ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Articles  (205)
  • Rats  (204)
  • Attenuation
  • 1985-1989  (205)
Collection
Source
Keywords
Publisher
Years
Year
Journal
Topic
  • 1
    facet.materialart.
    Unknown
    Biosynthesis and secretion of proatrial natriuretic factor by cultured rat cardiocytes (1985)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1985-12-06
    Description: Rat atrial natriuretic factor (ANF) is translated as a 152-amino acid precursor preproANF. PreproANF is converted to the 126-amino acid proANF, the storage form of ANF in the atria. ANF isolated from the blood is approximately 25 amino acids long. It is demonstrated here that rat cardiocytes in culture store and secrete proANF. Incubation of proANF with serum produced a smaller ANF peptide. PreproANF seems to be processed to proANF in the atria, and proANF appears to be released into the blood, where it is converted by a protease to a smaller peptide.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bloch, K D -- Scott, J A -- Zisfein, J B -- Fallon, J T -- Margolies, M N -- Seidman, C E -- Matsueda, G R -- Homcy, C J -- Graham, R M -- Seidman, J G -- 1R23CA33570/CA/NCI NIH HHS/ -- HL07208/HL/NHLBI NIH HHS/ -- HL26215/HL/NHLBI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1985 Dec 6;230(4730):1168-71.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2933808" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Atrial Natriuretic Factor/*biosynthesis/genetics/secretion ; Autoradiography ; Cells, Cultured ; Electrophoresis, Polyacrylamide Gel ; Heart/physiology ; Immune Sera/immunology ; Myocardium/*cytology/metabolism ; Protein Precursors/*biosynthesis/genetics/secretion ; RNA, Messenger/genetics ; Rabbits/immunology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    Shock and tissue injury induced by recombinant human cachectin (1986)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1986-10-24
    Description: Cachectin (tumor necrosis factor), a protein produced in large quantities by endotoxin-activated macrophages, has been implicated as an important mediator of the lethal effect of endotoxin. Recombinant human cachectin was infused into rats in an effort to determine whether cachectin, by itself, can elicit the derangements of host physiology caused by administration of endotoxin. When administered in quantities similar to those produced endogenously in response to endotoxin, cachectin causes hypotension, metabolic acidosis, hemoconcentration, and death within minutes to hours, as a result of respiratory arrest. Hyperglycemia and hyperkalemia were also observed after infusion. At necropsy, diffuse pulmonary inflammation and hemorrhage were apparent on gross and histopathologic examination, along with ischemic and hemorrhagic lesions of the gastrointestinal tract, and acute renal tubular necrosis. Thus, it appears that a single protein mediator (cachectin) is capable of inducing many of the deleterious effects of endotoxin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tracey, K J -- Beutler, B -- Lowry, S F -- Merryweather, J -- Wolpe, S -- Milsark, I W -- Hariri, R J -- Fahey, T J 3rd -- Zentella, A -- Albert, J D -- New York, N.Y. -- Science. 1986 Oct 24;234(4775):470-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3764421" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blood Glucose/metabolism ; Endotoxins/toxicity ; Female ; Glycoproteins/*toxicity ; Humans ; Potassium/blood ; Rats ; Recombinant Proteins ; Shock/*chemically induced/pathology/physiopathology ; Sodium/blood ; Tumor Necrosis Factor-alpha
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Clathrin light chains LCA and LCB are similar, polymorphic, and share repeated heptad motifs (1987)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1987-04-17
    Description: The clathrin light chains fall into two major classes, LCA and LCB. In an intact clathrin triskelion, one light chain, of either class, is bound to the proximal segment of a heavy chain leg. Analysis of rat brain and liver complementary DNA clones for LCA and LCB shows that the two light chain classes are closely related. There appear to be several members of each class having deletions of varying length aligned at the same position. A set of ten heptad elements, characteristic of alpha-helical coiled coils, is a striking feature of the central part of each derived amino acid sequence. These observations suggest a model in which the alpha-helical segment mediates binding to clathrin heavy chains and the amino- and carboxyl-terminal segments mediate interactions with other proteins. They also suggest an explanation for the observed tissue-dependent size variation for members of each class.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kirchhausen, T -- Scarmato, P -- Harrison, S C -- Monroe, J J -- Chow, E P -- Mattaliano, R J -- Ramachandran, K L -- Smart, J E -- Ahn, A H -- Brosius, J -- MH 38819/MH/NIMH NIH HHS/ -- R01 GM 36548-01/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1987 Apr 17;236(4799):320-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3563513" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Brain/metabolism ; Clathrin/*genetics ; Cloning, Molecular ; DNA/analysis ; Liver/metabolism ; Macromolecular Substances ; *Polymorphism, Genetic ; Rats ; Repetitive Sequences, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    A protein induced during nerve growth (GAP-43) is a major component of growth-cone membranes (1986)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1986-08-15
