ALBERT

Description: Despite the tremendous growth of the DNA sequencing data in the last decade, our understanding of the human genome is still in its infancy. To understand the implications of genetic variants in the light of population genetics and molecular evolution, we developed a database, PGG.SNV (https://www.pggsnv.org), which gives much higher weight to previously under-investigated indigenous populations in Asia. PGG.SNV archives 265 million SNVs across 220,147 present-day genomes and 1018 ancient genomes, including 1009 newly sequenced genomes, representing 977 global populations. Moreover, estimation of population genetic diversity and evolutionary parameters is available in PGG.SNV, a unique feature compared with other databases.

Description: Background: According to the 2016 revised World Health Organization (WHO) Classification of Lymphoid Tumors, high grade B-cell lymphoma (HGBL) has been delimited as a new category with two subgroups: HGBL with rearrangements of MYC and BCL2 and/or BCL6 (so-called "double/triple hit lymphoma), and HGBL-NOS (HGBLs with features intermediate between DLBCL and Burkitt lymphoma). Retrospective data indicated many patients with HGBL diagnosed at an advanced stage and often have extremely poor outcome even if they received intensive chemotherapy. The accurate genetic and pathological mechanism of this high-risk lymphoma remains uncertain. For HGBL, traditional scoring may not be systematic enough and has limited reference value, more accurate prognostic grouping indicators are needed. The aim of this study was to evaluate the clinicopathological significances in newly diagnosed HGBL and DLBCL. Several clinical and hematological indexes in concert with Fluorescence in situ hybridization (FISH) rearrangement and Immunohistochemistry (IHC) expression profiles of biomarkers between HGBL and DLBCL will also be analyzed. Methods: We reviewed 52 patients diagnosed as HGBL or DLBCL in our hospital from 2017 to 2018 retrospectively. The clinical and hematological characteristics of the patients including age, gender, Ann-Arbor stage, B symptoms, serum LDH levels, β2-microglobulin (β2-MG), peripheral EBV-DNA copies, white blood cell (WBC), absolute neutrophil count (ANC), absolute lymphocyte count (ALC), and IPI score were collected. FISH detection was done in each patient to identify whether the patient had MYC, BCL2, and BCL6 rearrangement. The expressions of the above three indexes were done by IHC as well. NLR (neutrophil to lymphocyte ratio) was definited as ANC/ALC ratio. Results: A total of 52 newly diagnosed patients were included in this study, including 34 (65.4%) males and 18 (34.6%) females. The median age at diagnosis was 54.1 years old (range, 15-88 years), and 22 (42.3%) of them were more than 60 years old. Six patients were classified into the HGBL category and 2 of them were HGBL-NOS subgroup. Twenty-five patients were MYC, BCL2, or BCL6 rearrangement single-positive. Among them, MYC, BCL2, and BCL6 rearrangement were detected in 13.5%, 7.7%, and 30.8% of 52 patients respectively.MYC (cut-off value 〉40%), BCL2 (cut-off value 〉50%), and BCL6 expression was found in 48.1%, 50%, and 65.4% of 52 patients, respectively. Among all of the patients, 32.7% (17/52) CD5 positive and 73.1% (38/52) MUM1 positive. 30.8% (16/52) of them were at stage Ⅰ/Ⅱ and 69.2% (36/52) of them were at stage Ⅲ/Ⅳ. 53.8% (28/52) of the patients had a high blood LDH level, 26.9% (14/52) showed an elevation of β2-MG level (〉3mg/L) and 38.5% (20/52) presented high IPI score (IPI〉2). The baseline clinical, hematological, and pathological characteristics are described in Table 1, 2. 3. With Pearson's Chi-square Tests analysis, the IPI score was significantly higher in patients older than 60 years old (P

Description: Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.

