ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Molecular Diversity Preservation International (MDPI)  (152,126)
  • 1
    Publication Date: 2018-09-21
    Description: Genes, Vol. 9, Pages 465: Molecular Genotyping (SSR) and Agronomic Phenotyping for Utilization of Durum Wheat (Triticum durum Desf.) Ex Situ Collection from Southern Italy: A Combined Approach Including Pedigreed Varieties Genes doi: 10.3390/genes9100465 Authors: Stefania Marzario Giuseppina Logozzo Jacques L. David Pierluigi Spagnoletti Zeuli Tania Gioia In South Italy durum wheat (Triticum durum Desf.) has a long-time tradition of growing and breeding. Accessions collected and now preserved ex situ are a valuable genetic resource, but their effective use in agriculture and breeding programs remains very low. In this study, a small number (44) of simple sequence repeats (SSR) molecular markers were used to detect pattern of diversity for 136 accessions collected in South Italy over time, to identify the genepool of origin, and establish similarities with 28 Italian varieties with known pedigree grown in Italy over the same time-period. Phenotyping was conducted for 12 morphophysiological characters of agronomic interest. Based on discriminant analysis of principal components (DAPC) and STRUCTURE analysis six groups were identified, the assignment of varieties reflected the genetic basis and breeding strategies involved in their development. Some “old” varieties grown today are the result of evolution through natural hybridization and conservative pure line selection. A small number of molecular markers and little phenotyping coupled with powerful statistical analysis and comparison to pedigreed varieties can provide enough information on the genetic structure of durum wheat germplasm for a quick screening of the germplasm collection able to identify accessions for breeding or introduction in low input agriculture.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    Publication Date: 2018-07-21
    Description: Genes, Vol. 9, Pages 366: Integrase-Controlled Excision of Metal-Resistance Genomic Islands in Acinetobacter baumannii Genes doi: 10.3390/genes9070366 Authors: Zaaima AL-Jabri Roxana Zamudio Eva Horvath-Papp Joseph D. Ralph Zakariya AL-Muharrami Kumar Rajakumar Marco R. Oggioni Genomic islands (GIs) are discrete gene clusters encoding for a variety of functions including antibiotic and heavy metal resistance, some of which are tightly associated to lineages of the core genome phylogenetic tree. We have investigated the functions of two distinct integrase genes in the mobilization of two metal resistant GIs, G08 and G62, of Acinetobacter baumannii. Real-time PCR demonstrated integrase-dependent GI excision, utilizing isopropyl β-d-1-thiogalactopyranoside IPTG-inducible integrase genes in plasmid-based mini-GIs in Escherichia coli. In A. baumannii, integrase-dependent excision of the original chromosomal GIs could be observed after mitomycin C induction. In both E. coli plasmids and A. baumannii chromosome, the rate of excision and circularization was found to be dependent on the expression level of the integrases. Susceptibility testing in A. baumannii strain ATCC 17978, A424, and their respective ΔG62 and ΔG08 mutants confirmed the contribution of the GI-encoded efflux transporters to heavy metal decreased susceptibility. In summary, the data evidenced the functionality of two integrases in the excision and circularization of the two Acinetobacter heavy-metal resistance GIs, G08 and G62, in E. coli, as well as when chromosomally located in their natural host. These recombination events occur at different frequencies resulting in genome plasticity and may participate in the spread of resistance determinants in A. baumannii.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    Publication Date: 2018-07-21
