diverse transcripts and eventually different protein products from a single gene. In computational biology field, researchers try to understand AS behavior and regulation using computational models known as “Splicing Codes”. The final goal of these algorithms is to make an in-silico prediction of AS outcome from genomic sequence. Here, we develop a deep learning approach, called Deep Splicing Code (DSC), for categorizing the well-studied classes of AS namely alternatively skipped exons, alternative 5’ss, alternative 3’ss, and constitutively spliced exons based only on the sequence of the exon junctions. The proposed approach significantly improves the prediction and the obtained results reveal that constitutive exons have distinguishable local characteristics from alternatively spliced exons. Using the motif visualization technique, we show that the trained models learned to search for competitive alternative splice sites as well as motifs of important splicing factors with high precision. Thus, the proposed approach greatly expands the opportunities to improve alternative splicing modeling. In addition, a web-server for AS events prediction has been developed based on the proposed method.

Description: The MEF2 (myocyte enhancer factor 2) family belongs to the MADS-box superfamily of eukaryotic transcription factors. The vertebrate genes compose four distinct subfamilies designated MEF2A, -B, -C, and -D. There are multiple mef2 genes in the common carp (Cyprinus carpio). So far, the embryonic expression patterns of these genes and the evolution of fish mef2 genes have been barely investigated. In this study, we completed the coding information of C. carpio mef2ca2 and mef2d1 genes via gene cloning and presented two mosaic mef2 sequences as evidence for recombination. We also analyzed the phylogenetic relationship and conserved synteny of mef2 genes and proposed a new evolutionary scenario. In our version, MEF2B and the other three vertebrate subfamilies were generated in parallel from the single last ancestor via two rounds of whole genome duplication events that occurred at the dawn of vertebrates. Moreover, we examined the expression patterns of C. carpio mef2 genes during embryogenesis, by using whole-mount in situ hybridization, and found the notochord to be a new expression site for these genes except for mef2ca1&2. Our results thus provide new insights into the evolution and expression of mef2 genes.

Description: The incidence of thyroid cancer (TC), particularly well-differentiated forms (DTC), has been rising and remains the highest among endocrine malignancies. Although ionizing radiation (IR) is well established on DTC aetiology, other environmental and genetic factors may also be involved. DNA repair single nucleotide polymorphisms (SNPs) could be among the former, helping in explaining the high incidence. To further clarify the role of DNA repair SNPs in DTC susceptibility, we analyzed 36 SNPs in 27 DNA repair genes in a population of 106 DTCs and corresponding controls with the aim of interpreting joint data from previously studied isolated SNPs in DNA repair genes. Significant associations with DTC susceptibility were observed for XRCC3 rs861539, XPC rs2228001, CCNH rs2230641, MSH6 rs1042821 and ERCC5 rs2227869 and for a haplotype block on chromosome 5q. From 595 SNP-SNP combinations tested and 114 showing relevance, 15 significant SNP combinations (p 〈 0.01) were detected on paired SNP analysis, most of which involving CCNH rs2230641 and mismatch repair variants. Overall, a gene-dosage effect between the number of risk genotypes and DTC predisposition was observed. In spite of the volume of data presented, new studies are sought to provide an interpretability of the role of SNPs in DNA repair genes and their combinations in DTC susceptibility.

Description: Background: Tumor-infiltrating leukocytes (TILs) are immune cells surrounding tumor cells, and several studies have shown that TILs are potential survival predictors in different cancers. However, few studies have dissected the differences between hepatitis B- and hepatitis C-related hepatocellular carcinoma (HBV−HCC and HCV−HCC). Therefore, we aimed to determine whether the abundance and composition of TILs are potential predictors for survival outcomes in HCC and which TILs are the most significant predictors. Methods: Two bioinformatics algorithms, ESTIMATE and CIBERSORT, were utilized to analyze the gene expression profiles from 6 datasets, from which the abundance of corresponding TILs was inferred. The ESTIMATE algorithm examined the overall abundance of TILs, whereas the CIBERSORT algorithm reported the relative abundance of 22 different TILs. Both HBV−HCC and HCV−HCC were analyzed. Results: The results indicated that the total abundance of TILs was higher in non-tumor tissue regardless of the HCC type. Alternatively, the specific TILs associated with overall survival (OS) and recurrence-free survival (RFS) varied between subtypes. For example, in HBV−HCC, plasma cells (hazard ratio [HR] = 1.05; 95% CI 1.00–1.10; p = 0.034) and activated dendritic cells (HR = 1.08; 95% CI 1.01–1.17; p = 0.03) were significantly associated with OS, whereas in HCV−HCC, monocytes (HR = 1.21) were significantly associated with OS. Furthermore, for RFS, CD8+ T cells (HR = 0.98) and M0 macrophages (HR = 1.02) were potential biomarkers in HBV−HCC, whereas neutrophils (HR = 1.01) were an independent predictor in HCV−HCC. Lastly, in both HBV−HCC and HCV−HCC, CD8+ T cells (HR = 0.97) and activated dendritic cells (HR = 1.09) had a significant association with OS, while γ delta T cells (HR = 1.04), monocytes (HR = 1.05), M0 macrophages (HR = 1.04), M1 macrophages (HR = 1.02), and activated dendritic cells (HR = 1.15) were highly associated with RFS. Conclusions: These findings demonstrated that TILs are potential survival predictors in HCC and different kinds of TILs are observed according to the virus type. Therefore, further investigations are warranted to elucidate the role of TILs in HCC, which may improve immunotherapy outcomes.

Description: Background: It has been suggested that microRNAs (miRNAs; short non-protein-coding RNA molecules that mediate post-transcriptional regulation), including mir-9 and mir-34 families, are important for brain development. Current data suggest that mir-9 and mir-34 may have shared effects across psychiatric disorders. This study aims to explore the role of genetic polymorphisms in the MIR9-2 (rs4916723) and MIR34B/C (rs4938723) genes on the susceptibility of psychiatric disorders in children from the 2004 Pelotas Birth Cohort. Methods: Psychiatric disorders were assessed in 3585 individuals using Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV), criteria through the application of standard semi-structured interviews (using the Development and Well-Being Assessment, DAWBA) at the six-years-of-age follow-up. The outcome was defined as the presence of any mental disorder. We also considered two broad groups of internalizing and externalizing disorders to further investigate the role of these variants in mental health. Results: We observed an association between rs4916723 (MIR9-2) and the presence of any psychiatric disorder (odds ratios (OR) = 0.820; 95% CI = 0.7130–0.944; p = 0.006) and a suggestive effect on internalizing disorders (OR = 0.830; 95% CI = 0.698–0.987; p = 0.035). rs4938723 (MIR34B/C) was not associated with any evaluated outcome. Conclusion: The study suggests that MIR9-2 may have an important role on a broad susceptibility for psychiatric disorders and may be important mainly for internalization problems.

Description: The recent advances in DNA sequencing technology are enabling a rapid increase in the number of genomes being sequenced. However, many fundamental questions in genome biology remain unanswered, because sequence data alone is unable to provide insight into how the genome is organised into chromosomes, the position and interaction of those chromosomes in the cell, and how chromosomes and their interactions with each other change in response to environmental stimuli or over time. The intimate relationship between DNA sequence and chromosome structure and function highlights the need to integrate genomic and cytogenetic data to more comprehensively understand the role genome architecture plays in genome plasticity. We propose adoption of the term ‘chromosomics’ as an approach encompassing genome sequencing, cytogenetics and cell biology, and present examples of where chromosomics has already led to novel discoveries, such as the sex-determining gene in eutherian mammals. More importantly, we look to the future and the questions that could be answered as we enter into the chromosomics revolution, such as the role of chromosome rearrangements in speciation and the role more rapidly evolving regions of the genome, like centromeres, play in genome plasticity. However, for chromosomics to reach its full potential, we need to address several challenges, particularly the training of a new generation of cytogeneticists, and the commitment to a closer union among the research areas of genomics, cytogenetics, cell biology and bioinformatics. Overcoming these challenges will lead to ground-breaking discoveries in understanding genome evolution and function.

Description: The Estonian Native Horse (ENH) is a medium-size pony found mainly in the western islands of Estonia and is well-adapted to the harsh northern climate and poor pastures. The ancestry of the ENH is debated, including alleged claims about direct descendance from the extinct Tarpan. Here we conducted a detailed analysis of the genetic makeup and relationships of the ENH based on the genotypes of 15 autosomal short tandem repeats (STRs), 18 Y chromosomal single nucleotide polymorphisms (SNPs), mitochondrial D-loop sequence and lateral gait allele in DMRT3. The study encompassed 2890 horses of 61 breeds, including 33 ENHs. We show that the expected and observed genetic diversities of the ENH are among the highest within 52 global breeds, and the highest among 8 related Northern European ponies. The genetically closest breeds to the ENH are the Finn Horse, and the geographically more distant primitive Hucul and Konik. ENH matrilines are diverse and relate to draught and Pontic-Caspian breeds. ENH patrilines relate to draught breeds, and to a unique haplogroup not described before. None of the 33 ENHs carried the “gait” mutation, but the mutation was found in 2 Huculs. The study demonstrates that the ENH is a genetically distinct and diverse breed of ancient origin with no notable pressure of selective breeding.

Description: The chicken is a common type of poultry that is economically important both for its medicinal and nutritional values. Previous studies have found that free-range chickens have more skeletal muscle mass. The methyltransferase-like 21C gene (METTL21C) plays an important role in muscle development; however, there have been few reports on the role of METTL21C in chickens. In this study, we performed a genome-wide identification of chicken METTL21C genes and analyzed their phylogeny, transcriptional expression profile, and real-time quantitative polymerase chain reaction (qPCR). We identified 10 GgMETTL21C genes from chickens, 11 from mice, and 32 from humans, and these genes were divided into six groups, which showed a large amount of variation among these three species. A total of 15 motifs were detected in METTL21C genes, and the intron phase of the gene structure showed that the METTL21C gene family was conservative in evolution. Further, both the transcript data and qPCR showed that a single gene’s (GgMETTL21C3) expression level increased with the muscle development of chickens, indicating that the METTL21C genes are involved in the development of chicken muscles. Our results provide some reference value for the subsequent study of the function of METTL21C.