Description: Introduction Dysregulation of proliferation and apoptosis is associated the pathogenesis of CLL. More recently, Metadherin (MTDH) involved in aberrant proliferation, survival, and increased migration, invasiveness, and metastasis of tumor cells, has been demonstrated as a potential crucial mediator of various types of huamn malignancies. MTDH promotes tumor progression by modulating multiple oncogenic signaling pathways (NF-kB, PI3K/Akt and Wnt/beta-catenin). However, there is no report about the role of MTDH in CLL. Since Wnt signaling pathway had been proven to be unusual activated in CLL, the objective of this study was to investigate the role of MTDH in CLL and the relationship between MTDH and Wnt/beta-catenin signaling pathway. Methods Peripheral blood mononuclear cells (PBMCs) came from samples of 31 CLL patients. The characteristics of CLL patients were shown in Table 1. CD19+B cells were selected from peripheral blood of age-matched heathy donor, cord blood, bone marrow and tonsil of normal controls using CD19+ magnetic selection kits and detected the purity with anti-CD19-PE antibody by flow cytometry. Qantitative PCR and Western blot were used to detect the expression of mRNA and protein for MTDH, and the key functional components of Wnt/beta-catenin signaling pathway (beta-catenin and LEF-1). We also measured MTDH level in B cells by flow cytometry after intracellular staining. CLL cell line(MEC-1) were infected by lentivirus to interfer MTDH and the infection efficiencies were determined by fluorescence microscope and flow cytometry. Both primary CLL cells and MEC-1 were exposed to 10ug/ml goat F(ab`)2 anti-human IgM for 48hours to mimic activation of BCR. The proliferation and apoptosis of these cells were evaluated by CCK-8 method and Annexin V kits. Results mRNA of MTDH in PBMCs of 31 CLL patients were overexpression compared with CD19+ B cells coming from 15 age-matched healthy donors (Figure 1A). 27 out of 31 CLL samples were detected MTDH expression in protein level but none in normal controls (Figure 1B). The expression of MTDH was associated with Rai staging of CLL. There were no MTDH detection in CD19+ B cells collected from bone marrow, peripheral blood, tonsil and cord blood, which stand for precursor, mature, germinal center, and lineage B cells, respectively. The transfection efficiency of MEC-1 cells by interfering MTDH expression with Lentivirus was shown in Figure 1C. The level of MTDH knockdown was accompanied with LEF-1 downregulation (Figure 1D, 1E), as well as the downregulation of c-myc and cyclinD1 expression (Figure 1F). siRNA targeting MTDH treatment in MEC-1 decreased the proliferation and increased the apoptosis(Figure 2A, 2B). We further observed that the proliferation and MTDH expression both in CLL cells and MEC-1 were upregulation after stimulation of anti-human IgM (Figure 2C, 2D, 2E). This effect in the proliferation was blocked by MTDH inteference (Figure 2F). Conclusions Our results demonstrated that MTDH is aberrant expression in B cells of CLL patients and correlated with clinical staging of CLL. MTDH was not expression in any subsets of normal B cells. MTDH may exert a preservative role through activation of Wnt signaling pathway. The CLL cell proliferation activation by BCR signaling pathway may be inhibited by MTDH interference. Our findings indicated that MTDH may be a potential therapeutic target of CLL. Disclosures: No relevant conflicts of interest to declare.

Description: Introduction N6-methyladenosine (m6A) RNA methylation is the most abundant epitranscriptomic modification, dynamically installed by the m6A methyltransferases (termed as "writers"), reverted by the demethylases (termed as "erasers"), and recognized by m6A binding proteins (termed as "readers"). Emerging evidence suggests that m6A RNA methylation regulates RNA stability, and participates in the pathogenesis of multiple diseases including cancers. Nevertheless, the role of m6A RNA methylation in chronic lymphocytic leukemia (CLL) remains to be unveiled. Herein, we hypothesized that m6A RNA methylation contributed to the tumorigenesis and maintenance of CLL. Moreover, the risk-prediction model integrated with the m6A regulators could serve as a novel and effective prognostic indicator in CLL. This study aimed to identify robust m6A RNA methylation-associated fingerprints for risk stratification in patients with CLL. Methods A total of 714 de novo CLL patients from 4 cohorts (China, Spain, Germany and Italy) were enrolled with informed consents. EpiQuik m6A RNA methylation colorimetric quantification assay was utilized to assess m6A RNA methylation levels. LASSO Cox regression algorithm was performed to calculate m6A RNA methylation-associated risk score (short for "m6A risk score") in R software. Besides, Kaplan-Meier survival analysis with log-rank test, univariate and multivariate Cox regression analyses and ROC curve analysis of overall survival (OS) were conduct to explore the prognostic value of m6A signature in CLL. Furthermore, RNA-seq, MeRIP-seq, Ribo-seq, functional enrichment analyses in silico and preclinical experiments ex vivo were applied to confirm the biological mechanism of the m6A regulators in CLL. Results In the present study, we performed a comprehensive analysis to dissect the role of m6A RNA methylation regulators in CLL. Compared with normal B cells from healthy donors, obvious decreased level of m6A RNA methylation was observed in primary CLL cells (p