    Description: Genes, Vol. 9, Pages 365: Cellular Genomic Sites of Hepatitis B Virus DNA Integration Genes doi: 10.3390/genes9070365 Authors: Magdalena A. Budzinska Nicholas A. Shackel Stephan Urban Thomas Tu Infection with the Hepatitis B Virus (HBV) is one of the strongest risk-factors for liver cancer (hepatocellular carcinoma, HCC). One of the reported drivers of HCC is the integration of HBV DNA into the host cell genome, which may induce pro-carcinogenic pathways. These reported pathways include: induction of chromosomal instability; generation of insertional mutagenesis in key cancer-associated genes; transcription of downstream cancer-associated cellular genes; and/or formation of a persistent source of viral protein expression (particularly HBV surface and X proteins). The contribution of each of these specific mechanisms towards carcinogenesis is currently unclear. Here, we review the current knowledge of specific sites of HBV DNA integration into the host genome, which sheds light on these mechanisms. We give an overview of previously-used methods to detect HBV DNA integration and the enrichment of integration events in specific functional and structural cellular genomic sites. Finally, we posit a theoretical model of HBV DNA integration during disease progression and highlight open questions in the field.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2018-09-04
    Description: Genes, Vol. 9, Pages 440: L Chromosome Behaviour and Chromosomal Imprinting in Sciara Coprophila Genes doi: 10.3390/genes9090440 Authors: Prim B. Singh Stepan N. Belyakin The retention of supernumerary chromosomes in the germ-line of Sciara coprophila is part of a highly-intricate pattern of chromosome behaviours that have fascinated cytogeneticists for over 80 years. Germ-line limited (termed L or “limited”) chromosomes are cytologically heterochromatic and late-replicating, with more recent studies confirming they possess epigenetic hallmarks characteristic of constitutive heterochromatin. Little is known about their genetic constitution although they have been found to undergo cycles of condensation and de-condensation at different stages of development. Unlike most supernumeraries, the L chromosomes in S. coprophila are thought to be indispensable, although in two closely related species Sciara ocellaris and Sciara reynoldsi the L chromosomes, have been lost during evolution. Here, we review what we know about L chromosomes in Sciara coprophila. We end by discussing how study of the L chromosome condensation cycle has provided insight into the site and timing of both the erasure of parental “imprints” and also the placement of a putative “imprint” that might be carried by the sperm into the egg.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    Publication Date: 2018-09-06
    Description: Genes, Vol. 9, Pages 442: Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus Genes doi: 10.3390/genes9090442 Authors: Chang Liu Ze Chen Yue Hu Haishuo Ji Deshui Yu Wenyuan Shen Siyu Li Jishou Ruan Wenjun Bu Shan Gao In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    Publication Date: 2018-09-06
    Description: Genes, Vol. 9, Pages 443: Global Long Noncoding RNA and mRNA Expression Changes between Prenatal and Neonatal Lung Tissue in Pigs Genes doi: 10.3390/genes9090443 Authors: Long Jin Silu Hu Teng Tu Zhiqing Huang Qianzi Tang Jideng Ma Xun Wang Xuewei Li Xuan Zhou Surong Shuai Mingzhou Li Lung tissue plays an important role in the respiratory system of mammals after birth. Early lung development includes six key stages, of which the saccular stage spans the pre- and neonatal periods and prepares the distal lung for alveolarization and gas-exchange. However, little is known about the changes in gene expression between fetal and neonatal lungs. In this study, we performed transcriptomic analysis of messenger RNA (mRNA) and long noncoding RNA (lncRNA) expressed in the lung tissue of fetal and neonatal piglets. A total of 19,310 lncRNAs and 14,579 mRNAs were identified and substantially expressed. Furthermore, 3248 mRNAs were significantly (FDR-adjusted p value ≤ 0.05, FDR: False Discovery Rate) differentially expressed and were mainly enriched in categories related to cell proliferation, immune response, hypoxia response, and mitochondrial activation. For example, CCNA2, an important gene involved in the cell cycle and DNA replication, was upregulated in neonatal lungs. We also identified 452 significantly (FDR-adjusted p value ≤ 0.05) differentially expressed lncRNAs, which might function in cell proliferation, mitochondrial activation, and immune response, similar to the differentially expressed mRNAs. These results suggest that differentially expressed mRNAs and lncRNAs might co-regulate lung development in early postnatal pigs. Notably, the TU64359 lncRNA might promote distal lung development by up-regulating the heparin-binding epidermal growth factor-like (HB-EGF) expression. Our research provides basic lung development datasets and will accelerate clinical researches of newborn lung diseases with pig models.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 2018-09-12