    Description: Growth cones are specialized structures that form the distal tips of growing axons. During both normal development of the nervous system and regeneration of injured nerves, growth cones are essential for elongation and guidance of growing axons. Developmental and regenerative axon growth is frequently accompanied by elevated synthesis of a protein designated GAP-43. GAP-43 has now been found to be a major component of growth-cone membranes in developing rat brains. Relative to total protein, GAP-43 is approximately 12 times as abundant in growth-cone membranes as in synaptic membranes from adult brains. Immunohistochemical localization of GAP-43 in frozen sections of developing brain indicates that the protein is specifically associated with neuropil areas containing growth cones and immature synaptic terminals. The results support the proposal that GAP-43 plays a role in axon growth.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Skene, J H -- Jacobson, R D -- Snipes, G J -- McGuire, C B -- Norden, J J -- Freeman, J A -- EY01117/EY/NEI NIH HHS/ -- EY03718/EY/NEI NIH HHS/ -- NS18103/NS/NINDS NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1986 Aug 15;233(4765):783-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3738509" target="_blank"〉PubMed〈/a〉
    Keywords: Aging ; Animals ; Animals, Newborn ; Anura ; Axons/physiology ; Brain/growth & development/*physiology ; Cell Membrane/metabolism ; Fetus ; GAP-43 Protein ; Growth Substances/*biosynthesis/isolation & purification ; Membrane Proteins/*biosynthesis/isolation & purification ; *Nerve Regeneration ; Nerve Tissue Proteins/*biosynthesis/isolation & purification ; Optic Nerve/cytology/*physiology ; Rats ; Synaptic Membranes/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Similarity of synthetic peptide from human tumor to parathyroid hormone in vivo and in vitro (1987)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1987-12-11
    Description: One mechanism considered responsible for the hypercalcemia that frequently accompanies malignancy is secretion by the tumor of a circulating factor that alters calcium metabolism. The structure of a tumor-secreted peptide was recently determined and found to be partially homologous to parathyroid hormone (PTH). The amino-terminal 1-34 region of the factor was synthesized and evaluated biologically. In vivo it produced hypercalcemia, acted on bone and kidney, and stimulated 1,25-dihydroxy-vitamin D3 formation. In vitro it interacted with PTH receptors and, in some systems, was more potent than PTH. These studies support a long-standing hypothesis regarding pathogenesis of malignancy-associated hypercalcemia.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Horiuchi, N -- Caulfield, M P -- Fisher, J E -- Goldman, M E -- McKee, R L -- Reagan, J E -- Levy, J J -- Nutt, R F -- Rodan, S B -- Schofield, T L -- AR 36446/AR/NIAMS NIH HHS/ -- AR 39191/AR/NIAMS NIH HHS/ -- New York, N.Y. -- Science. 1987 Dec 11;238(4833):1566-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Regional Bone Center, Helen Hayes Hospital (New York State Department of Health), West Haverstraw 10993.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3685994" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Calcium/blood ; Humans ; Hypercalcemia/etiology ; Neoplasms/*physiopathology ; Parathyroid Glands/physiology ; Parathyroid Hormone/pharmacology/*physiology ; Peptides/*physiology ; Rats ; Rats, Inbred Strains ; Thyroidectomy
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    Electronic Resource
    Electronic Resource
    The influence of different nutrients on plasma cholecystokinin levels in the rat (1988)
    Springer
    Cellular and molecular life sciences 44 (1988), S. 21-23 
    Details
    ISSN: 1420-9071
    Keywords: Rats ; nutrients ; cholecystokinin ; pancreatic secretion
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Summary Isocaloric and isovolemic amounts of protein (casein), fat (intralipid) and carbohydrate (saccharose) and an isovolemic control solution of water were administered intragastrically to conscious rats. The plasma CCK levels, determined by a sensitive and specific radioimmunoassay, showed an increment of 6.3±0.6, 2.7±0.5, 1.7±0.4 and −0.9±0.4 pM, respectively (basal value 2.5±0.3 pM). The threshold increment of plasma CCK to stimulate pancreatic enzyme secretion by exogenous CCK was found to be 1.5 pM. It is therefore concluded that casein is a potent stimulus for CCK secretion and pancreatic secretion, but that fat and even carbohydrate, although less potent, also produce a CCK increment above the threshold for pancreatic secretion.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF01960229
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 7
    facet.materialart.