Description: Rapid advance in single-cell RNA sequencing (scRNA-seq) allows measurement of the expression of genes at single-cell resolution in complex disease or tissue. While many methods have been developed to detect cell clusters from the scRNA-seq data, this task currently remains a main challenge. We proposed a multi-objective optimization-based fuzzy clustering approach for detecting cell clusters from scRNA-seq data. First, we conducted initial filtering and SCnorm normalization. We considered various case studies by selecting different cluster numbers ( c l = 2 to a user-defined number), and applied fuzzy c-means clustering algorithm individually. From each case, we evaluated the scores of four cluster validity index measures, Partition Entropy ( P E ), Partition Coefficient ( P C ), Modified Partition Coefficient ( M P C ), and Fuzzy Silhouette Index ( F S I ). Next, we set the first measure as minimization objective (↓) and the remaining three as maximization objectives (↑), and then applied a multi-objective decision-making technique, TOPSIS, to identify the best optimal solution. The best optimal solution (case study) that had the highest TOPSIS score was selected as the final optimal clustering. Finally, we obtained differentially expressed genes (DEGs) using Limma through the comparison of expression of the samples between each resultant cluster and the remaining clusters. We applied our approach to a scRNA-seq dataset for the rare intestinal cell type in mice [GEO ID: GSE62270, 23,630 features (genes) and 288 cells]. The optimal cluster result (TOPSIS optimal score= 0.858) comprised two clusters, one with 115 cells and the other 91 cells. The evaluated scores of the four cluster validity indices, F S I , P E , P C , and M P C for the optimized fuzzy clustering were 0.482, 0.578, 0.607, and 0.215, respectively. The Limma analysis identified 1240 DEGs (cluster 1 vs. cluster 2). The top ten gene markers were Rps21, Slc5a1, Crip1, Rpl15, Rpl3, Rpl27a, Khk, Rps3a1, Aldob and Rps17. In this list, Khk (encoding ketohexokinase) is a novel marker for the rare intestinal cell type. In summary, this method is useful to detect cell clusters from scRNA-seq data.

Description: Salt stress is a major constraint for many crops and trees. A wild species of Goji named Lycium ruthenicum is an important economic halophyte in China and has an extremely high tolerance to salinity. L. ruthenicum grows in saline soil and is known as a potash-rich species. However, its salt adaptation strategies and ion balance mechanism remains poorly understood. Potassium (K+) is one of the essential macronutrients for plant growth and development. In this study, a putative salt stress-responsive gene encoding a HAK (high-affinity K+)/KUP (K+ uptake)/KT (K+ transporter) transporter was cloned and designated as LrKUP8. This gene belongs to the cluster II group of the KT/HAK/KUP family. The expression of LrKUP8 was strongly induced under high NaCl concentrations. The OE-LrKUP8 calli grew significantly better than the vector control calli under salt stress conditions. Further estimation by ion content and micro-electrode ion flux indicated a relative weaker K+ efflux in the OE-LrKUP8 calli than in the control. Thus, a key gene involved in K+ uptake under salt condition was functionally characterized using a newly established L. ruthenicum callus transformation system. The importance of K+ regulation in L. ruthenicum under salt tolerance was highlighted.

Description: Insect bite hypersensitivity (IBH), which is a cutaneous allergic reaction to antigens from Culicoides spp., is the most prevalent skin disorder in horses. Misdiagnosis is possible, as IBH is usually diagnosed based on clinical signs. Our study is the first to employ IgE levels against several recombinant Culicoides spp. allergens as an objective, independent, and quantitative phenotype to improve the power to detect genetic variants that underlie IBH. Genotypes of 200 Shetland ponies, 127 Icelandic horses, and 223 Belgian Warmblood horses were analyzed while using a mixed model approach. No single-nucleotide polymorphism (SNP) passed the Bonferroni corrected significance threshold, but several regions were identified within and across breeds, which confirmed previously identified regions of interest and, in addition, identifying new regions of interest. Allergen-specific IgE levels are a continuous and objective phenotype that allow for more powerful analyses when compared to a case-control set-up, as more significant associations were obtained. However, the use of a higher density array seems necessary to fully employ the use of IgE levels as a phenotype. While these results still require validation in a large independent dataset, the use of allergen-specific IgE levels showed value as an objective and continuous phenotype that can deepen our understanding of the biology underlying IBH.

Description: Recent developments in our understanding of the interactions between long non-coding RNAs (lncRNAs) and cellular components have improved treatment approaches for various human diseases including cancer, vascular diseases, and neurological diseases. Although investigation of specific lncRNAs revealed their role in the metabolism of cellular RNA, our understanding of their contribution to post-transcriptional regulation is relatively limited. In this study, we explore the role of lncRNAs in modulating alternative splicing and their impact on downstream protein–RNA interaction networks. Analysis of alternative splicing events across 39 lncRNA knockdown and wildtype RNA-sequencing datasets from three human cell lines—HeLa (cervical cancer), K562 (myeloid leukemia), and U87 (glioblastoma)—resulted in the high-confidence (false discovery rate (fdr) 〈 0.01) identification of 11,630 skipped exon events and 5895 retained intron events, implicating 759 genes to be impacted at the post-transcriptional level due to the loss of lncRNAs. We observed that a majority of the alternatively spliced genes in a lncRNA knockdown were specific to the cell type. In tandem, the functions annotated to the genes affected by alternative splicing across each lncRNA knockdown also displayed cell-type specificity. To understand the mechanism behind this cell-type-specific alternative splicing pattern, we analyzed RNA-binding protein (RBP)–RNA interaction profiles across the spliced regions in order to observe cell-type-specific alternative splice event RBP binding preference. Despite limited RBP binding data across cell lines, alternatively spliced events detected in lncRNA perturbation experiments were associated with RBPs binding in proximal intron–exon junctions in a cell-type-specific manner. The cellular functions affected by alternative splicing were also affected in a cell-type-specific manner. Based on the RBP binding profiles in HeLa and K562 cells, we hypothesize that several lncRNAs are likely to exhibit a sponge effect in disease contexts, resulting in the functional disruption of RBPs and their downstream functions. We propose that such lncRNA sponges can extensively rewire post-transcriptional gene regulatory networks by altering the protein–RNA interaction landscape in a cell-type-specific manner.

Description: Mitochondrial (mt) genomes of the sea urchins Strongylocentrotus intermedius and Mesocentrotus nudus demonstrate the identical patterns of intraspecific length variability of the ND6 gene, consisting of 489 bp (S variant) and 498 bp (L variant), respectively. For both species, the ND6 length difference is due to the 488A〉G substitution, which changes the stop codon TAG in S variant for a tryptophan codon TGG in L variant and elongates the corresponding ND6 protein by three additional amino acids, Trp-Leu-Trp. The phylogenetic analysis based on mt genomes of sea urchins and related echinoderm groups from GenBank has shown the S and L ND6 variants as shared among the camarodont sea urchins; the rest of the echinoderms demonstrate the S variant only. The data suggest that the ND6 488A〉G substitution can be the first example of the trans-species polymorphism in sea urchins, persisting at least since the time of the Odontophora diversification at the Eocene/Oligocene boundary (approximately 34 million years ago), which was characterized by an abrupt climate change and significant global ocean cooling. Alternative hypotheses, including the convergent RNA editing and/or codon reassignment, are not supported by direct comparisons of the ND6 gene sequences with the corresponding transcripts using the basic local alignment search tool (BLAST) of full sea urchin transcriptomes.

Description: Among the Lamiaceae family, the genus Thymus is an economically important genera due to its medicinal and aromatic properties. Most Thymus molecular research has focused on the determining the phylogenetic relationships between different species, but no published work has focused on the evolution of the transcriptome across the genus to elucidate genes involved in terpenoid biosynthesis. Hence, in this study, the transcriptomes of five different Thymus species were generated and analyzed to mine putative genes involved in thymol and carvacrol biosynthesis. High-throughput sequencing produced ~43 million high-quality reads per sample, which were assembled de novo using several tools, then further subjected to a quality evaluation. The best assembly for each species was used as queries to search within the UniProt, KEGG (Kyoto Encyclopedia of Genes and Genomes), COG (Clusters of Orthologous Groups) and TF (Transcription Factors) databases. Mining the transcriptomes resulted in the identification of 592 single-copy orthogroups used for phylogenetic analysis. The data showed strongly support a close genetic relationship between Thymus vulgaris and Thymus daenensis. Additionally, this study dates the speciation events between 1.5–2.1 and 9–10.2 MYA according to different methodologies. Our study provides a global overview of genes related to the terpenoid pathway in Thymus, and can help establish an understanding of the relationship that exists among Thymus species.

Description: The HOXA gene family is associated with various cancer types. However, the role of HOXA genes in acute myeloid leukemia (AML) have not been comprehensively studied. We compared the transcriptional expression, survival data, and network analysis of HOXA-associated signaling pathways in patients with AML using the ONCOMINE, GEPIA, LinkedOmics, cBioPortal, and Metascape databases. We observed that HOXA2-10 mRNA expression levels were significantly upregulated in AML and that high HOXA1-10 expression was associated with poor AML patient prognosis. The HOXA genes were altered in ~18% of the AML samples, either in terms of amplification, deep deletion, or elevated mRNA expression. The following pathways were modulated by HOXA gene upregulation: GO:0048706: embryonic skeletal system development; R-HSA-5617472: activation of HOX genes in anterior hindbrain development during early embryogenesis; GO:0060216: definitive hemopoiesis; hsa05202: transcriptional mis-regulation in cancer; and GO:0045638: negative regulation of myeloid cell differentiation, and they were significantly regulated due to alterations affecting the HOXA genes. This study identified HOXA3-10 genes as potential AML therapeutic targets and prognostic markers.

Description: The SPP1, LAP3, and LCORL are located on chromosome 6 of sheep and a domain of 36.15-38.56 Mb, which plays an essential role in tissue and embryonic growth. In this study, we cloned the complete coding sequences of SPP1 and partial coding regions of LAP3 and LCORL from Hu sheep (Gansu Province, China) and analyzed their genomic structures. The RT-qPCR showed that the three genes were expressed widely in the different tissues of Hu sheep. The SPP1 expression was significantly higher in the kidney (p 〈 0.01) and LAP3 expression was significantly higher in the spleen, lung, kidney, and duodenum than in the other tissues (heart, liver, rumen, muscle, fat, and ovary; p 〈 0.05). The LCORL was preferentially expressed in the spleen, duodenum, and lung (p 〈 0.05). In addition, the nucleotide substitution NM_001009224.1:c.132A〉C was found in SPP1; an association analysis showed that it was associated with birth weight and yearling weight (p 〈 0.05), and NM_001009224.1:c.132C was the dominant allele. Two mutations XM_012179698.3:c.232C〉G and XM_012179698.3:c.1154C〉T were identified in LAP3. The nucleotide substitution XM_012179698.3:c.232C〉G was confirmed to be associated with birth weight, 1-month weight, 3-month weight (p 〈 0.05), and 2-month weight (p 〈 0.01). The nucleotide substitution XM_012179698.3:c.1154C〉T was associated with birth weight (p 〈 0.01), 1-month weight, and 2-month weight (p 〈 0.05). The LAP3 gene XM_012179698.3:c.232C〉G mutation with the C allele has higher body weight than other sheep, and CC genotype individuals show higher birth weight, 1-month weight, and weaning weight than the GG genotype individuals (p 〈 0.05). Our results support the conclusion that the mutations on ovine SPP1 and LAP3 successfully track functional alleles that affect growth in sheep, and these genes could be used as candidate genes for improving the growth traits of sheep during breeding.