    Description: Genes, Vol. 9, Pages 455: Correction of a Splicing Mutation Affecting an Unverricht-Lundborg Disease Patient by Antisense Therapy Genes doi: 10.3390/genes9090455 Authors: Liliana Matos Ana Joana Duarte Diogo Ribeiro João Chaves Olga Amaral Sandra Alves Unverricht-Lundborg disease (ULD) is a common form of progressive myoclonic epilepsy caused by mutations in the cystatin B gene (CSTB) that encodes an inhibitor of several lysosomal cathepsins. Presently, only pharmacological treatment and psychosocial support are available for ULD patients. To overcome the pathogenic effect of the ULD splicing mutation c.66G>A (exon 1), we investigated whether an antisense oligonucleotide therapeutic strategy could correct the defect in patient cells. A specific locked nucleic acid (LNA) antisense oligonucleotide was designed to block a cryptic 5′ss in intron 1. Overall, this approach allowed the restoration of the normal splicing pattern. Furthermore, the recovery was both sequence and dose-specific. In general, this work provides a proof of principle on the correction of a CSTB gene defect causing ULD through a mutation-specific antisense therapy. It adds evidence to the feasibility of this approach, joining the many studies that are paving the way for translating antisense technology into the clinical practice. The insights detailed herein make mutation-based therapy a clear candidate for personalized treatment of ULD patients, encouraging similar investigations into other genetic diseases.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2018-09-13
    Description: Genes, Vol. 9, Pages 456: Functional Evolution of Avian RIG-I-Like Receptors Genes doi: 10.3390/genes9090456 Authors: Wanjing Zheng Yoko Satta RIG-I-like receptors (retinoic acid-inducible gene-I-like receptors, or RLRs) are family of pattern-recognition receptors for RNA viruses, consisting of three members: retinoic acid-inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5) and laboratory of genetics and physiology 2 (LGP2). To understand the role of RLRs in bird evolution, we performed molecular evolutionary analyses on the coding genes of avian RLRs using filtered predicted coding sequences from 62 bird species. Among the three RLRs, conservation score and dN/dS (ratio of nonsynonymous substitution rate over synonymous substitution rate) analyses indicate that avian MDA5 has the highest conservation level in the helicase domain but a lower level in the caspase recruitment domains (CARDs) region, which differs from mammals; LGP2, as a whole gene, has a lower conservation level than RIG-I or MDA5. We found evidence of positive selection across all bird lineages in RIG-I and MDA5 but only on the stem lineage of Galliformes in LGP2, which could be related to the loss of RIG-I in Galliformes. Analyses also suggest that selection relaxation may have occurred in LGP2 during the middle of bird evolution and the CARDs region of MDA5 contains many positively selected sites, which might explain its conservation level. Spearman’s correlation test indicates that species-to-ancestor dN/dS of RIG-I shows a negative correlation with endogenous retroviral abundance in bird genomes, suggesting the possibility of interaction between immunity and endogenous retroviruses during bird evolution.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    Publication Date: 2018-09-14
    Description: Genes, Vol. 9, Pages 457: Correction: Li, X.; et al. Identification and Characterization of the WOX Family Genes in Five Solanaceae Species Reveal Their Conserved Roles in Peptide Signaling. Genes 2018, 9, 260. Genes doi: 10.3390/genes9090457 Authors: Xiaoxu Li Madiha Hamyat Cheng Liu Salman Ahmad Xiaoming Gao Cun Guo Yuanying Wang Yongfeng Guo The authors wish to make the following change in their paper [...]