Description: Abstract 3653 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is an aggressive malignancy of mature B lymphocytes with variable biological and cytogenetic features, as well as clinical outcomes. Further investigating specific biomarkers and cellular signaling pathways, understanding molecular pathogenesis of DLBCL and developing more targeted and effective treatments are indispensable for significantly increasing the survival and alleviating the suffering of patients. Metadherin (MTDH) has been demonstrated as a potentially crucial mediator of various types of human malignancies. It promotes tumor progression by modulating multiple oncogenic signaling pathways, such as NF-kB, PI3K/Akt and Wnt/b-catenin pathways. However, the expression and role of MTDH in DLBCL have not been reported yet. This study focuses on illuminating the role of MTDH and the relationship between MTDH and Wnt/b-catenin pathway in the pathogenesis of DLBCL. Methods: Sixteen fresh and thirty araffin-embedded tissues from DLBCL patients were collected. The tissues from patients of reactive hyperplasia of lymph node were used as control group. Peripheral blood mononuclear cells (PBMCs) from healthy volunteers served as normal control compared with human DLBCL cell lines LY1 and LY8. LY1 and LY8 cells were treated with tumor necrosis factor-a(TNF-a,250pg/ml) and cultured for 48 hours to induce the upregulation of MTDH protein. The expressions of MTDH and b-catenin mRNA in DLBCL tissues and controls were determined by quantitative PCR. MTDH and b-catenin protein expressions and localizations were examined by Western-blot analysis and immunohistochemical staining. The impacts of MTDH overexpression induced by TNF-a on LY1 and LY8 cells!&hibar; proliferation and apoptosis were assessed by 3H-TdR incorporation method and flow cytometry. The effects of MTDH upregulation on expression of total b-catenin and its nuclear translocation were analyzed by nuclear protein extraction and Western-blot analysis. Results: A remarkable elevation of MTDH and b-catenin on mRNA level was detected in DLBCL tissues (Figure 1A, P

Description: Introduction: B-cell non-Hodgkin lymphoma is the most frequent type of non-Hodgkin's lymphoma. RCHOP regimen is established as the standard therapy for aggressive and indolent B-cell NHL, which has a 10%-20% rate of febrile neutropenia (FN). Recently, pegylated recombinant human granulocyte colony stimulating factor (PEG-rhG-CSF) is frequently used in clinical practice. This randomized controlled clinical study was conducted to investigate the efficacy and safety of prophylactic PEG-rhG-CSF in patients with B-cell non-Hodgkin lymphoma on RCHOP chemotherapy. Methods:We included 162 patients with pathological diagnosis of B-cell non-Hodgkin lymphoma including diffuse large B-cell lymphoma, follicular lymphoma and mantle cell lymphoma (MCL),from October 2016 to May 2019 at Shandong Provincial Hospital Affiliated to Shandong University. All patients gave written informed consent in accordance with the Declaration of Helsinki. The patients were randomized into PEG-rhG-CSF and rhG-CSF groups. Each patient received three cycles of chemotherapy with identical RCHOP regimens. In the study group, the patients received PEG-rhG-CSF 6mg(weight≥45Kg)or 3mg(weight≤45Kg)once 24 hours after the end of chemotherapy drugs of every chemotherapy cycle. In the control group, they weren't preventively administered rhG-CSF. If their neutrophil count (ANC)≤1.0×109/L, they were administered rhG-CSF:5ug/kg/day until their neutrophil count (ANC)≥2.0×109/L. The primary endpoint was the incidence of III/IV grade neutropenia and febrile neutropenia(FN) after each chemotherapy cycle. Meanwhile the rate of antibiotics application and safety were observed. Analyses were performed with SPSS Statistics 20.0 (IBM-SPSS, Chicago, Illinois). The numerical data was presented as mean ± SD. Statistical analysis was performed using one-way analysis of variance and chi-square test. A p-value