Description: Triploidy in cancer is associated with poor prognosis, but its origins remain unclear. Here, we attempted to differentiate between random chromosomal and whole-genome origins of cancer triploidy. In silico meta-analysis was performed on 15 male malignant and five benign tumor cohorts (2928 karyotypes) extracted from the Mitelman Database, comparing their ploidy and combinations of sex chromosomes. A distinct near-triploid fraction was observed in all malignant tumor types, and was especially high in seminoma. For all tumor types, X-chromosome doubling, predominantly observed as XXY, correlated strongly with the near-triploid state (r ≈ 0.9, p 〈 0.001), negatively correlated with near-diploidy, and did not correlate with near-tetraploidy. A smaller near-triploid component with a doubled X-chromosome was also present in three of the five benign tumor types, especially notable in colon adenoma. Principal component analysis revealed a non-random correlation structure shaping the X-chromosome disomy distribution across all tumor types. We suggest that doubling of the maternal genome followed by pedogamic fusion with a paternal genome (a possible mimic of the fertilization aberration, 69, XXY digyny) associated with meiotic reprogramming may be responsible for the observed rearrangements of genome complements leading to cancer triploidy. The relatively frequent loss of the Y-chromosome results as a secondary factor from chromosome instability.

Description: Hirudin and its variants, as strong inhibitors against thrombin, are present in the saliva of leeches and are recognized as potent anticoagulants. However, their yield is far from the clinical requirement up to now. In this study, the production of hirudin variant 3 (HV3) was successfully realized by cultivating the recombinant Pichia pastoris GS115/pPIC9K-hv3 under the regulation of the promoter of AOX1 encoding alcohol oxidase (AOX). The antithrombin activity in the fermentation broth reached the maximum value of 5000 ATU/mL. To explore an effective strategy for improving HV3 production in the future, we investigated the influence of methanol assimilation on the general gene expression in this recombinant by transcriptomic study. The results showed that methanol was partially oxidized into CO2, and the rest was converted into glycerone-P which subsequently entered into central carbon metabolism, energy metabolism, and amino acid biosynthesis. However, the later metabolic processes were almost all down-regulated. Therefore, we propose that the up-regulated central carbon metabolism, energy, and amino acid metabolism should be beneficial for methanol assimilation, which would accordingly improve the production of HV3.

Description: The Ehlers‒Danlos syndromes (EDS) constitute a heterogenous group of connective tissue disorders characterized by joint hypermobility, skin abnormalities, and vascular fragility. The latest nosology recognizes 13 types caused by pathogenic variants in genes encoding collagens and other molecules involved in collagen processing and extracellular matrix (ECM) biology. Classical (cEDS), vascular (vEDS), and hypermobile (hEDS) EDS are the most frequent types. cEDS and vEDS are caused respectively by defects in collagen V and collagen III, whereas the molecular basis of hEDS is unknown. For these disorders, the molecular pathology remains poorly studied. Herein, we review, expand, and compare our previous transcriptome and protein studies on dermal fibroblasts from cEDS, vEDS, and hEDS patients, offering insights and perspectives in their molecular mechanisms. These cells, though sharing a pathological ECM remodeling, show differences in the underlying pathomechanisms. In cEDS and vEDS fibroblasts, key processes such as collagen biosynthesis/processing, protein folding quality control, endoplasmic reticulum homeostasis, autophagy, and wound healing are perturbed. In hEDS cells, gene expression changes related to cell-matrix interactions, inflammatory/pain responses, and acquisition of an in vitro pro-inflammatory myofibroblast-like phenotype may contribute to the complex pathogenesis of the disorder. Finally, emerging findings from miRNA profiling of hEDS fibroblasts are discussed to add some novel biological aspects about hEDS etiopathogenesis.

Description: Global maize cultivation is often adversely affected by drought stress. The CC-type glutaredoxin (GRX) genes form a plant-specific subfamily that regulate plant growth and respond to environmental stresses. However, how maize CC-type GRX (ZmGRXCC) genes respond to drought stress remains unclear. We performed a TBLASTN search to identify ZmGRXCCs in the maize genome and verified the identified sequences using the NCBI conservative domain database (CDD). We further established a phylogenetic tree using Mega7 and surveyed known cis-elements in the promoters of ZmGRXCCs using the PlantCARE database. We found twenty-one ZmGRXCCs in the maize genome by a genome-wide investigation and compared their phylogenetic relationships with rice, maize, and Arabidopsis. The analysis of their redox active sites showed that most of the 21 ZmGRXCCs share similar structures with their homologs. We assessed their expression at young seedlings and adult leaves under drought stress and their expression profiles in 15 tissues, and found that they were differentially expressed, indicating that different ZmGRXCC genes have different functions. Notably, ZmGRXCC14 is up-regulated at seedling, V12, V14, V16, and R1 stages. Importantly, significant associations between genetic variation in ZmGRXCC14 and drought tolerance are found at the seedling stage. These results will help to advance the study of the function of ZmGRXCCs genes under drought stress and understand the mechanism of drought resistance in maize.

Description: With the advances in different biological networks including gene regulation, gene co-expression, protein–protein interaction networks, and advanced approaches for network reconstruction, analysis, and interpretation, it is possible to discover reliable and accurate molecular network-based biomarkers for monitoring cancer treatment. Such efforts will also pave the way toward the realization of biomarker-driven personalized medicine against cancer. Previously, we have reconstructed disease-specific driver signaling networks using multi-omics profiles and cancer signaling pathway data. In this study, we developed a network-based sparse Bayesian machine (NBSBM) approach, using previously derived disease-specific driver signaling networks to predict cancer cell responses to drugs. NBSBM made use of the information encoded in a disease-specific (differentially expressed) network to improve its prediction performance in problems with a reduced amount of training data and a very high-dimensional feature space. Sparsity in NBSBM is favored by a spike and slab prior distribution, which is combined with a Markov random field prior that encodes the network of feature dependencies. Gene features that are connected in the network are assumed to be both relevant and irrelevant to drug responses. We compared the proposed method with network-based support vector machine (NBSVM) approaches and found that the NBSBM approach could achieve much better accuracy than the other two NBSVM methods. The gene modules selected from the disease-specific driver networks for predicting drug sensitivity might be directly involved in drug sensitivity or resistance. This work provides a disease-specific network-based drug sensitivity prediction approach and can uncover the potential mechanisms of the action of drugs by selecting the most predictive sub-networks from the disease-specific network.

Description: The genus Pseudomonas comprises many known plant-associated microbes with plant growth promotion and disease suppression properties. Genome-based studies allow the prediction of the underlying mechanisms using genome mining tools and the analysis of the genes unique for a strain by implementing comparative genomics. Here, we provide the genome sequence of the strain Pseudomonas brassicacearum 3Re2-7, formerly known as P. trivialis and P. reactans, elucidate its revised taxonomic classification, experimentally verify the gene predictions by transcriptome sequencing, describe its genetic biocontrol potential and contextualize it to other known Pseudomonas biocontrol agents. The P. brassicacearum 3Re2-7 genome comprises a circular chromosome with a size of 6,738,544 bp and a GC-content of 60.83%. 6267 genes were annotated, of which 6113 were shown to be transcribed in rich medium and/or in the presence of Rhizoctonia solani. Genome mining identified genes related to biocontrol traits such as secondary metabolite and siderophore biosynthesis, plant growth promotion, inorganic phosphate solubilization, biosynthesis of lipo- and exopolysaccharides, exoproteases, volatiles and detoxification. Core genome analysis revealed, that the 3Re2-7 genome exhibits a high collinearity with the representative genome for the species, P. brassicacearum subsp. brassicacearum NFM421. Comparative genomics allowed the identification of 105 specific genes and revealed gene clusters that might encode specialized biocontrol mechanisms of strain 3Re2-7. Moreover, we captured the transcriptome of P. brassicacearum 3Re2-7, confirming the transcription of the predicted biocontrol-related genes. The gene clusters coding for 2,4-diacetylphloroglucinol (phlABCDEFGH) and hydrogen cyanide (hcnABC) were shown to be highly transcribed. Further genes predicted to encode putative alginate production enzymes, a pyrroloquinoline quinone precursor peptide PqqA and a matrixin family metalloprotease were also found to be highly transcribed. With this study, we provide a basis to further characterize the mechanisms for biocontrol in Pseudomonas species, towards a sustainable and safe application of P. brassicacearum biocontrol agents.

Description: A dose of proanthocyanidins with satiating properties proved to be able to limit body weight increase several weeks after administration under exposure to a cafeteria diet. Here we describe some of the molecular targets and the duration of the effects. We treated rats with 500 mg grape seed proanthocyanidin extract (GSPE)/kg BW for ten days. Seven or seventeen weeks after the last GSPE dose, while animals were on a cafeteria diet, we used reverse transcriptase-polymerase chain reaction (RT-PCR) to measure the mRNA of the key energy metabolism enzymes from the liver, adipose depots and muscle. We found that a reduction in the expression of adipose Lpl might explain the lower amount of adipose tissue in rats seven weeks after the last GSPE dose. The liver showed increased expression of Cpt1a and Hmgs2 together with a reduction in Fasn and Dgat2. In addition, muscle showed a higher fatty oxidation (Oxct1 and Cpt1b mRNA). However, after seventeen weeks, there was a completely different gene expression pattern. At the conclusion of the study, seven weeks after the last GSPE administration there was a limitation in adipose accrual that might be mediated by an inhibition of the gene expression of the adipose tissue Lpl. Concomitantly there was an increase in fatty acid oxidation in liver and muscle.

Description: The location of the high mountains of southern Europe has been crucial in the phylogeography of most European species, but how extrinsic (topography of sky islands) and intrinsic features (dispersal dynamics) have interacted to shape the genetic structure in alpine restricted species is still poorly known. Here we investigated the mechanisms explaining the colonisation of Cantabrian sky islands in an endemic flightless grasshopper. We scrutinised the maternal genetic variability and haplotype structure, and we evaluated the fitting of two migration models to understand the extant genetic structure in these populations: Long-distance dispersal (LDD) and gradual distance dispersal (GDD). We found that GDD fits the real data better than the LDD model, with an onset of the expansion matching postglacial expansions after the retreat of the ice sheets. Our findings suggest a scenario with small carrying capacity, migration rates, and population growth rates, being compatible with a slow dispersal process. The gradual expansion process along the Cantabrian sky islands found here seems to be conditioned by the suitability of habitats and the presence of alpine corridors. Our findings shed light on our understanding about how organisms which have adapted to live in alpine habitats with limited dispersal abilities have faced new and suitable environmental conditions.