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    Publication Date: 2018-09-15
    Description: Genes, Vol. 9, Pages 458: miRmapper: A Tool for Interpretation of miRNA–mRNA Interaction Networks Genes doi: 10.3390/genes9090458 Authors: Willian A. da Silveira Ludivine Renaud Jonathan Simpson William B. Glen Edward. S. Hazard Dongjun Chung Gary Hardiman It is estimated that 30% of all genes in the mammalian cells are regulated by microRNA (miRNAs). The most relevant miRNAs in a cellular context are not necessarily those with the greatest change in expression levels between healthy and diseased tissue. Differentially expressed (DE) miRNAs that modulate a large number of messenger RNA (mRNA) transcripts ultimately have a greater influence in determining phenotypic outcomes and are more important in a global biological context than miRNAs that modulate just a few mRNA transcripts. Here, we describe the development of a tool, “miRmapper”, which identifies the most dominant miRNAs in a miRNA–mRNA network and recognizes similarities between miRNAs based on commonly regulated mRNAs. Using a list of miRNA–target gene interactions and a list of DE transcripts, miRmapper provides several outputs: (1) an adjacency matrix that is used to calculate miRNA similarity utilizing the Jaccard distance; (2) a dendrogram and (3) an identity heatmap displaying miRNA clusters based on their effect on mRNA expression; (4) a miRNA impact table and (5) a barplot that provides a visual illustration of this impact. We tested this tool using nonmetastatic and metastatic bladder cancer cell lines and demonstrated that the most relevant miRNAs in a cellular context are not necessarily those with the greatest fold change. Additionally, by exploiting the Jaccard distance, we unraveled novel cooperative interactions between miRNAs from independent families in regulating common target mRNAs; i.e., five of the top 10 miRNAs act in synergy.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    Publication Date: 2018-09-20
    Description: Genes, Vol. 9, Pages 460: A Statistical Method for Observing Personal Diploid Methylomes and Transcriptomes with Single-Molecule Real-Time Sequencing Genes doi: 10.3390/genes9090460 Authors: Yuta Suzuki Yunhao Wang Kin Fai Au Shinichi Morishita We address the problem of observing personal diploid methylomes, CpG methylome pairs of homologous chromosomes that are distinguishable with respect to phased heterozygous variants (PHVs), which is challenging due to scarcity of PHVs in personal genomes. Single molecule real-time (SMRT) sequencing is promising as it outputs long reads with CpG methylation information, but a serious concern is whether reliable PHVs are available in erroneous SMRT reads with an error rate of ∼15%. To overcome the issue, we propose a statistical model that reduces the error rate of phasing CpG site to 1%, thereby calling CpG hypomethylation in each haplotype with >90% precision and sensitivity. Using our statistical model, we examined GNAS complex locus known for a combination of maternally, paternally, or biallelically expressed isoforms, and observed allele-specific methylation pattern almost perfectly reflecting their respective allele-specific expression status, demonstrating the merit of elucidating comprehensive personal diploid methylomes and transcriptomes.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    Publication Date: 2018-09-22
    Description: Genes, Vol. 9, Pages 466: Comprehensive Transcriptome Profiling and Identification of Potential Genes Responsible for Salt Tolerance in Tall Fescue Leaves under Salinity Stress Genes doi: 10.3390/genes9100466 Authors: Erick Amombo Xiaoning Li Guangyang Wang Shao An Wei Wang Jinmin Fu Soil salinity is a serious threat to plant growth and crop productivity. Tall fescue utilization in saline areas is limited by its inferior salt tolerance. Thus, a transcriptome study is a prerequisite for future research aimed at providing deeper insights into the molecular mechanisms of tall fescue salt tolerance as well as molecular breeding. Recent advances in sequencing technology offer a platform to achieve this. Here, Illumina RNA sequencing of tall fescue leaves generated a total of 144,339 raw reads. After de novo assembly, unigenes with a total length of 129,749,938 base pairs were obtained. For functional annotations, the unigenes were aligned to various databases. Further structural analyses revealed 79,352 coding DNA sequences and 13,003 microsatellites distributed across 11,277 unigenes as well as single nucleotide polymorphisms. In total, 1862 unigenes were predicted to encode for 2120 transcription factors among which most were key salt-responsive. We determined differential gene expression and distribution per sample and most genes related to salt tolerance and photosynthesis were upregulated in 48 h vs. 24 h salt treatment. Protein interaction analysis revealed a high interaction of chaperonins and Rubisco proteins in 48 h vs. 24 h salt treatment. The gene expressions were finally validated using quantitative polymerase chain reaction (qPCR), which was coherent with sequencing results.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    Publication Date: 2018-09-20
