ALBERT — All Library Books, journals and Electronic Records Telegrafenberg

1

Unknown

Mitochondrial DNA stress primes the antiviral innate immune response (2015)

A. P. West ; W. Khoury-Hanold ; M. Staron ; [et al.]

Nature Publishing Group (NPG)

In: Nature. 520(7548): 553-7. doi: 10.1038/nature14156.

add to mindlist on the mindlist

Details

Publication Date: 2015-02-03

Description: Mitochondrial DNA (mtDNA) is normally present at thousands of copies per cell and is packaged into several hundred higher-order structures termed nucleoids. The abundant mtDNA-binding protein TFAM (transcription factor A, mitochondrial) regulates nucleoid architecture, abundance and segregation. Complete mtDNA depletion profoundly impairs oxidative phosphorylation, triggering calcium-dependent stress signalling and adaptive metabolic responses. However, the cellular responses to mtDNA instability, a physiologically relevant stress observed in many human diseases and ageing, remain poorly defined. Here we show that moderate mtDNA stress elicited by TFAM deficiency engages cytosolic antiviral signalling to enhance the expression of a subset of interferon-stimulated genes. Mechanistically, we find that aberrant mtDNA packaging promotes escape of mtDNA into the cytosol, where it engages the DNA sensor cGAS (also known as MB21D1) and promotes STING (also known as TMEM173)-IRF3-dependent signalling to elevate interferon-stimulated gene expression, potentiate type I interferon responses and confer broad viral resistance. Furthermore, we demonstrate that herpesviruses induce mtDNA stress, which enhances antiviral signalling and type I interferon responses during infection. Our results further demonstrate that mitochondria are central participants in innate immunity, identify mtDNA stress as a cell-intrinsic trigger of antiviral signalling and suggest that cellular monitoring of mtDNA homeostasis cooperates with canonical virus sensing mechanisms to fully engage antiviral innate immunity.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4409480/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉 〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4409480/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉West, A Phillip -- Khoury-Hanold, William -- Staron, Matthew -- Tal, Michal C -- Pineda, Cristiana M -- Lang, Sabine M -- Bestwick, Megan -- Duguay, Brett A -- Raimundo, Nuno -- MacDuff, Donna A -- Kaech, Susan M -- Smiley, James R -- Means, Robert E -- Iwasaki, Akiko -- Shadel, Gerald S -- F31 AG039163/AG/NIA NIH HHS/ -- F32 DK091042/DK/NIDDK NIH HHS/ -- MOP37995/Canadian Institutes of Health Research/Canada -- P01 ES011163/ES/NIEHS NIH HHS/ -- R01 AG047632/AG/NIA NIH HHS/ -- R01 AI054359/AI/NIAID NIH HHS/ -- R01 AI081884/AI/NIAID NIH HHS/ -- T32 AI055403/AI/NIAID NIH HHS/ -- UL1 TR000142/TR/NCATS NIH HHS/ -- England -- Nature. 2015 Apr 23;520(7548):553-7. doi: 10.1038/nature14156. Epub 2015 Feb 2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Yale School of Medicine, New Haven, Connecticut 06520, USA. ; Department of Immunobiology, Yale School of Medicine, New Haven, Connecticut 06520, USA. ; Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta T6G 2S2, Canada. ; Department of Pathology and Immunology, Washington University School of Medicine, St Louis, Missouri 63110, USA. ; 1] Department of Immunobiology, Yale School of Medicine, New Haven, Connecticut 06520, USA [2] Howard Hughes Medical Institute, Chevy Chase, Maryland 20815-6789, USA. ; 1] Department of Pathology, Yale School of Medicine, New Haven, Connecticut 06520, USA [2] Department of Genetics, Yale School of Medicine, New Haven, Connecticut 06520, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/25642965" target="_blank"〉PubMed〈/a〉

Keywords: Animals ; Cell Line ; DNA, Mitochondrial/*metabolism ; DNA-Binding Proteins/deficiency/genetics/metabolism ; Female ; Gene Expression Regulation/genetics/immunology ; Herpesvirus 1, Human/*immunology ; High Mobility Group Proteins/deficiency/genetics/metabolism ; Humans ; Immunity, Innate/*immunology ; Interferon Regulatory Factor-3/metabolism ; Interferon Type I/immunology ; Membrane Proteins/metabolism ; Mice ; Nucleotidyltransferases/metabolism ; *Stress, Physiological

Print ISSN: 0028-0836

Electronic ISSN: 1476-4687

Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics

Published by Nature Publishing Group (NPG)

Permalink

	Location	Call Number	Expected	Availability

Others were also interested in ...