Description: Sugar accumulation is a critical event during grape berry ripening that determines the grape market values. Berry cells are highly dependent on sugar transporters to mediate cross-membrane transport. However, the role of sugar transporters in improving sugar accumulation in berries is not well established in grapes. Herein we report that a Sugars Will Eventually be Exported Transporter (SWEET), that is, VvSWEET10, was strongly expressed at the onset of ripening (véraison) and can improve grape sugar content. VvSWEET10 encodes a plasma membrane-localized transporter, and the heterologous expression of VvSWEET10 indicates that VvSWEET10 is a hexose-affinity transporter and has a broad spectrum of sugar transport functions. VvSWEET10 overexpression in grapevine calli and tomatoes increased the glucose, fructose, and total sugar levels significantly. The RNA sequencing results of grapevine transgenic calli showed that many sugar transporter genes and invertase genes were upregulated and suggest that VvSWEET10 may mediate sugar accumulation. These findings elucidated the role of VvSWEET10 in sugar accumulation and will be beneficial for the improvement of grape berry quality in the future.

Description: Among biotic constraints affecting olive trees cultivation worldwide, the soil-borne fungus Verticillium dahliae is considered one of the most serious threats. Olive cultivars display differential susceptibility to the disease, but our knowledge on the pathogen’s responses when infecting varieties differing in susceptibility is scarce. A comparative transcriptomic analysis (RNA-seq) was conducted in olive cultivars Picual (susceptible) and Frantoio (tolerant). RNA samples originated from roots during the first two weeks after inoculation with V. dahliae defoliating (D) pathotype. Verticillium dahliae mRNA amount was overwhelmingly higher in roots of the susceptible cultivar, indicating that proliferation of pathogen biomass is favored in ‘Picual’. A significant larger number of V. dahliae unigenes (11 fold) were only induced in this cultivar. Seven clusters of differentially expressed genes (DEG) were identified according to time-course expression patterns. Unigenes potentially coding for niche-adaptation, pathogenicity, virulence and microsclerotia development were induced in ‘Picual’, while in ‘Frantoio’ expression remained negligible or null. Verticillium dahliae D pathotype transcriptome responses are qualitatively and quantitatively different, and depend on cultivar susceptibility level. The much larger V. dahliae biomass found in ‘Picual’ roots is a consequence of both host and pathogen DEG explaining, to a large extent, the higher aggressiveness exerted over this cultivar.

Description: The generation of a complete and accurate copy of the genetic material during each cell cycle is integral to cell growth and proliferation. However, genetic diversity is essential for adaptation and evolution, and the process of DNA replication is a fundamental source of mutations. Genome alterations do not accumulate randomly, with variations in the types and frequencies of mutations that arise in different genomic regions. Intriguingly, recent studies revealed a striking link between the mutational landscape of a genome and the spatial and temporal organization of DNA replication, referred to as the replication program. In our review, we discuss how this program may contribute to shaping the profile and spectrum of genetic alterations, with implications for genome dynamics and organismal evolution in natural and pathological contexts.

Description: One of the main goals of the quality control evaluation is to identify contaminants in raw material, or contamination after a food is processed and before it is placed on the market. During the treatment processes, contamination, both accidental and economically motivated, can generate incongruence between declared and real composition. In our study, we evaluated if DNA metabarcoding is a suitable tool for unveiling the composition of processed food, when it contains small trace amounts. We tested this method on different types of commercial plant products by using tnrL marker and we applied amplicon-based high-throughput sequencing techniques to identify plant components in different food products. Our results showed that DNA metabarcoding can be an effective approach for food traceability in different type of processed food. Indeed, the vast majority of our samples, we identified the species composition as the labels reported. Although some critical issues still exist, mostly deriving from the starting composition (i.e., variable complexity in taxa composition) of the sample itself and the different processing level (i.e., high or low DNA degradation), our data confirmed the potential of the DNA metabarcoding approach also in quantitative analyses for food composition quality control.

Description: DNA methylation (5-methylcytosine, 5mC) is a major form of DNA modification in the mammalian genome that plays critical roles in chromatin structure and gene expression. In general, DNA methylation is stably maintained in somatic tissues. However, DNA methylation patterns and levels show dynamic changes during development. Specifically, the genome undergoes two waves of global demethylation and remethylation for the purpose of producing the next generation. The first wave occurs in the germline, initiated with the erasure of global methylation in primordial germ cells (PGCs) and completed with the establishment of sex-specific methylation patterns during later stages of germ cell development. The second wave occurs after fertilization, including the erasure of most methylation marks inherited from the gametes and the subsequent establishment of the embryonic methylation pattern. The two waves of DNA methylation reprogramming involve both distinct and shared mechanisms. In this review article, we provide an overview of the key reprogramming events, focusing on the important players in these processes, including DNA methyltransferases (DNMTs) and ten-eleven translocation (TET) family of 5mC dioxygenases.

Description: Hematopoietic cells are continuously replenished from progenitor cells that reside in the bone marrow. To evaluate molecular changes during this process, we analyzed the transcriptomes of freshly harvested human bone marrow progenitor (lineage-negative) and differentiated (lineage-positive) cells by single-molecule real-time (SMRT) full-length RNA-sequencing. This analysis revealed a ~5-fold higher number of transcript isoforms than previously detected and showed a distinct composition of individual transcript isoforms characteristic for bone marrow subpopulations. A detailed analysis of messenger RNA (mRNA) isoforms transcribed from the ANXA1 and EEF1A1 loci confirmed their distinct composition. The expression of proteins predicted from the transcriptome analysis was evaluated by mass spectrometry and validated previously unknown protein isoforms predicted e.g., for EEF1A1. These protein isoforms distinguished the lineage negative cell population from the lineage positive cell population. Finally, transcript isoforms expressed from paralogous gene loci (e.g., CFD, GATA2, HLA-A, B, and C) also distinguished cell subpopulations but were only detectable by full-length RNA sequencing. Thus, qualitatively distinct transcript isoforms from individual genomic loci separate bone marrow cell subpopulations indicating complex transcriptional regulation and protein isoform generation during hematopoiesis.

Description: Epigenetic modifications have an important role to explain part of the intra- and inter-species variation in gene expression. They also have a role in the control of transposable elements (TEs) whose activity may have a significant impact on genome evolution by promoting various mutations, which are expected to be mostly deleterious. A change in the local epigenetic landscape associated with the presence of TEs is expected to affect the expression of neighboring genes since these modifications occurring at TE sequences can spread to neighboring sequences. In this work, we have studied how the epigenetic modifications of genes are conserved and what the role of TEs is in this conservation. For that, we have compared the conservation of the epigenome associated with human duplicated genes and the differential presence of TEs near these genes. Our results show higher epigenome conservation of duplicated genes from the same family when they share similar TE environment, suggesting a role for the differential presence of TEs in the evolutionary divergence of duplicates through variation in the epigenetic landscape.

Description: The tRNAHis guanylyltransferase (Thg1) superfamily includes enzymes that are found in all three domains of life that all share the common ability to catalyze the 3′ to 5′ synthesis of nucleic acids. This catalytic activity, which is the reverse of all other known DNA and RNA polymerases, makes this enzyme family a subject of biological and mechanistic interest. Previous biochemical, structural, and genetic investigations of multiple members of this family have revealed that Thg1 enzymes use the 3′ to 5′ chemistry for multiple reactions in biology. Here, we describe the current state of knowledge regarding the catalytic features and biological functions that have been so far associated with Thg1 and its homologs. Progress toward the exciting possibility of utilizing this unusual protein activity for applications in biotechnology is also discussed.

Description: Keratin 8 (KRT8), a type II basic intermediate filament (IF) protein, is essential for the development and metastasis of various cancers. In this study, by analyzing RNA-seq data from the Cancer Genome Atlas (TCGA)-lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC), we have determined the expression profile of KRT8, and assessed its prognostic significance and the possible mechanism underlying the dysregulation. Our results showed that KRT8 mRNA expression was significantly up-regulated in both LUAD and LUSC tissues compared with normal lung tissues. The high KRT8 expression group for LUAD patients significantly reduced overall survival (OS) and recurrence-free survival (RFS). Univariate and multivariate analysis revealed that KRT8 expression was an independent prognostic indicator for poor OS and RFS in LUAD patients. However, KRT8 expression had no prognostic value in terms of OS and RFS for LUSC. By exploring DNA copy number alterations (CNAs) of the KRT8 gene in LUAD, we found that DNA low copy gain (+1 and +2) was associated with elevated KRT8 mRNA expression. From the above findings, we have deduced that KRT8 is aberrantly expressed in LUAD tissues and that its expression might independently predict poor OS and RFS for LUAD patients, but not for LUSC patients.

Description: Species belonging to Rosa section Synstylae (Rosaceae) are mainly distributed in East Asia, and represent recently diverged lineages within the genus. Over decades, inferring phylogenetic relationships within section Synstylae have been exceptional challenges, due to short branch lengths and low support values. Of approximately 36 species in the section Synstylae, Rosa multiflora, Rosa luciae and Rosa maximowicziana are widely distributed in the Sino-Japanese floristic region. In this study, we assembled chloroplast genomes of these three species to compare the genomic features within section Synstylae, and to compare with other infrageneric groups. We found that three Rosa sect. Synstylae species had lost infA genes with pseudogenization, and they were almost identical to each other. Two protein-coding gene regions (ndhF and ycf1) and five non-coding regions (5’matK-trnK, psbI-trnS-trnG, rps16-trnG, rpoB-trnC, and rps4-trnT) were identified as being highly informative markers. Within three section Synstylae chloroplast genomes, 85 simple sequence repeat (SSR) motifs were detected, of which at least 13 motifs were identified to be effective markers. The phylogenetic relationships of R. multiflora, R. luciae and R. maximowicziana could not be resolved, even with chloroplast genome-wide data. This study reveals the chloroplast genomic data of Rosa sect. Synstylae, and it provides valuable markers for DNA barcoding and phylogenetic analyses for further studies.

Description: Anticancer regimens for Hodgkin lymphoma (HL) patients include highly genotoxic drugs that have been very successful in killing tumor cells and providing a 90% disease-free survival at five years. However, some of these treatments do not have a specific cell target, damaging both cancerous and normal cells. Thus, HL survivors have a high risk of developing new primary cancers, both hematologic and solid tumors, which have been related to treatment. Several studies have shown that after treatment, HL patients and survivors present persistent chromosomal instability, including nonclonal chromosomal aberrations. The frequency and type of chromosomal abnormalities appear to depend on the type of therapy and the cell type examined. For example, MOPP chemotherapy affects hematopoietic and germ stem cells leading to long-term genotoxic effects and azoospermia, while ABVD chemotherapy affects transiently sperm cells, with most of the patients showing recovery of spermatogenesis. Both regimens have long-term effects in somatic cells, presenting nonclonal chromosomal aberrations and genomic chaos in a fraction of noncancerous cells. This is a source of karyotypic heterogeneity that could eventually generate a more stable population acquiring clonal chromosomal aberrations and leading towards the development of a new cancer.