    Description: Genes, Vol. 9, Pages 462: The GIS2 Gene Is Repressed by a Zinc-Regulated Bicistronic RNA in Saccharomyces cerevisiae Genes doi: 10.3390/genes9090462 Authors: Janet Taggart Yirong Wang Erin Weisenhorn Colin W. MacDiarmid Jason Russell Joshua J. Coon David J. Eide Zinc homeostasis is essential for all organisms. The Zap1 transcriptional activator regulates these processes in the yeast Saccharomyces cerevisiae. During zinc deficiency, Zap1 increases expression of zinc transporters and proteins involved in adapting to the stress of zinc deficiency. Transcriptional activation by Zap1 can also repress expression of some genes, e.g., RTC4. In zinc-replete cells, RTC4 mRNA is produced with a short transcript leader that is efficiently translated. During deficiency, Zap1-dependent expression of an RNA with a longer transcript leader represses the RTC4 promoter. This long leader transcript (LLT) is not translated due to the presence of small open reading frames upstream of the RTC4 coding region. In this study, we show that the RTC4 LLT RNA also plays a second function, i.e., repression of the adjacent GIS2 gene. In generating the LLT transcript, RNA polymerase II transcribes RTC4 through the GIS2 promoter. Production of the LLT RNA correlates with the decreased expression of GIS2 mRNA and mutations that prevent synthesis of the LLT RNA or terminate it before the GIS2 promoter renders GIS2 mRNA expression and Gis2 protein accumulation constitutive. Thus, we have discovered an unusual regulatory mechanism that uses a bicistronic RNA to control two genes simultaneously.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    Publication Date: 2018-09-20
    Description: Genes, Vol. 9, Pages 461: Evolutionary Emergence of Drug Resistance in Candida Opportunistic Pathogens Genes doi: 10.3390/genes9090461 Authors: Ewa Ksiezopolska Toni Gabaldón Fungal infections, such as candidiasis caused by Candida, pose a problem of growing medical concern. In developed countries, the incidence of Candida infections is increasing due to the higher survival of susceptible populations, such as immunocompromised patients or the elderly. Existing treatment options are limited to few antifungal drug families with efficacies that vary depending on the infecting species. In this context, the emergence and spread of resistant Candida isolates are being increasingly reported. Understanding how resistance can evolve within naturally susceptible species is key to developing novel, more effective treatment strategies. However, in contrast to the situation of antibiotic resistance in bacteria, few studies have focused on the evolutionary mechanisms leading to drug resistance in fungal species. In this review, we will survey and discuss current knowledge on the genetic bases of resistance to antifungal drugs in Candida opportunistic pathogens. We will do so from an evolutionary genomics perspective, focusing on the possible evolutionary paths that may lead to the emergence and selection of the resistant phenotype. Finally, we will discuss the potential of future studies enabled by current developments in sequencing technologies, in vitro evolution approaches, and the analysis of serial clinical isolates.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    Publication Date: 2017-09-06
    Description: Genes, Vol. 8, Pages 219: Quantification of Pseudouridine Levels in Cellular RNA Pools with a Modified HPLC-UV Assay Genes doi: 10.3390/genes8090219 Authors: Jialin Xu Alice Gu Naresh Thumati Judy Wong Pseudouridine (Ψ) is the most abundant post-transcriptionally modified ribonucleoside. Different Ψ modifications correlate with stress responses and are postulated to coordinate the distinct biological responses to a diverse panel of cellular stresses. With the help of different guide RNAs, the dyskerin complex pseudouridylates ribosomal RNA, small nuclear RNA and selective messenger RNAs. To monitor Ψ levels quantitatively, a previously reported high performance liquid chromatography method coupled with ultraviolet detection (HPLC-UV) was modified to determine total Ψ levels in different cellular RNA fractions. Our method was validated to be accurate and precise within the linear range of 0.06–15.36 pmol/μL and to have absolute Ψ quantification levels as low as 3.07 pmol. Using our optimized HPLC assay, we found that 1.20% and 1.94% of all ribonucleosides in nuclear-enriched RNA and small non-coding RNA pools from the HEK293 cell line, and 1.77% and 0.98% of ribonucleosides in 18S and 28S rRNA isolated from the HeLa cell line, were pseudouridylated. Upon knockdown of dyskerin expression, a consistent and significant reduction in total Ψ levels in nuclear-enriched RNA pools was observed. Our assay provides a fast and accurate quantification method to measure changes in Ψ levels of different RNA pools without sample derivatization.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    Publication Date: 2017-09-06
