ALBERT

Beschreibung: We proposed and studied an impact detection system based on a fiber Bragg grating (FBG) sensor array and multiple signal classification (MUSIC) algorithm to determine the location and the number of low velocity impacts on a carbon fiber-reinforced polymer (CFRP) plate. A FBG linear array, consisting of seven FBG sensors, was used for detecting the ultrasonic signals from impacts. The edge-filter method was employed for signal demodulation. Shannon wavelet transform was used to extract narrow band signals from the impacts. The Gerschgorin disc theorem was used for estimating the number of impacts. We used the MUSIC algorithm to obtain the coordinates of multi-impacts. The impact detection system was tested on a 500 mm × 500 mm × 1.5 mm CFRP plate. The results show that the maximum error and average error of the multi-impacts’ localization are 9.2 mm and 7.4 mm, respectively.

Beschreibung: Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.

Beschreibung: Introduction: Hematopoietic stem cell transplantation (HSCT) is a potentially curative or consolidative therapy for a large number of hematological diseases. Sexual dysfunction (SD) and abnormal level of the sexual hormone are common in patients after HSCT, which are usually caused by intensive myeloablative conditioning. The change of sexual hormone level and SD resulted in the poor quality of life in this population after transplantation. The current aims of this study were to determine: (i) the incidence rate of SD and the association with androgen post both autologous (auto) and allogeneic (allo) HSCT; (ii) multi-factors analysis between SD and clinical characteristics, primary diease, donor type, cGVHD, etc; (iii) the association of androgen with cGVHD and glucocorticoid (GC) therapy. Methods: From April 2010 to February 2019, a total of 126 (74 males and 52 females) patients with hematological diseases undergoing HSCT were enrolled in our study. The reason for the small sample of patients was that only 126 patients completed our Sexual Function Questionnaire. Controls were 108 healthy, age and gender matched persons came from Medical Examiniation Center of our hospital. Assessment indexes included clinical characteristics, donor type, GVHD incidence, sex hormone levels, and Sexual Functioning Questionnaire (SFQ). The SFQ was implemented by the team members of our research group through a telephone interview, email, paper letter, and WeChat. All of the information and privacy of each patient was strictly conserved. Results: 1. Clinical characteristics of the 126 patients who underwent HSCT were shown in Table 1. The median age of the patients was 38 years old (range 16-66) and the follow up after HSCT was from 6 months to 7 years. The predominant disease spectra were multiple myeloma (MM) and acute leukemia in auto- and allo-HSCT group, respectively. Our results showed a significant difference in gender (P

Beschreibung: Objective: Retrospectively analysing the outcome of additional medium-dose etoposide (VP-16 30mg/kg) in allogeneic hematopoietic stem cell transplantation (allo-HSCT) for acute lymphoblastic leukemia (ALL). Methods: From 2010.10.1 to 2018.6.30, 53 ALL patients received allo-HSCT in Shandong provincial hospital. 20 conditioning with medium-dose VP-16 (15 in CR , 5 in refractory and/or relapse disease) (VP-16 group), 33 conditioning without medium-dose VP-16 (32 in CR and 1 in refractory and/or relapse disease) (control group) . The basic conditions of the primary disease, treatment-related toxicity, leukemia-free survival (LFS), overall survival (OS), graft-versus-host disease (GVHD) and relapse-free survival (GRFS), non-relapse mortality (NRM), relapse incidence (RI), GVHD and so on were compared between the two groups. Results: The VP-16 group included more R/R(refractory and/or relapse disease) patients and was associated with improved 3-year-LFS (70.7% vs. 56.5%, p= 0.565) and 3-year-OS (68% vs. 59.4%, p=0.825), although there was no statistical difference. Moreover, the additional of VP-16 lead to reduced incidence of aGVHD (II,III,IV) (10% vs. 30.7%, p=0.146) and cGVHD (9.1% vs 24%, p=0.25), resulting in improved GRFS (63.6% vs. 48.7%, P=0.343). RI was similar between the two group (29.3% vs 27.2%, p=0.76). Meanwhile, the addition of VP-16 enhanced the intensity of conditioning regimen, its NRM was relatively lower than control group (0% vs. 20.2%, P=0.371). Conclusion: The intensified conditioning regimen with medium-dose VP-16 did not increase NRM and GVHD, with tendency to increase OS and LFS, may become an effective pre-treatment scheme in allo-HSCT for ALL. Disclosures No relevant conflicts of interest to declare.