Description: Introduction: Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a potentially curative therapeutic strategy to cure a large number of hematologic diseases. Acute graft-versus-host disease (aGVHD) remains a major obstacle against long-term survival for patient underwent allo-HSCT. Oxidative stress can generate large amounts of oxygen free radicals affecting the metabolism, proliferation, and differentiation of normal cells. It may also further induce the autoimmune response to form a waterfall effect, causing reversible to extracellular insults. It has been confirmed that oxidative stress plays an important role in the pathogenesis of aGVHD and the following organ injury. Multiple immunosuppressant agents including calmodulin inhibitor, corticosteroids, anti-CD25 antibody, and JAK1/JAK2 inhibitors have been used to treat GVHD in clinical scenarios. However, quite an amount of patients will develop to glucocorticoid-refractory aGVHD and too intensive immunosuppressive therapy will increase the incidence of infection and malignancy relapse. Nrf2/HO-1 (Nuclear factor E2-related factor 2/ Haemoxygenase-1) signaling pathway has been recognized as a major regulator against oxidative stress injury. Recent studies have demonstrated that hyperbaric oxygen therapy (HBOT) significantly improved non-healing ulcers secondary to GVHD and hemorrhagic cystitis after HLA-mismatched allo-HSCT whether induced by infection or aGVHD. Based on the important role of oxidative stress in the process of aGVHD, we hypothesis that HBOT can improve aGVHD via up-regulating Nrf2/HO-1 pathway. Methods: By using an allo-HSCT murine model of C57BL/6 (H-2KB)→BALB/C (H-2KD), we evaluated the therapeutic effects of HBO on aGVHD. The murine model of aGVHD was established in BALB/C mice by lethally body irradiation, followed by 1×107 bone marrow cells and 2×107 spleen cell transplantation. Mice were randomly divided into three groups: BMT+HBO group, GVHD group, and GVHD+HBO group. BMT+HBO group and GVHD+HBO group mice were simultaneously treated with HBO per day for 2 weeks from day -7 to +7 before- to post stem cell transfusion. The HBO therapy was performed for mice in a sealed chamber at a pressure of 2.4 atmosphere absolute (ATA) for 90 min per day. The induction of the murine GVHD process and GVHD scores were calculated according to the method of Cooke et al (1996) every 6 days. Results: The flow cytometry showed that the level of H-2KB positive cells in the bone marrow cavity of the recipient mice was more than 95%, indicating successful implantation (Figure A). The BALB/C recipient mice in the control group (non-HBOT) showed typical aGVHD symptoms within 20 days, mainly including wasting, ruffled fur, hunched back, skin defect, ocular signs, diarrhea, and anal swelling (Figure B). The aGVHD+HBO group only showed slightly ruffled fur on 40 days post-transplantation (Figure C) and the aGVHD score of aGVHD+HBO group was much lower than that of GVHD group (Figure D) Weight loss was mild in the aGVHD+HBO group than that in the aGVHD group (Figure E). All aGVHD group mice eventually succumbed within 1 month after transplantation, the survival was shorter than that of aGVHD+HBO group. The survival time was analyzed by Kaplan-Meier method (Figure F). The BMT+HBO group served as a control for HBO toxicity. Immunofluorescence microscopy evaluation of mouse liver, skin, and small intestine revealed an attenuation of fluorescence signal in the aGVHD+HBO group, indicating HBO can significantly reduce ROS levels (Figure G). Immunohistochemical staining showed that the expression of NRF2 protein in the liver collected in day 16 post-transplantation was higher than the BMT+HBO group and aGVHD group (Figure H). Conclusions: By using this murine model of aGVHD following allo-HSCT, our results indicated that ROS inhibition by HBOT markedly reduced the infiltration of inflammatory cells and tissue damage to targeted organs, resulting in significantly improved symptoms and prolonged survival. In conclusion, our study provided laboratory evidence that HBO can prevent and treat aGVHD by upregulating the expression of NRF2 and HO-1. HBOT might be a promising prophylactic and pre-emptive treatment choice for aGVHD. In the future, we will further investigate the accurate mechanism of HOBT in the process of aGVHD via Nrf2/HO-1 pathway, verify our preliminary animal experimental results in clinical application. Figure Disclosures No relevant conflicts of interest to declare.