Description: The pikeperch (Sander lucioperca) is a fresh and brackish water Percid fish natively inhabiting the northern hemisphere. This species is emerging as a promising candidate for intensive aquaculture production in Europe. Specific traits like cannibalism, growth rate and meat quality require genomics based understanding, for an optimal husbandry and domestication process. Still, the aquaculture community is lacking an annotated genome sequence to facilitate genome-wide studies on pikeperch. Here, we report the first highly contiguous draft genome assembly of Sander lucioperca. In total, 413 and 66 giga base pairs of DNA sequencing raw data were generated with the Illumina platform and PacBio Sequel System, respectively. The PacBio data were assembled into a final assembly size of ~900 Mb covering 89% of the 1,014 Mb estimated genome size. The draft genome consisted of 1966 contigs ordered into 1,313 scaffolds. The contig and scaffold N50 lengths are 3.0 Mb and 4.9 Mb, respectively. The identified repetitive structures accounted for 39% of the genome. We utilized homologies to other ray-finned fishes, and ab initio gene prediction methods to predict 21,249 protein-coding genes in the Sander lucioperca genome, of which 88% were functionally annotated by either sequence homology or protein domains and signatures search. The assembled genome spans 97.6% and 96.3% of Vertebrate and Actinopterygii single-copy orthologs, respectively. The outstanding mapping rate (99.9%) of genomic PE-reads on the assembly suggests an accurate and nearly complete genome reconstruction. This draft genome sequence is the first genomic resource for this promising aquaculture species. It will provide an impetus for genomic-based breeding studies targeting phenotypic and performance traits of captive pikeperch.

Description: Over the decades, pig breeding objectives have focused on improving the meat content in the carcass without taking into consideration the more effective fattening indicators that affect feed conversion. At present, pig growth traits associated particularly with animal feeding have become crucial due to their economic significance. This is especially evident in countries where pigs are maintained on large farms. The present study indicates that pituitary differentially expressed genes (DEGs) are activated in response to variable feed conversion (FC) in pigs. The experiment included two native Polish breeds: Puławska and Złotnicka White (ZW). The whole pituitary transcriptome was sequenced using next-generation sequencing (NGS) technology. The RNA-seq method identified over 500 and 300 DEGs in the pituitaries of the ZW and the Puławska pig populations, respectively, that were associated with hormonal regulation, notch signaling, and Wnt pathways. Lower FC in the ZW pigs favoured increased fat content in the body and significantly higher prolactin expression. The obtained results indicate that low FC values in pigs are related to slower growth or increased fat content, which suggests various pituitary responses. Therefore, the identified candidate genes were not directly associated with feed conversion values but with other factors. However, the present study delivers new insights into pituitary regulation in pigs.

Description: Background: Sometimes dental implants seem to be the only therapeutic alternative for the oral rehabilitation of patients with Down syndrome, given that they usually lose all their teeth early due to suffering aggressive periodontitis and they do not usually have the skills required to wear removable prostheses. However, the evolution of dental implants in these patients shows very adverse results. It is possible that basal genetic alterations, or at least some characteristics of these, may underlie these clinical results. The metabolic pathway of metallothioneins, molecules with an important influence on bone metabolism, could be one of the said alterations. Aims: To determine whether the expression of metallothioneins (MTs) and their metabolic pathway may be identified and related to the periodontitis and lack of osseointegration of dental implants in Down syndrome patients. Materials and Methods: Retrospective study of cases and controls by comparing patients with Down syndrome, periodontal disease, and implant failure (four patients, test group) with patients with Down syndrome, without periodontal disease, and without implant failure after two years of following (seven patients, control group), by extracting peripheral blood at the time of the dental examination to extract RNA and its subsequent processing in relation to gene expression of the metabolic pathway of metallothioneins. Results: The results identified low expression in the group of patients with periodontal disease and implant failure of genes MT1E, MT1H, MT1X, MT1A, MT1B, MT1C, MT1L, MT2A, MT1M, and MT1G. Conclusions: The low MT1 and MT2 gene expression seems to be related to the onset of periodontal disease and implant rejection in Down syndrome patients, although more data are required to confirm whether this relationship is due to one of the two conditions, to both independently, or to the two jointly—this last option being indicated by our current study.

Description: Advances in technologies offer new opportunities to collect and integrate data from a broad range of sources to advance the understanding of rare diseases and support the development of new treatments. Prader–Willi syndrome (PWS) is a rare, complex neurodevelopmental disorder, which has a variable and incompletely understood natural history. PWS is characterized by early failure to thrive, followed by the onset of excessive appetite (hyperphagia). Additional characteristics include multiple endocrine abnormalities, hypotonia, hypogonadism, sleep disturbances, a challenging neurobehavioral phenotype, and cognitive disability. The Foundation for Prader–Willi Research’s Global PWS Registry is one of more than twenty-five registries developed to date through the National Organization of Rare Disorders (NORD) IAMRARE Registry Program. The Registry consists of surveys covering general medical history, system-specific clinical complications, diet, medication and supplement use, as well as behavior, mental health, and social information. Information is primarily parent/caregiver entered. The platform is flexible and allows addition of new surveys, including updatable and longitudinal surveys. Launched in 2015, the PWS Registry has enrolled 1696 participants from 37 countries, with 23,550 surveys completed. This resource can improve the understanding of PWS natural history and support medical product development for PWS.

Description: In teleost, pigment in the skin and scales played important roles in various biological processes. Iridophores, one of the main pigment cells in teleost, could produce silver pigments to reflect light. However, the specific mechanism of the formation of silver pigments is still unclear. In our previous study, some transparent mutant individuals were found in the carp–goldfish nucleocytoplasmic hybrid (CyCa hybrid) population. In the present study, using transparent mutants (TM) and wild type (WT) of the CyCa hybrid as a model, firstly, microscopic observations showed that the silver pigments and melanin were both lost in the scales of transparent mutants compared to that in wild types. Secondly, genetic study demonstrated that the transparent trait in the CyCa hybrid was recessively inherent, and controlled by an allele in line with Mendelism. Thirdly, RNA-Seq analysis showed that differential expression genes (DEGs) between wild type and transparent mutants were mainly enriched in the metabolism of guanine, such as hydrolase, guanyl nucleotide binding, guanyl ribonucleotide binding, and GTPase activity. Among the DEGs, purine nucleoside phosphorylase 4a (pnp4a) and endothelin receptor B (ednrb) were more highly expressed in the wild type compared to the transparent mutant (p 〈 0.05). Finally, miRNA-Seq analysis showed that miRNA-146a and miR-153b were both more highly expressed in the transparent mutant compared to that in wild type (p 〈 0.05). Interaction analysis between miRNAs and mRNAs indicated that miRNA-146a was associated with six DEGs (MGAT5B, MFAP4, GP2, htt, Sema6b, Obscn) that might be involved in silver pigmentation.

Description: Amyloid beta-peptide is produced by the cleavage of amyloid precursor protein by two secretases, a β-secretase, beta-site amyloid precursor protein cleaving enzyme 1 (BACE1) and a γ-secretase. It has been hypothesised that partial inhibition of BACE1 in individuals with a high risk of developing Alzheimer’s disease may be beneficial in preventing cognitive decline. In this study, we report the development of a novel antisense oligonucleotide (AO) that could efficiently downregulate the BACE1 transcript and partially inhibit BACE1 protein. We designed and synthesised a range of 2’-OMethyl-modified antisense oligonucleotides with a phosphorothioate backbone across various exons of the BACE1 transcript, of which AO2, targeting exon 2, efficiently downregulated BACE1 RNA expression by 90%. The sequence of AO2 was later synthesised with a phosphorodiamidate morpholino chemistry, which was found to be not as efficient at downregulating BACE1 expression as the 2’-OMethyl antisense oligonucleotides with a phosphorothioate backbone variant. AO2 also reduced BACE1 protein levels by 45%. In line with our results, we firmly believe that AO2 could be used as a potential preventative therapeutic strategy for Alzheimer’s disease.

Description: Background: Obesity is associated with several comorbid disorders, ranging from cardiovascular diseases to insulin resistance. In this context, visceral adipose tissue (VAT) seems to have a close connection with insulin resistance. In our study, we hypothesized that the expression profile of key adipogenic genes, such as proliferator-activated receptor γ type 2 (PPAR-γ2), CCAAT/enhancer-binding protein type α (C/EBP-α), and forkhead box protein class O type 1 (FOXO1) in VAT should shed light on their association with obesity-related insulin resistance. Methods: To test this idea, we studied the expression profile of C/EBP-α, FOXO1 and PPAR-γ2 in VAT from non-obese individuals, and low insulin (LIR-MO) and high insulin morbidly obese (HIR-MO) subjects, through a combination of RT-qPCR, co-immunoprecipitation, ELISA, Western blot analysis and EMSA assays. Results: Our results show that C/EBP-α and PPAR-γ2 were down-expressed in HIR-MO individuals, while FOXO1 was overexpressed. In addition, the PPAR-γ2–RXR-α heterodimer showed weak activity and bound weakly to the putative IGFBP-2–PPRE promoter sequence in VAT from HIR-MO subjects when compared with LIR-MO individuals. Conclusions: These results show that PPAR-γ2, C/EBP-α, FOXO1 and IGFBP-2 have a close relationship with insulin resistance in VAT of morbidly obese individuals.

Description: Existing methods often fail to recognize the conversions for the biological roles of the pairs of genes and microRNAs (miRNAs) between the tumor and normal samples. We have developed a novel cluster scoring method to identify messenger RNA (mRNA) and miRNA interaction pairs and clusters while considering tumor and normal samples jointly. Our method has identified 54 significant clusters for 15 cancer types selected from The Cancer Genome Atlas project. We also determined the shared clusters across tumor types and/or subtypes. In addition, we compared gene and miRNA overlap between lists identified in our liver hepatocellular carcinoma (LIHC) study and regulatory relationships reported from human and rat nonalcoholic fatty liver disease studies (NAFLD). Finally, we analyzed biological functions for the single significant cluster in LIHC and uncovered a significantly enriched pathway (phospholipase D signaling pathway) with six genes represented in the cluster, symbols: DGKQ, LPAR2, PDGFRB, PIK3R3, PTGFR and RAPGEF3.

Description: A diverse set of mobile genetic elements (MGEs) transmit between Streptococcus pneumoniae cells, but many isolates remain uninfected. The best-characterised defences against horizontal transmission of MGEs are restriction-modification systems (RMSs), of which there are two phase-variable examples in S. pneumoniae. Additionally, the transformation machinery has been proposed to limit vertical transmission of chromosomally integrated MGEs. This work describes how these mechanisms can act in concert. Experimental data demonstrate RMS phase variation occurs at a sub-maximal rate. Simulations suggest this may be optimal if MGEs are sometimes vertically inherited, as it reduces the probability that an infected cell will switch between RMS variants while the MGE is invading the population, and thereby undermine the restriction barrier. Such vertically inherited MGEs can be deleted by transformation. The lack of between-strain transformation hotspots at known prophage att sites suggests transformation cannot remove an MGE from a strain in which it is fixed. However, simulations confirmed that transformation was nevertheless effective at preventing the spread of MGEs into a previously uninfected cell population, if a recombination barrier existed between co-colonising strains. Further simulations combining these effects of phase variable RMSs and transformation found they synergistically inhibited MGEs spreading, through limiting both vertical and horizontal transmission.