PAPER CURRENT

S·F·X

Fulltext

2

Unknown

TLR signalling augments macrophage bactericidal activity through mitochondrial ROS (2011)

A. P. West ; I. E. Brodsky ; C. Rahner ; [et al.]

Nature Publishing Group (NPG)

In: Nature. 472(7344): 476-80. doi: 10.1038/nature09973.

add to mindlist on the mindlist

Details

Publication Date: 2011-04-29

Description: Reactive oxygen species (ROS) are essential components of the innate immune response against intracellular bacteria and it is thought that professional phagocytes generate ROS primarily via the phagosomal NADPH oxidase machinery. However, recent studies have suggested that mitochondrial ROS (mROS) also contribute to mouse macrophage bactericidal activity, although the mechanisms linking innate immune signalling to mitochondria for mROS generation remain unclear. Here we demonstrate that engagement of a subset of Toll-like receptors (TLR1, TLR2 and TLR4) results in the recruitment of mitochondria to macrophage phagosomes and augments mROS production. This response involves translocation of a TLR signalling adaptor, tumour necrosis factor receptor-associated factor 6 (TRAF6), to mitochondria, where it engages the protein ECSIT (evolutionarily conserved signalling intermediate in Toll pathways), which is implicated in mitochondrial respiratory chain assembly. Interaction with TRAF6 leads to ECSIT ubiquitination and enrichment at the mitochondrial periphery, resulting in increased mitochondrial and cellular ROS generation. ECSIT- and TRAF6-depleted macrophages have decreased levels of TLR-induced ROS and are significantly impaired in their ability to kill intracellular bacteria. Additionally, reducing macrophage mROS levels by expressing catalase in mitochondria results in defective bacterial killing, confirming the role of mROS in bactericidal activity. These results reveal a novel pathway linking innate immune signalling to mitochondria, implicate mROS as an important component of antibacterial responses and further establish mitochondria as hubs for innate immune signalling.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3460538/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉 〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3460538/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉West, A Phillip -- Brodsky, Igor E -- Rahner, Christoph -- Woo, Dong Kyun -- Erdjument-Bromage, Hediye -- Tempst, Paul -- Walsh, Matthew C -- Choi, Yongwon -- Shadel, Gerald S -- Ghosh, Sankar -- NS-056206/NS/NINDS NIH HHS/ -- R01 AI033443/AI/NIAID NIH HHS/ -- R01 NS056206/NS/NINDS NIH HHS/ -- R37 AI033443/AI/NIAID NIH HHS/ -- R37-AI33443/AI/NIAID NIH HHS/ -- England -- Nature. 2011 Apr 28;472(7344):476-80. doi: 10.1038/nature09973.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Immunobiology, Yale University School of Medicine, New Haven, Connecticut 06520, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/21525932" target="_blank"〉PubMed〈/a〉

Keywords: Adaptor Proteins, Signal Transducing/deficiency/genetics/metabolism ; Animals ; Catalase/genetics/metabolism ; Cell Line ; Immunity, Innate ; Macrophages/cytology/*immunology/*metabolism ; Mice ; Mice, Inbred C57BL ; Mice, Transgenic ; Mitochondria/*metabolism ; Phagosomes/metabolism ; Reactive Oxygen Species/*metabolism ; Salmonella/immunology ; *Signal Transduction ; TNF Receptor-Associated Factor 6/metabolism ; Toll-Like Receptors/*immunology/metabolism ; Ubiquitin-Protein Ligases/metabolism ; Ubiquitination

Print ISSN: 0028-0836

Electronic ISSN: 1476-4687

Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics

Published by Nature Publishing Group (NPG)

Permalink

	Location	Call Number	Expected	Availability

Others were also interested in ...

PAPER CURRENT

S·F·X

Fulltext

3

Electronic Resource

Autoinducer-independent mutants of the LuxR transcriptional activator exhibit differential effects on the two lux promoters of Vibrio fischeri (1996)

Sitnikov, Dmitry M. ; Shadel, G. S. ; Baldwin, T. O.