    Description: Genes, Vol. 8, Pages 220: Zebrafish Xenograft: An Evolutionary Experiment in Tumour Biology Genes doi: 10.3390/genes8090220 Authors: Rachael A. Wyatt Nhu P. V. Trieu Bryan D. Crawford Though the cancer research community has used mouse xenografts for decades more than zebrafish xenografts, zebrafish have much to offer: they are cheap, easy to work with, and the embryonic model is relatively easy to use in high-throughput assays. Zebrafish can be imaged live, allowing us to observe cellular and molecular processes in vivo in real time. Opponents dismiss the zebrafish model due to the evolutionary distance between zebrafish and humans, as compared to mice, but proponents argue for the zebrafish xenograft’s superiority to cell culture systems and its advantages in imaging. This review places the zebrafish xenograft in the context of current views on cancer and gives an overview of how several aspects of this evolutionary disease can be addressed in the zebrafish model. Zebrafish are missing homologs of some human proteins and (of particular interest) several members of the matrix metalloproteinase (MMP) family of proteases, which are known for their importance in tumour biology. This review draws attention to the implicit evolutionary experiment taking place when the molecular ecology of the xenograft host is significantly different than that of the donor.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    Publication Date: 2017-09-09
    Description: Genes, Vol. 8, Pages 223: Advances in Genomic Profiling and Analysis of 3D Chromatin Structure and Interaction Genes doi: 10.3390/genes8090223 Authors: Binhua Tang Xiaolong Cheng Yunlong Xi Zixin Chen Yufan Zhou Victor Jin Recent sequence-based profiling technologies such as high-throughput sequencing to detect fragment nucleotide sequence (Hi-C) and chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) have revolutionized the field of three-dimensional (3D) chromatin architecture. It is now recognized that human genome functions as folded 3D chromatin units and looping paradigm is the basic principle of gene regulation. To better interpret the 3D data dramatically accumulating in past five years and to gain deep biological insights, huge efforts have been made in developing novel quantitative analysis methods. However, the full understanding of genome regulation requires thorough knowledge in both genomic technologies and their related data analyses. We summarize the recent advances in genomic technologies in identifying the 3D chromatin structure and interaction, and illustrate the quantitative analysis methods to infer functional domains and chromatin interactions, and further elucidate the emerging single-cell Hi-C technique and its computational analysis, and finally discuss the future directions such as advances of 3D chromatin techniques in diseases.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    Publication Date: 2017-09-16
    Description: Genes, Vol. 8, Pages 229: Emerging Estrogenic Pollutants in the Aquatic Environment and Breast Cancer Genes doi: 10.3390/genes8090229 Authors: Sylvain Lecomte Denis Habauzit Thierry Charlier Farzad Pakdel The number and amount of man-made chemicals present in the aquatic environment has increased considerably over the past 50 years. Among these contaminants, endocrine-disrupting chemicals (EDCs) represent a significant proportion. This family of compounds interferes with normal hormonal processes through multiple molecular pathways. They represent a potential risk for human and wildlife as they are suspected to be involved in the development of diseases including, but not limited to, reprotoxicity, metabolic disorders, and cancers. More precisely, several studies have suggested that the increase of breast cancers in industrialized countries is linked to exposure to EDCs, particularly estrogen-like compounds. Estrogen receptors alpha (ERα) and beta (ERβ) are the two main transducers of estrogen action and therefore important targets for these estrogen-like endocrine disrupters. More than 70% of human