Description: Latent autoimmune diabetes in adults (LADA) was recently demonstrated to be the most frequent form of adult-onset autoimmune diabetes mellitus. Case–control studies have investigated the relationship between human leukocyte antigen (HLA)-DQB1 and HLA-DRB1 polymorphisms and LADA risk, but their conclusions are inconsistent. This study aimed to more precisely explore the correlation between these HLA gene variants and LADA development. Eight databases, including PubMed, Embase, and Medline, were systematically searched for relevant studies up to September 15, 2018. We performed this retrospective study using meta-analysis and relative predispositional effect (RPE) methods. The meta-analysis results indicated that DQB1*02 (odds ratio (OR) = 1.685, pc 〈 0.005) and DQB1*06 (OR = 0.604, pc = 0.010) have opposite effects on susceptibility to LADA, while a significant decrease in LADA risk caused by DQB1*05 (OR = 0.764, pc = 0.100) disappeared upon Bonferroni correction. The RPE method confirmed the roles of DQB1*02 (χ² = 46.475, p 〈 0.001) and DQB1*06 (χ² = 17.883, p 〈 0.001) and further suggested protective effects of DQB1*05 (χ² = 16.496, p 〈 0.001). Additionally, the meta-analysis results showed that DRB1*03 (OR = 2.685, pc 〈 0.013), DRB1*04 (OR = 1.954, pc 〈 0.013), and DRB1*09 (OR = 1.346, pc 〈 0.013) are associated with increased LADA risk, while DRB1*12 (OR = 0.600, pc 〈 0.013) and DRB1*13 (OR = 0.583, pc 〈 0.013) carriers have a decreased risk of developing LADA. Furthermore, the RPE method revealed that DRB1*03 (χ² = 98.754, p 〈 0.001), DRB1*04 (χ² = 94.685, p 〈 0.001), DRB1*09 (χ² = 40.489, p 〈 0.001), DRB1*01 (χ² = 12.181, p 〈 0.001), DRB1*07 (χ² = 10.882, p = 0.001), and DRB1*08 (χ² = 5.000, p = 0.025) play protective roles against LADA. LADA showed a close relationship with genetic polymorphisms of HLA-DQB1 and WHLA-DRB1, which could contribute to a better understanding of disease pathogenesis and the identification of predisposing loci in the diagnosis and treatment of LADA.

Description: Thyroid cancer comprises different clinical and histological entities. Whereas differentiated (DTCs) malignancies are sensitive to radioiodine therapy, anaplastic (ATCs) and medullary (MTCs) tumors do not uptake radioactive iodine and display aggressive features associated with a poor prognosis. Moreover, in a majority of DTCs, disease evolution leads to the progressive loss of iodine sensitivity. Hence, iodine-refractory DTCs, along with ATCs and MTCs, require alternative treatments reflective of their different tumor biology. In the last decade, the molecular mechanisms promoting thyroid cancer development and progression have been extensively studied. This has led to a better understanding of the genomic landscape, displayed by thyroid malignancies, and to the identification of novel therapeutic targets. Indeed, several pharmacological compounds have been developed for iodine-refractory tumors, with four multi-target tyrosine kinase inhibitors already available for DTCs (sorafenib and lenvatinib) and MTCs (cabozantib and vandetanib), and a plethora of drugs currently being evaluated in clinical trials. In this review, we will describe the genomic alterations and biological processes intertwined with thyroid cancer development, also providing a thorough overview of targeted drugs already tested or under investigation for these tumors. Furthermore, given the existing preclinical evidence, we will briefly discuss the potential role of immunotherapy as an additional therapeutic strategy for the treatment of thyroid cancer.

Description: Laccase is a widely used industrial oxidase for food processing, dye synthesis, paper making, and pollution remediation. At present, laccases used by industries come mainly from fungi. Plants contain numerous genes encoding laccase enzymes that show properties which are distinct from that of the fungal laccases. These plant-specific laccases may have better potential for industrial purposes. The aim of this work was to conduct a genome-wide search for the soybean laccase genes and analyze their characteristics and specific functions. A total of 93 putative laccase genes (GmLac) were identified from the soybean genome. All 93 GmLac enzymes contain three typical Cu-oxidase domains, and they were classified into five groups based on phylogenetic analysis. Although adjacent members on the tree showed highly similar exon/intron organization and motif composition, there were differences among the members within a class for both conserved and differentiated functions. Based on the expression patterns, some members of laccase were expressed in specific tissues/organs, while some exhibited a constitutive expression pattern. Analysis of the transcriptome revealed that some laccase genes might be involved in providing resistance to oomycetes. Analysis of the selective pressures acting on the laccase gene family in the process of soybean domestication revealed that 10 genes could have been under artificial selection during the domestication process. Four of these genes may have contributed to the transition of the soft and thin stem of wild soybean species into strong, thick, and erect stems of the cultivated soybean species. Our study provides a foundation for future functional studies of the soybean laccase gene family.

Description: Background: The study of the biological basis of anxiety, depression, and intellectual disabilities in humans is one of the most actual problems of modern neurophysiology. Of particular interest is the study of complex interactions between molecular genetic factors, electrophysiological properties of the nervous system, and the behavioral characteristics of people. The neurobiological understanding of neuropsychiatric disorders requires not only the identification of genes that play a role in the molecular mechanisms of the occurrence and course of diseases, but also the understanding of complex interactions that occur between these genes. A systematic study of such interactions obviously contributes to the development of new methods of diagnosis, prevention, and treatment of disorders, as the orientation to allele variants of individual loci is not reliable enough, because the literature describes a number of genes, the same alleles of which can be associated with different, sometimes extremely different variants of phenotypic traits, depending on the genetic background, of their carriers, habitat, and other factors. Results: In our study, we have reconstructed a series of gene networks (in the form of protein–protein interactions networks, as well as networks of transcription regulation) to build a model of the influence of complex interactions of environmental factors and genetic risk factors for intellectual disability, depression, and other disorders in human behavior. Conclusion: A list of candidate genes whose expression is presumably associated with environmental factors and has potentially contentious manifestation for behavioral and neurological traits is identified for further experimental verification.

Description: Interleukin 6 (IL-6) is an immunoregulatory cytokine involved in various inflammatory and immune responses. To investigate the effects of single nucleotide polymorphisms (SNPs) and haplotypes of IL-6 on resistance to Eimeria tenella (E. tenella), SNPs in the 5′ regulatory region of IL-6 were detected with direct sequencing, and the effects of SNPs and haplotypes on resistance to E. tenella were analyzed by the least square model in Jinghai yellow chickens. Nineteen SNPs were identified in the 5′ regulation region of IL-6, among which three SNPs were newly discovered. The SNP association analysis results showed that nine of the SNPs were significantly associated with E. tenella resistance indexes; the A-483G locus was significantly associated with the GSH-Px, IL-2, and IL-17 indexes (p 〈 0.05); the C-447G locus was significantly associated with the SOD, GSH-Px, IL-17, and IL-2 indexes (p 〈 0.05); and the G-357A locus had significant effects on the CAT and IL-16 indexes (p 〈 0.05). Haplotype analysis showed that H2H3 and H2H5 were favorable haplotype combinations with good coccidium resistance. Furthermore, we used qRT-PCR and observed that the expression of IL-6 in the infection group was higher than that in the control group in the liver, proventriculus, small intestine, thymus, kidney, and bursa of Fabricius and extremely significantly different than that in the cecum especially (p 〈 0.01). In summary, SNPs and haplotypes in the 5′ regulatory region of IL-6 have important effects on E. tenella resistance, and the results will provide a reference for molecular marker selection of E. tenella resistance in Jinghai yellow chickens.

Description: (1) Background: DNA sequence alignment process is an essential step in genome analysis. BWA-MEM has been a prevalent single-node tool in genome alignment because of its high speed and accuracy. The exponentially generated genome data requiring a multi-node solution to handle large volumes of data currently remains a challenge. Spark is a ubiquitous big data platform that has been exploited to assist genome alignment in handling this challenge. Nonetheless, existing works that utilize Spark to optimize BWA-MEM suffer from higher overhead. (2) Methods: In this paper, we presented PipeMEM, a framework to accelerate BWA-MEM with lower overhead with the help of the pipe operation in Spark. We additionally proposed to use a pipeline structure and in-memory-computation to accelerate PipeMEM. (3) Results: Our experiments showed that, on paired-end alignment tasks, our framework had low overhead. In a multi-node environment, our framework, on average, was 2.27× faster compared with BWASpark (an alignment tool in Genome Analysis Toolkit (GATK)), and 2.33× faster compared with SparkBWA. (4) Conclusions: PipeMEM could accelerate BWA-MEM in the Spark environment with high performance and low overhead.

Description: The reverse transcription quantitative polymerase chain reaction (RT-qPCR) has been widely used to determine gene functions in Laodelphax striatellus (Fallén) (small brown planthopper). Selection of suitable reference gene(s) for normalizations of RT-qPCR data is critical for reliable results. To date, reports on identification of suitable L. striatellus reference genes are still very limited. L. striatellus is a destructive rice pest and it can transmit multiple viruses, including Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), and Maize rough dwarf virus (MRDV), to many important cereal crops worldwide. In this study, we examined the stablity of seven selected candidate reference genes in L. striatellus at different developmental stages, in different tissues, in RBSDV- or RSV-infected L. striatellus or in RBSDV-infected and Lssynaptojanin 1 (LsSYNJ1)-silenced L. striatellus. The RT-qPCR data representing individual candidate genes were analyzed using five different methods: the delta Ct method, geNorm, NormFinder, BestKeeper, and the RefFinder algorithm, respectively. The most stable reference gene for the specific condition was selected according to a comprehensive analysis using the RefFinder method. Ribosomal protein L5 (LsRPL5) and LsRPL8 are the most stably expressed genes in L. striatellus at different developmental stages. Alpha-1-tubulin (Lsα-TUB) is the most stably expressed reference gene in different tissues of RBSDV viruliferous (RBSDV-V) or non-viruliferous (RBSDV-NV) L. striatellus. LsRPL8 is the most stably expressed reference gene in RBSDV-V or RSV viruliferous (RSV-V) L. striatellus, while beta-tubulin (Lsβ-TUB) is the most stably expressed reference gene in RBSDV-V and LsSYNJ1-silenced L. striatellus. The selected reference genes were further investigated during analyses of RBSDV P5-1 and P10 gene expression in different tissues from RBSDV-V or RBSDV-NV L. striatellus. The stably expressed reference genes identified in this study will benefit future gene function studies using L. striatellus.