Description: Introduction: CD5-positive diffuse large B-cell lymphoma (CD5+ DLBCL) is characterized by a poor prognosis, poorly respond to the regulatory treatment strategy, and a relatively high incidence of central nervous system (CNS) infiltration. In this study, we aim to identify key differentially expressed miRNAs (DE-miRNAs) and their target genes in the peripheral blood of CD5+ refractory and relapsed (CD5+ R/R DLBCL) patients. The relationship of the DE-miRNAs and the pathogenesis of CD5+ R/R DLBCL will also be analyzed by bioinformatics tools. Methods: Three female patients with confirmed CD5+ R/R DLBCL were enrolled in this study, their age were 38, 62 and 65 years old, respectively. Three healthy female adults aged 42, 55 and 61, respectively were selected as the control group. The peripheral venous blood of them was collected for RNA extraction and standard small RNA sequencing. Differentially expressed miRNAs analysis was performed with R package edgeR. The target genes of DE-miRNAs were predicted by miRNet. A protein protein interaction (PPI) network was established for these target genes through string database. Functional annotation and pathway enrichment analyses for the target genes were performed through DAVID database to identify their potential functions, target genes, and pathways they might be involved in. Results: 1. Scatter plots, Volcano plots and Heat-maps were used to visualize miRNAs of Differentially expressed genes. As shown in Fig.1, Fig. 2 and Fig. 3. 2. Fifty-five sequences were significantly upregulated and 23 were significantly downregulated in patients with CD5+ R/R DLBCL.Among the candidate miRNAs, 11 up-regulated genes and 4 down-regulated genes were selected according to the log2FC value. The target genes of 11 potential up-regulated and 4 down-regulated DE-miRNAs were successively predicted by As shown in Table 1, a total of 439 and 632 predicted targets of the up-regulated and down-regulated DE-miRNAs were identified, respectively. 3. PPI networks of predicted target genes of 11 upregulated DE-miRNAs (Fig.4a) and 4 downregulated DE-miRNAs (Fig. 4b) were separately constructed using the STRING database and Cytoscape software. According to a degree, the top 10 hub genes in the networks were screened out and were listed inTable 2. Six important hub genes were identified, including two target genes predicted by up-regulating DE-miRNAs, namely NRAS and PIK3R1, and four target genes predicted by down-regulating DE-miRNAs, namely EGFR, VEGFA, IGF1 and Grb2. 4. DAVID now provides a comprehensive set of functional annotation tools for investigators to understand biological meaning. GO analysis was divided into three functional groups, including molecular function (MF), biological processes (BP), and cell composition (CC). The top 10 GO terms of targets of up-regulated DE-miRNAs were presented in Fig.5a-c. The top 10 GO terms of targets of down-regulated DE-miRNAs were shown in Fig. 5d-f. 5. Based on the KEGG database, we analyzed the pathways in which the differentially expressed target genes were involved in. As shown in Fig. 6a-b. The targets of up-regulated DE-miRNAs were enriched in pathways in cancer, oxytocin signaling pathway, ErbB signaling pathway, Rap1 signaling pathway, and proteoglycans in cancer. Whereas the targets of down-regulated DE-miRNAs were enriched in pathways in cancer, Ras signaling pathway, and PI3K-Akt signaling pathway. Conclusions: In this study, we analyzed the differentially expressed miRNAs in CD5+ R/R DLBCL patients, identified their potential functions, target genes, and pathways they might be involved in. This study found that ErbB signaling pathway, Rap1 signaling pathway, Ras signaling pathway and PI3K Akt signaling pathway were the most frequently involved pathways of miRNAs related genes. Target genes including NRAS, PIK3R1, EGFR, VEGFA, IGF1, and Grb2 might have a close relationship in the pathogenesis of CD5+ R/R DLBCL. New targeted drugs related to these pathways and genes may be beneficial to the treatment of CD5+ DLBCL. Our preliminary informatic results might be helpful to deeply understand the pathogenesis and chemotherapy resistance mechanism of CD5+ R/R DLBCL. In the future, we will verify our preliminary informatic results in pathological tissues from patients with CD5+ DLBCL in larger samples. Disclosures No relevant conflicts of interest to declare.