    Unknown
    Functional expression of a new pharmacological subtype of brain nicotinic acetylcholine receptor (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-04-15
    Description: A new type of agonist-binding subunit of rat neuronal nicotinic acetylcholine receptors (nAChRs) was identified. Rat genomic DNA and complementary DNA encoding this subunit (alpha 2) were cloned and analyzed. Complementary DNA expression studies in Xenopus oocytes revealed that the injection of messenger RNAs (mRNAs) for alpha 2 and beta 2 (a neuronal nAChR subunit) led to the generation of a functional nAChR. In contrast to the other known neuronal nAChRs, the receptor produced by the injection of alpha 2 and beta 2 mRNAs was resistant to the alpha-neurotoxin Bgt3.1. In situ hybridization histochemistry showed that alpha 2 mRNA was expressed in a small number of regions, in contrast to the wide distribution of the other known agonist-binding subunits (alpha 3 and alpha 4) mRNAs. These results demonstrate that the alpha 2 subunit differs from other known agonist-binding alpha-subunits of nAChRs in its distribution in the brain and in its pharmacology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wada, K -- Ballivet, M -- Boulter, J -- Connolly, J -- Wada, E -- Deneris, E S -- Swanson, L W -- Heinemann, S -- Patrick, J -- New York, N.Y. -- Science. 1988 Apr 15;240(4850):330-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Salk Institute for Biological Studies, San Diego, CA 92138.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2832952" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Brain/*metabolism ; DNA Restriction Enzymes ; Female ; *Genes ; Molecular Sequence Data ; Neurons/metabolism ; Nucleotide Mapping ; Oocytes/metabolism ; Rats ; Receptors, Nicotinic/*genetics/metabolism ; Transcription, Genetic ; Xenopus laevis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    Fibroblasts transformed with v-src show enhanced formation of an inositol tetrakisphosphate (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    Site-directed neovessel formation in vivo (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-09-09
    Description: Angiogenesis is an important component of organogenesis and wound repair and occurs during the pathology of oncogenesis, atherogenesis, and other disease processes. Thus, it is important to understand the physiological mechanisms that control neovascularization, especially with methods that permit the molecular dissection of the phenomenon in vivo. Heparin-binding growth factor-1 was shown to bind to collagen type I and type IV. When complexed with gelatin, heparin-binding growth factor-1 can induce neovascularization at polypeptide concentrations that are consistent with the biological activity of the mitogen in vitro. The adsorption strategy induces rapid blood vessel formation at and between organ- and tissue-specific sites and permits recovery of the site-specific implant for examination and manipulation by molecular methods.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Thompson, J A -- Anderson, K D -- DiPietro, J M -- Zwiebel, J A -- Zametta, M -- Anderson, W F -- Maciag, T -- HL32348/HL/NHLBI NIH HHS/ -- HL35627/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1988 Sep 9;241(4871):1349-52.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Hematology, National Heart, Lung and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2457952" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blood Vessels/cytology ; Collagen/metabolism ; Extracellular Matrix ; Fibroblast Growth Factor 1 ; Gelatin/metabolism ; Growth Substances/*pharmacology ; Heparin/*pharmacology ; *Neovascularization, Pathologic ; Rats ; Tampons, Surgical
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...