Description: Captive breeding has been used as an effective approach to protecting endangered animals but its effect on the gut microbiome and the conservation status of these species is largely unknown. The giant panda is a flagship species for the conservation of wildlife. With integrated efforts including captive breeding, this species has been recently upgraded from “endangered” to “vulnerable” (IUCN 2016). Since a large proportion (21.8%) of their global population is still captive, it is critical to understand how captivity changes the gut microbiome of these pandas and how such alterations to the microbiome might affect their future fitness and potential impact on the ecosystem after release into the wild. Here, we use 16S rRNA (ribosomal RNA) marker gene sequencing and shotgun metagenomics sequencing to demonstrate that the fecal microbiomes differ substantially between wild and captive giant pandas. Fecal microbiome diversity was significantly lower in captive pandas, as was the diversity of functional genes. Additionally, captive pandas have reduced functional potential for cellulose degradation but enriched metabolic pathways for starch metabolism, indicating that they may not adapt to a wild diet after being released into the wild since a major component of their diet in the wild will be bamboo. Most significantly, we observed a significantly higher level of amylase activity but a lower level of cellulase activity in captive giant panda feces than those of wild giant pandas, shown by an in vitro experimental assay. Furthermore, antibiotic resistance genes and virulence factors, as well as heavy metal tolerance genes were enriched in the microbiomes of captive pandas, which raises a great concern of spreading these genes to other wild animals and ecosystems when they are released into a wild environment. Our results clearly show that captivity has altered the giant panda microbiome, which could have unintended negative consequences on their adaptability and the ecosystem during the reintroduction of giant pandas into the wild.

Description: Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA〉TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Description: The Wnt, TGF-β, and Notch signaling pathways are essential for the regulation of cellular polarity, differentiation, proliferation, and migration. Differential activation and mutual crosstalk of these pathways during animal development are crucial instructive forces in the initiation of the body axis and the development of organs and tissues. Due to the ability to initiate cell proliferation, these pathways are vulnerable to somatic mutations selectively producing cells, which ultimately slip through cellular and organismal checkpoints and develop into cancer. The architecture of the Wnt, TGF-β, and Notch signaling pathways is simple. The transmembrane receptor, activated by the extracellular stimulus, induces nuclear translocation of the transcription factor, which subsequently changes the expression of target genes. Nevertheless, these pathways are regulated by a myriad of factors involved in various feedback mechanisms or crosstalk. The most prominent group of regulators is the ubiquitin–proteasome system (UPS). To open the door to UPS-based therapeutic manipulations, a thorough understanding of these regulations at a molecular level and rigorous confirmation in vivo are required. In this quest, mouse models are exceptional and, thanks to the progress in genetic engineering, also an accessible tool. Here, we reviewed the current understanding of how the UPS regulates the Wnt, TGF-β, and Notch pathways and we summarized the knowledge gained from related mouse models.

Description: A single male domestic shorthair cat that did not complete puberty was reported. At four years of age, it still had primary dentition, testicular hypoplasia, and was relatively small for its age. We hypothesized that the phenotype might have been due to an inherited form of hypogonadotropic hypogonadism (HH). We sequenced the genome of the affected cat and compared the data to 38 genomes from control cats. A search for private variants in 40 candidate genes associated with human HH revealed a single protein-changing variant in the affected cat. It was located in the TAC3 gene encoding tachykinin 3, a precursor protein of the signaling molecule neurokinin B, which is known to play a role in sexual development. TAC3 variants have been reported in human patients with HH. The identified feline variant, TAC3:c.220G〉A or p.(Val74Met), affects a moderately conserved region of the precursor protein, 11 residues away from the mature neurokinin B sequence. The affected cat was homozygous for the mutant allele. In a cohort of 171 randomly sampled cats, 169 were homozygous for the wildtype allele and 2 were heterozygous. These data tentatively suggest that the identified TAC3 variant might have caused the suppression of puberty in the affected cat.

Description: Network biology has the capability to integrate, represent, interpret, and model complex biological systems by collectively accommodating biological omics data, biological interactions and associations, graph theory, statistical measures, and visualizations. Biological networks have recently been shown to be very useful for studies that decipher biological mechanisms and disease etiologies and for studies that predict therapeutic responses, at both the molecular and system levels. In this review, we briefly summarize the general framework of biological network studies, including data resources, network construction methods, statistical measures, network topological properties, and visualization tools. We also introduce several recent biological network applications and methods for the studies of rare diseases.

Description: Gnetum possesses morphologically bisexual but functionally unisexual reproductive structures that exude sugary pollination drops to attract insects. Previous studies have revealed that the arborescent species (G. gnemon L.) and the lianoid species (G. luofuense C.Y.Cheng) possess different pollination syndromes. This study compared the proteome in the pollination drops of these two species using label-free quantitative techniques. The transcriptomes of fertile reproductive units (FRUs) and sterile reproductive units (SRUs) for each species were furthermore compared using Illumina Hiseq sequencing, and integrated proteomic and transcriptomic analyses were subsequently performed. Our results show that the differentially expressed proteins between FRUs and SRUs were involved in carbohydrate metabolism, the biosynthesis of amino acids and ovule defense. In addition, the differentially expressed genes between the FRUs and SRUs (e.g., MADS-box genes) were engaged in reproductive development and the formation of pollination drops. The integrated protein-transcript analyses revealed that FRUs and their exudates were relatively conservative while the SRUs and their exudates were more diverse, probably functioning as pollinator attractants. The evolution of reproductive organs appears to be synchronized with changes in the pollination drop proteome of Gnetum, suggesting that insect-pollinated adaptations are not restricted to angiosperms but also occur in gymnosperms.

Description: Development requires the careful orchestration of several biological events in order to create any structure and, eventually, to build an entire organism. On the other hand, the fate transformation of terminally differentiated cells is a consequence of erroneous development, and ultimately leads to cancer. In this review, we elaborate how development and cancer share several biological processes, including molecular controls. Transcription factors (TF) are at the helm of both these processes, among many others, and are evolutionarily conserved, ranging from yeast to humans. Here, we discuss four families of TFs that play a pivotal role and have been studied extensively in both embryonic development and cancer—high mobility group box (HMG), GATA, paired box (PAX) and basic helix-loop-helix (bHLH) in the context of their role in development, cancer, and their conservation across several species. Finally, we review TFs as possible therapeutic targets for cancer and reflect on the importance of natural resistance against cancer in certain organisms, yielding knowledge regarding TF function and cancer biology.

Description: Variations in genes encoding for the enzymes responsible for synthesizing the linker region of proteoglycans may result in recessive conditions known as “linkeropathies”. The two phenotypes related to mutations in genes B4GALT7 and B3GALT6 (encoding for galactosyltransferase I and II respectively) are similar, characterized by short stature, hypotonia, joint hypermobility, skeletal features and a suggestive face with prominent forehead, thin soft tissue and prominent eyes. The most outstanding feature of these disorders is the combination of severe connective tissue involvement, often manifesting in newborns and infants, and skeletal dysplasia that becomes apparent during childhood. Here, we intend to more accurately define some of the clinical features of B4GALT7 and B3GALT6-related conditions and underline the extreme hypermobility of distal joints and the soft, doughy skin on the hands and feet as features that may be useful as the first clues for a correct diagnosis.

Description: This study identified a transcription factor that might bind to the 5′ regulatory region of the HTR1A and explored the potential effect on 5-HT1A receptor expression. Based on JASPAR predictions, the binding of the transcription factor was demonstrated using the electrophoretic mobility shift assay (EMSA). Vectors over-expressing the transcription factor were co-transfected into HEK-293 and SK-N-SH cells with the recombinant pGL3 vector, and relative fluorescence intensity was measured to determine regulatory activity. Additionally, the qRT-PCR and Western blot were also used to identify whether the transcription factor modulated the endogenous expression of 5-HT1A receptor. The results suggest that the transcription factor CCAA/T enhancer binding protein beta (CEBPB) likely binds to the −1219 to −1209 bp (ATG+1) region of the HTR1A. Two sequences located in the −722 to −372 bp and −119 to +99 bp were also identified. Although the effect of CEBPB on endogenous 5-HT1A receptor expression was not significant, it exhibited the strong inhibition on the relative fluorescence intensity and the mRNA level of HTR1A. CEBPB inhibited the human HTR1A expression by binding to the sequence −1219–−1209 bp. This is useful and informative for ascertaining the regulation of 5-HT1A receptor and mental diseases.

Description: Microglia, the main immune cells of the central nervous system, are increasingly implicated in Alzheimer’s disease (AD). Manifold transcriptomic studies in the brain have not only highlighted microglia’s role in AD pathogenesis, but also mapped crucial pathological processes and identified new therapeutic targets. An important component of many of these transcriptomic studies is the investigation of gene expression networks in AD brain, which has provided important new insights into how coordinated gene regulatory programs in microglia (and other cell types) underlie AD pathogenesis. Given the rapid technological advancements in transcriptional profiling, spanning from microarrays to single-cell RNA sequencing (scRNA-seq), tools used for mapping gene expression networks have evolved to keep pace with the unique features of each transcriptomic platform. In this article, we review the trajectory of transcriptomic network analyses in AD from brain to microglia, highlighting the corresponding methodological developments. Lastly, we discuss examples of how transcriptional network analysis provides new insights into AD mechanisms and pathogenesis.

Description: Germline mutations in BRCA1 and BRCA2 (BRCA1/2) genes are present in about 50% of cases of hereditary breast cancer. Proteins encoded by these genes are key players in DNA repair by homologous recombination (HR). Advances in next generation sequencing and gene panels for breast cancer testing have generated a large amount of data on gene variants implicated in hereditary breast cancer, particularly in genes such as PALB2, ATM, CHEK2, RAD51, MSH2, and BARD1. These genes are involved in DNA repair. Most of these variants have been reported for Caucasian, Jewish, and Asian population, with few reports for other communities, like those in Latin American (LA) countries. We reviewed 81 studies from 11 LA countries published between 2000 and 2019 but most of these studies focused on BRCA1/2 genes. In addition to these genes, breast cancer-related variants have been reported for PALB2, ATM, CHEK2, BARD1, MLH1, BRIP1, MSH2, NBN, MSH6, and PMS2 genes. Some of these variants are unique to LA populations. This analysis may contribute to enhance breast cancer variant characterization, and thus to find therapies and implement precision medicine for LA communities.

Description: Spikelet number per panicle is a determinative factor of rice yield. DNA repair epigenetically alters the DNA accessibility, which can eventually regulate the transcription of the target genes. However, what and how DNA repair genes are related to rice spikelet development remains unknown. Here, we report the map-based cloning of a novel spikelet number gene DES4 encoding a tetratricopeptide domain-containing protein. DES4 is a close ortholog of Arabidopsis BRU1, which is functionally related to axillary meristem development. A single base pair deletion in the last exon of DES4 caused a premature stop of the resulting protein. The des4 mutant exhibited dwarf, reduced tiller, and spikelet numbers phenotypes, as well as hypersensitivity to genotoxic stresses, suggesting its essential role in DNA repair. DES4 is predominantly expressed in young panicles and axillary meristems, and DES4 protein is localized in nucleus. A set of DNA repair genes such as cyclins, KUs (KD subunits) and recombinases were differentially regulated in des4. Meanwhile, rice spikelet number genes LAX1, LAX2, and MOC1 were significantly down-regulated in des4. In morphology, des4 showed more severe reduction of spikelet numbers than lax1, lax2, and moc1, suggesting that DES4 may work upstream of the three genes.