Springer

Molecular genetics and genomics 252 (1996), S. 622-625

add to mindlist on the mindlist

Details

ISSN: 1617-4623

Keywords: Key words Vibrio fischeri ; Luminescence ; LuxR ; Quorum sensing ; Autoinducer

Source: Springer Online Journal Archives 1860-2000

Topics: Biology

Notes: Abstract The LuxR protein is a transcriptional activator which, together with a diffusible small molecule termed the autoinducer [N-(3-oxohexanoyl)-L-homoserine lactone], represents the primary level of regulation of the bioluminescence genes in Vibrio fischeri. LuxR, in the presence of autoinducer, activates transcription of the luxICDABEG gene cluster and both positively and negatively autoregulates transcription of the divergently oriented luxR gene, activating transcription at low levels of autoinducer, and repressing synthesis at high autoinducer concentration. Seven LuxR point mutants which activate V. fischeri lux transcription in the absence of autoinducer (LuxR*) have been characterized. The LuxR* proteins activated transcription of the bioluminescence genes to levels 1.5–40 times that achieved by wild-type LuxR without autoinducer. All of the LuxR* mutants retained responsiveness to autoinducer. However, in each case the degree of stimulation in response to autoinducer was lower than that observed for wild-type LuxR. The LuxR* proteins retained the requirement for autoinducer for autoregulation of the luxR gene. We propose that the LuxR protein exists in two conformations, an inactive form, and an active form which predominates in the presence of autoinducer. The LuxR* mutations appear to shift the equilibrium distribution of these two forms so as to increase the amount of the active form in the absence of autoinducer, while autoinducer can still convert inactive to active species. The differential effects of the LuxR* proteins at the two lux promoters suggest that LuxR stimulates P luxR transcription by a different mechanism to that used at the P luxI promoter, implying that binding of LuxR to its binding site, known to be necessary for transcriptional activation, may not be sufficient.

Type of Medium: Electronic Resource

URL: http://dx.doi.org/10.1007/BF02172408

Permalink

	Location	Call Number	Expected	Availability

Others were also interested in ...

Paper (German National Licenses)

Fulltext

4

Electronic Resource

Autoinducer-independent mutants of the LuxR transcriptional activator exhibit differential effects on the twolux promoters ofVibrio fischeri (1996)

Sitnikov, D. M. ; Shadel, G. S. ; Baldwin, T. O.

Springer

Molecular genetics and genomics 252 (1996), S. 622-625

add to mindlist on the mindlist

Details

ISSN: 1617-4623

Keywords: Vibrio fischeri ; Luminescence ; LuxR ; Quorum sensing ; Autoinducer

Source: Springer Online Journal Archives 1860-2000

Topics: Biology

Notes: Abstract The LuxR protein is a transcriptional activator which, together with a diffusible small molecule termed the autoinducer [N-(3-oxohexanoyl)-l-homoserine lactone], represents the primary level of regulation of the bioluminescence genes inVibrio fischeri. LuxR, in the presence of autoinducer, activates transcription of theluxICDABEG gene cluster and both positively and negatively autoregulates transcription of the divergently orientedluxR gene, activating transcription at low levels of autoinducer, and repressing synthesis at high autoinducer concentration. Seven LuxR point mutants which activateV. fischeri lux transcription in the absence of autoinducer (LuxR*) have been characterized. The LuxR* proteins activated transcription of the bioluminescence genes to levels 1.5–40 times that achieved by wild-type LuxR without autoinducer. All of the LuxR* mutants retained responsiveness to autoinducer. However, in each case the degree of stimulation in response to autoinducer was lower than that observed for wild-type LuxR. The LuxR* proteins retained the requirement for autoinducer for autoregulation of theluxR gene. We propose that the LuxR protein exists in two conformations, an inactive form, and an active form which predominates in the presence of autoinducer. The LuxR* mutations appear to shift the equilibrium distribution of these two forms so as to increase the amount of the active form in the absence of autoinducer, while autoinducer can still convert inactive to active species. The differential effects of the LuxR* proteins at the twolux promoters suggest that LuxR stimulatesP luxR transcription by a different mechanism to that used at the P luxI promoter, implying that binding of LuxR to its binding site, known to be necessary for transcriptional activation, may not be sufficient.

Type of Medium: Electronic Resource

URL: http://dx.doi.org/10.1007/BF02172408

Permalink

	Location	Call Number	Expected	Availability

Others were also interested in ...