Beschreibung: Introduction: B-cell non-Hodgkin lymphoma is the most frequent type of non-Hodgkin's lymphoma. RCHOP regimen is established as the standard therapy for aggressive and indolent B-cell NHL, which has a 10%-20% rate of febrile neutropenia (FN). Recently, pegylated recombinant human granulocyte colony stimulating factor (PEG-rhG-CSF) is frequently used in clinical practice. This randomized controlled clinical study was conducted to investigate the efficacy and safety of prophylactic PEG-rhG-CSF in patients with B-cell non-Hodgkin lymphoma on RCHOP chemotherapy. Methods:We included 162 patients with pathological diagnosis of B-cell non-Hodgkin lymphoma including diffuse large B-cell lymphoma, follicular lymphoma and mantle cell lymphoma (MCL),from October 2016 to May 2019 at Shandong Provincial Hospital Affiliated to Shandong University. All patients gave written informed consent in accordance with the Declaration of Helsinki. The patients were randomized into PEG-rhG-CSF and rhG-CSF groups. Each patient received three cycles of chemotherapy with identical RCHOP regimens. In the study group, the patients received PEG-rhG-CSF 6mg(weight≥45Kg)or 3mg(weight≤45Kg)once 24 hours after the end of chemotherapy drugs of every chemotherapy cycle. In the control group, they weren't preventively administered rhG-CSF. If their neutrophil count (ANC)≤1.0×109/L, they were administered rhG-CSF:5ug/kg/day until their neutrophil count (ANC)≥2.0×109/L. The primary endpoint was the incidence of III/IV grade neutropenia and febrile neutropenia(FN) after each chemotherapy cycle. Meanwhile the rate of antibiotics application and safety were observed. Analyses were performed with SPSS Statistics 20.0 (IBM-SPSS, Chicago, Illinois). The numerical data was presented as mean ± SD. Statistical analysis was performed using one-way analysis of variance and chi-square test. A p-value

Beschreibung: Background: Late-onset hemorrhagic cystitis (LO-HC) is one of the common complications and major causes of morbidity in patients undergoing allogeneic hematopoietic stem cell transplantation (allo-HSCT). The classic treatment for HC includes hydration, alkalization, bladder irrigation, immunosuppressant reduction, and platelet transfusion. When the HC was considered to be associated with aGVHD, more immunosuppressive agents such as glucocorticoids will be added in. However, too intensive immunosuppressive measures leave the patients susceptible to infection and, in turn, increases the accidence of non-relapse mortality (NRM). It is important to explore novel, less-toxic, more effective, and cost-effective strategies for LO-HC. Hyperbaric oxygen therapy (HBOT) can stimulate fibroblast proliferation, angiogenesis, and wound healing. We deduce that HBOT might benefit patients with LO-HC after allo-HSCT. Methods: In this study, we retrospectively analyzed 238 patient underwent allo-HSCT in our center. From 2018, patients with LO-HC have been given HBOT in addition to conventional treatment in our center. The data in HBOT and the control group were collected and compared. Patients' characteristics were compared using the x2 test in case of discrete variables or the Mann-Whitney test in case of continuous variables. Logistic regression examined factors might be used as effective predictors for HBOT. Sensitivity and specificity were estimated based on four parameters cut-off point for additional glucocorticoid necessity. Results: A total of 238 patients who underwent allo-HSCT from 2014 to 2020 were enrolled in this study. Among them, 55 (23.11%) developed LO-HC (36 received regular treatment, and 19 received HBOT in addition to the regular therapy). The clinical & transplantation parameters of the patients with LO-HC were listed in table 1. There is no significant difference in the age, gender, primary disease distribution, conditioning regimen, donor, HLA compatibility, stem cell sources, the occurrence of aGVHD between two groups. There is also no significant difference in the initial day of LO-HC post-HSCT and duration, peak red cells count in the urine, and whether additional glucocorticoid for HC control had been added between the two groups. It is worth noting that compared with the HBOT group, we found higher HC grade distribution, higher CMV-DNA copies, and decreased levels of SOD2 within the 1st week of the initial therapy for LO-HC in the control group. The comparison of the demographic and medical characteristics of subjects with LO-HC were listed in table 2. According to the results of logistic regression analysis, patients who developed LO-HC with higher HC grade (p = 0.001) and decreased SOD2 level (p = 0.002) might benefit more from HBOT, indicating that they might be used as effective predictors for HBOT (Figure 1A). Only higher HC grade (p = 0.011) could predict whether or not additional glucocorticoid would be necessary for LO-HC control (Figure 1B). The predictive power of additional glucocorticoid during the LO-HC treatment process for 4 different titers (HC grade and duration, CMV, and SOD2 level) was evaluated by ROC analysis. According to the area under the curve (AUC), the best diagnostic capabilities of four parameters were shown in Figure 2A, 2B, 2C, and 2D. None of our patients experienced severe adverse events of HBOT, such as gas emboli, pulmonary edema, and seizures. Only one patient with AML discontinued after 1 session due to the reversible ear barotrauma which was suspected with HOBT. Conclusions: In summary, HBOT was effective and well-tolerated in patients with LO-HC post-allo-HSCT. Patients who received HBOT exhibited with short disease duration and mild LO-HC grade. Higher HC grade and decreased SOD2 levels might be used as effective predictors for HBOT. Higher HC grade might be used as a predictor to determine whether or not additional glucocorticoid would be necessary for HC control. In the future, HBOT might be not only used as an adjunctive care application for LO-HC, but also might be as the first-line treatment therapy for this population, regardless of the causes of LO-HC. Based on our preliminary result, we plan to enroll more eligible patients to establish the definitive efficacy and safety of HBOT in patients with LO-HC after allo-HSCT (NCT04502628). Disclosures No relevant conflicts of interest to declare.