Description: Genomic data is a powerful tool. However, the phylogenetic relationships among different ecological races of avocado remain unclear. Here, we used the results from specific length amplified fragment sequencing (SLAF-seq) and transcriptome data to infer the population structure and genetic diversity of 21 avocado cultivars and reconstructed the phylogeny of three ecological races and two interracial hybrids. The results of the three analyses performed (unweighted pair-group methods with arithmetic means (UPGMA) cluster, Principal coordinate analysis (PCoA), and STRUCTURE) based on single nucleotide polymorphisms (SNPs) from SLAF-seq all indicated the existence of two populations based on botanical race: Mexican–Guatemalan and West Indian genotype populations. Our results based on SNPs from SLAF-seq indicated that the Mexican and Guatemalan races were more closely related to each other than either was to the West Indian race, which also was confirmed in the UPGMA cluster results based on SNPs from transcriptomic data. SNPs from SLAF-seq provided strong evidence that the Guatemalan, Mexican, and Guatemalan × Mexican hybrid accession possessed higher genetic diversity than the West Indian races and Guatemalan × West Indian hybrid accessions. Six race-specific Kompetitive allele specific PCR (KASP) markers based on SNPs from SLAF-seq were then developed and validated.

Description: D7 family proteins are among the most expressed salivary proteins in mosquitoes. They facilitate blood meal intake of the mosquito by scavenging host amines that induce vasoconstriction, platelet aggregation and pain. Despite this important role, little information is available on the impact of insecticide resistance on the regulation of D7 proteins and consequently on the blood feeding success. In this study, real-time quantitative polymerase chain reaction (qPCR) analyses were performed to investigate how pyrethroid resistance could influence the expression of genes encoding D7 family proteins in Anopheles gambiae and Anopheles funestus s.s. mosquitoes from Elon in the Central Cameroon. Out of 328 collected mosquitoes, 256 were identified as An. funestus sl and 64 as An. gambiae sl. Within the An. funestus group, An. funestus s.s. was the most abundant species (95.95%) with An. rivulorum, An. parensis and An. rivulorum-like also detected. All An. gambiae s.l mosquitoes were identified as An. gambiae. High levels of pyrethroid resistance were observed in both An. gambiae and An. funestus mosquitoes. RT-qPCR analyses revealed a significant overexpression of two genes encoding D7 proteins, D7r3 and D7r4, in pyrethroids resistant An. funestus. However, no association was observed between the polymorphism of these genes and their overexpression. In contrast, overall D7 salivary genes were under-expressed in pyrethroid resistant An. gambiae. This study provides preliminary evidences that pyrethroid resistance could influence blood meal intake through over-expression of D7 proteins although future studies will help establishing potential impact on vectorial capacity.

Description: Prions are infectious, self-perpetuating protein conformers. In mammals, pathological aggregation of the prion protein causes incurable neurodegenerative disorders, while in yeast Saccharomyces cerevisiae, prion formation may be neutral or even beneficial. According to the prevailing contemporary point of view, prion formation is considered to be a functional inactivation of the corresponding protein whose conformational state shifts from the functional monomeric one to the infectious aggregated one. The Swi1 protein forms the [SWI+] prion and belongs to the nucleosome remodeler complex SWI/SNF controlling the expression of a significant part of the yeast genome. In this work, we performed RNA sequencing of isogenic S. cerevisiae strains grown on the media containing galactose as the sole carbon source. These strains bore the [SWI+] prion or had its structural gene SWI1 deleted. The comparative analysis showed that [SWI+] affects genome expression significantly weaker as compared to the SWI1 deletion. Moreover, in contrast to [SWI+], the SWI1 deletion causes the general inhibition of translation-related genes expression and chromosome I disomy. At the same time, the [SWI+] prion exhibits a specific pattern of modulation of the metabolic pathways and some biological processes and functions, as well as the expression of several genes. Thus, the [SWI+] prion only partially corresponds to the loss-of-function of SWI1 and demonstrates several gain-of-function traits.

Description: Serotonin is a neurotransmitter involved in various physiological processes in the central and peripheral nervous systems. Serotonin is also a precursor for melatonin biosynthesis, which mainly occurs in the pineal gland of vertebrates. Tryptophan hydroxylase (TPH) acts as the rate-limiting enzyme in serotonin biosynthesis and is the initial enzyme involved in the synthesis of melatonin. Recently, two enzymes—TPH1 and TPH2—were reported to form the TPH family in vertebrates and to play divergent roles in serotonergic systems. Here, we examined the evolution of the TPH family from 70 vertebrate genomes. Based on the sequence similarity, we extracted 184 predicted tph homologs in the examined vertebrates. A phylogenetic tree, constructed on the basis of these protein sequences, indicated that tph genes could be divided into two main clades (tph1 and tph2), and that the two clades were further split into two subgroups of tetrapods and Actinopterygii. In tetrapods, and some basal non-teleost ray-finned fishes, only two tph isotypes exist. Notably, tph1 in most teleosts that had undergone the teleost-specific genome duplication could be further divided into tph1a and tph1b. Moreover, protein sequence comparisons indicated that TPH protein changes among vertebrates were concentrated at the NH2-terminal. The tertiary structures of TPH1 and TPH2 revealed obvious differences in the structural elements. Five positively selected sites were characterized in TPH2 compared with TPH1; these sites may reflect the functional divergence in enzyme activity and substrate specificity. In summary, our current work provides novel insights into the evolution of tph genes in vertebrates from a comprehensive genomic perspective.

Description: Mediterranean spotted fever develops from an infection with Rickettsia conorii, an obligate intracellular, Gram-negative, endotheliotropic, and tick-transmitted bacterial pathogen, and is an acute, febrile illness that can progress to life-threatening complications if not diagnosed and treated early with effective antibiotics. Despite significant morbidity and mortality, little is known about changes in gene expression that determine the host responses during in vivo infection. We have investigated the transcriptional landscape of host lungs as a prominently affected organ system in an established murine model of infection by RNA-sequencing. Ingenuity pathway analysis resulted in the identification of 1332 differentially expressed genes and 292 upstream regulators. Notably, genes encoding for ubiquitin D, aconitate decarboxylase, antimicrobial peptides, calgranulins, cytokines and chemokines, and guanylate binding proteins were highly up-regulated, whereas those involved in hemoglobin biosynthesis and heme homeostasis were significantly down-regulated. Amongst response regulators, nucleotide-binding oligomerization domain-containing protein 2 and killer cell lectin-like receptors were differentially expressed, and gene clustering revealed eukaryotic initiation factor-2, oxidative phosphorylation, and ubiquitination as the predominantly activated biological pathways. Collectively, this first global transcriptomic profiling has identified R. conorii-induced regulation of novel genes and pathways in the host lungs, further in-depth investigation of which will strengthen our understanding of the pathogenesis of human rickettsioses.

Description: Çatalhöyük is one of the most widely recognized and extensively researched Neolithic settlements. The site has been used to discuss a wide range of aspects associated with the spread of the Neolithic lifestyle and the social organization of Neolithic societies. Here, we address both topics using newly generated mitochondrial genomes, obtained by direct sequencing and capture-based enrichment of genomic libraries, for a group of individuals buried under a cluster of neighboring houses from the classical layer of the site’s occupation. Our data suggests a lack of maternal kinship between individuals interred under the floors of Çatalhöyük buildings. The findings could potentially be explained either by a high variability of maternal lineages within a larger kin group, or alternatively, an intentional selection of individuals for burial based on factors other than biological kinship. Our population analyses shows that Neolithic Central Anatolian groups, including Çatalhöyük, share the closest affinity with the population from the Marmara Region and are, in contrast, set further apart from the Levantine populations. Our findings support the hypothesis about the emergence and the direction of spread of the Neolithic within Anatolian Peninsula and beyond, emphasizing a significant role of Central Anatolia in this process.

Description: Piwi-interacting RNAs (piRNAs) control transposable element (TE) activity in the germline. piRNAs are produced from single-stranded precursors transcribed from distinct genomic loci, enriched by TE fragments and termed piRNA clusters. The specific chromatin organization and transcriptional regulation of Drosophila germline-specific piRNA clusters ensure transcription and processing of piRNA precursors. TEs harbour various regulatory elements that could affect piRNA cluster integrity. One of such elements is the suppressor-of-hairy-wing (Su(Hw))-mediated insulator, which is harboured in the retrotransposon gypsy. To understand how insulators contribute to piRNA cluster activity, we studied the effects of transgenes containing gypsy insulators on local organization of endogenous piRNA clusters. We show that transgene insertions interfere with piRNA precursor transcription, small RNA production and the formation of piRNA cluster-specific chromatin, a hallmark of which is Rhino, the germline homolog of the heterochromatin protein 1 (HP1). The mutations of Su(Hw) restored the integrity of piRNA clusters in transgenic strains. Surprisingly, Su(Hw) depletion enhanced the production of piRNAs by the domesticated telomeric retrotransposon TART, indicating that Su(Hw)-dependent elements protect TART transcripts from piRNA processing machinery in telomeres. A genome-wide analysis revealed that Su(Hw)-binding sites are depleted in endogenous germline piRNA clusters, suggesting that their functional integrity is under strict evolutionary constraints.

Description: Chinese kale is a native vegetable in Southern China and the flowering stalk is the most commonly used edible part due to its high glucosinolate content and other nutritional qualities. The GTR protein played important roles in the glucosinolate transport process. In this study, three BocGTR1 genes were cloned from Chinese kale for the first time. Their gene structure, physicochemical properties, signal peptides, transmembrane structures, functional domains, second and third-order protein structures, and phylogenetic relationships were predicted. The expression levels of BocGTR1a and BocGTR1c were much higher than those of BocGTR1b in various tissues, especially in leaves and buds. In addition, the expression patterns of three genes were examined under various abiotic stresses or hormone treatment, including those induced by wounding, heat stress, methyl jasmonate, salicylic acid, salt, and MgCl2 treatment. BocGTR1a and BocGTR1c were strongly induced by wounding and heat stress. The expression of BocGTR1a and BocGTR1c was significantly silenced in plants transformed by RNAi technology. Total glucosinolate content was significantly decreased in mature leaves and increased in roots of RNAi-transformed plants compared to wild-type plants. In addition, we found that BocGTR1a and BocGTR1c may participate in glucosinolate accumulation in different tissues with a selection for specific glucosinolates. These results indicated that BocGTR1a and BocGTR1c may be the key genes involved in the glucosinolate accumulation in different tissues of Chinese kale.