Paper (German National Licenses)

Fulltext

5

Electronic Resource

The complete nucleotide sequence of the lux regulon of Vibrio fischeri and the luxABN region of Photobacterium leiognathi and the mechanism of control of bacterial bioluminescence (1989)

Baldwin, T. O. ; Devine, J. H. ; Heckel, R. C. ; [et al.]

New York : Wiley-Blackwell

Journal of Bioluminescence and Chemiluminescence 4 (1989), S. 326-341

add to mindlist on the mindlist

Details

ISSN: 0884-3996

Keywords: Nucleotide sequence ; genetic regulation ; bacterial luciferase ; amino acid sequence ; luxR ; autoinducer ; luxN ; Chemistry ; Biochemistry and Biotechnology

Source: Wiley InterScience Backfile Collection 1832-2000

Topics: Biology , Chemistry and Pharmacology

Notes: We have determined the complete nucleotide sequence of a 7622 base pair fragment of DNA from Vibrio fischeri strain ATCC7744 that contains all the information required to confer plasmid-borne, regulated bioluminescence upon strains of Escherichia coli. The lux regulon from V. fischeri consists of two divergently transcribed operons, L (left) and R (right), and at least seven genes, luxR (L operon) and luxICDABE (R operon) and the intervening control region. The luxA and luxB genes encode respectively the α and β subunits of luciferase. The gene order luxCDABE seen in V. fischeri is the same as for V. harveyi. We have determined the sequence of the luxAB and flanking regions from Photobacterium leiognathi and have found upstream sequences homologous with luxC from the Vibrio species, but between luxB and luxE, there is an open reading frame encoding a protein of 227 amino acids (26,229 molecular weight) that is not found in this location in the Vibrio species. The amino terminal amino acid sequence of the encoded protein is nearly identical to that determined by O'Kane and Lee (University of Georgia) for the non-fluorescent flavoprotein from a closely related Photobacterium species (Dr Dennis O'Kane, personal communication). We have therefore designated this gene luxN.There is a 20-base inverted repeat ACCTGTAGGA×TCGTACAGGT, centred between bases 927 and 928 in the region between the two operons of V. fischeri. This region appears to fulfil two functions: it is critical for the LuxR protein to exert its effect and it is a consensus binding site for the E. coli LexA protein, a negative regulatory protein involved with the SOS response. There are sequences within the luxR coding region that appear to function in a cis-acting fashion to repress transcription from both the leftward and rightward promoters in the absence of the respective transcriptional activator proteins, thereby resulting in low basal levels of transcription. It now appears clear that there are multiple levels of control on the lux system allowing for a modulation of the intensity of bioluminescence of over four orders of magnitude.

Additional Material: 11 Ill.

Type of Medium: Electronic Resource

URL: http://dx.doi.org/10.1002/bio.1170040145

Permalink

	Location	Call Number	Expected	Availability

Others were also interested in ...

Paper (German National Licenses)

Fulltext

6

Electronic Resource

Control of the lux regulon of Vibrio fischeri (1990)

Shadel, G. S. ; Devine, J. H. ; Baldvvin, T. O.

New York : Wiley-Blackwell

Journal of Bioluminescence and Chemiluminescence 5 (1990), S. 99-106

add to mindlist on the mindlist

Details

ISSN: 0884-3996

Keywords: Bioluminescence ; Vibrio fischeri ; positive feedback ; transcriptional regulation ; operator ; LexA ; LuxR ; Chemistry ; Biochemistry and Biotechnology

Source: Wiley InterScience Backfile Collection 1832-2000

Topics: Biology , Chemistry and Pharmacology

Notes: Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxl, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP- dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxl gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of Luxl and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region. Hence there appear to be at least two effects resulting from the interaction between LuxR: autoinducer and the control region DNA. One effect is to relieve the repression afforded by the sequences within luxR and the second is to stimulate transcription from PR. Recent analysis of the rightward promotor by site-directed mutagenesis has suggested a different location for PR than that which was implicated in earlier studies. Our results suggest that the -35 sequence is located at a position which overlaps the 3′ edge of the LuxR binding site by one base pair.

Additional Material: 7 Ill.

Type of Medium: Electronic Resource

URL: http://dx.doi.org/10.1002/bio.1170050205

Permalink