breast cancers are ERα-positive and estrogen-dependent, and their development and growth are not only influenced by endogenous estrogens but also likely by environmental estrogen-like endocrine disrupters. It is, therefore, of major importance to characterize the potential estrogenic activity from contaminated surface water and identify the molecules responsible for the hormonal effects. This information will help us understand how environmental contaminants can potentially impact the development of breast cancer and allow us to fix a maximal limit to the concentration of estrogen-like compounds that should be found in the environment. The aim of this review is to provide an overview of emerging estrogen-like compounds in the environment, sum up studies demonstrating their direct or indirect interactions with ERs, and link their presence to the development of breast cancer. Finally, we emphasize the use of in vitro and in vivo methods based on the zebrafish model to identify and characterize environmental estrogens.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    Publication Date: 2017-09-20
    Description: Genes, Vol. 8, Pages 234: Circulating microRNAs and Bioinformatics Tools to Discover Novel Diagnostic Biomarkers of Pediatric Diseases Genes doi: 10.3390/genes8090234 Authors: Antonella Baldassarre Cristina Felli Giorgio Prantera Andrea Masotti MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression at the post-transcriptional level. Current studies have shown that miRNAs are also present in extracellular spaces, packaged into various membrane-bound vesicles, or associated with RNA-binding proteins. Circulating miRNAs are highly stable and can act as intercellular messengers to affect many physiological processes. MicroRNAs circulating in body fluids have generated strong interest in their potential use as clinical biomarkers. In fact, their remarkable stability and the relative ease of detection make circulating miRNAs ideal tools for rapid and non-invasive diagnosis. This review summarizes recent insights about the origin, functions and diagnostic potential of extracellular miRNAs by especially focusing on pediatric diseases in order to explore the feasibility of alternative sampling sources for the development of non-invasive pediatric diagnostics. We will also discuss specific bioinformatics tools and databases for circulating miRNAs focused on the identification and discovery of novel diagnostic biomarkers of pediatric diseases.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    Publication Date: 2017-09-20
    Description: Genes, Vol. 8, Pages 212: Chloroplast Genome Sequence of Clusterbean (Cyamopsis tetragonoloba L.): Genome Structure and Comparative Analysis Genes doi: 10.3390/genes8090212 Authors: Tanvi Kaila Pavan Chaduvla Hukam Rawal Swati Saxena Anshika Tyagi S. Mithra Amolkumar Solanke Pritam Kalia T. Sharma N. Singh Kishor Gaikwad Clusterbean (Cyamopsis tetragonoloba L.), also known as guar, belongs to the family Leguminosae, and is an annual herbaceous legume. Guar is the main source of galactomannan for gas mining industries. In the present study, the draft chloroplast genome of clusterbean was generated and compared to some of the previously reported legume chloroplast genomes. The chloroplast genome of clusterbean is 152,530 bp in length, with a quadripartite structure consisting of large single copy (LSC) and small single copy (SSC) of 83,025 bp and 17,879 bp in size, respectively, and a pair of inverted repeats (IRs) of 25,790 bp in size. The chloroplast genome contains 114 unique genes, which includes 78 protein coding genes, 30 tRNAs, 4 rRNAs genes, and 2 pseudogenes. It also harbors a 50 kb inversion, typical of the Leguminosae family. The IR region of the clusterbean chloroplast genome has undergone an expansion, and hence, the whole rps19 gene is included in the IR, as compared to other legume plastid genomes. A total of 220 simple sequence repeats (SSRs) were detected in the clusterbean plastid genome. The analysis of the clusterbean plastid genome will provide useful insights for evolutionary, molecular and genetic engineering studies.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    Publication Date: 2017-09-20
    Description: Genes, Vol. 8, Pages 235: Genome-Wide Analysis of the Biosynthesis and Deactivation of Gibberellin-Dioxygenases Gene Family in Camellia sinensis (L.) O. Kuntze Genes doi: 10.3390/genes8090235 Authors: Cheng Pan Kunhong Tian Qiuyan Ban Leigang Wang Qilu Sun Yan He Yuanfei Yang Yuting Pan Yeyun Li Jiayue Jiang Changjun Jiang Gibberellins (GAs), a class of diterpenoid phytohormones, play a key role in regulating diverse processes throughout the life cycle of plants. Bioactive GA levels are rapidly regulated by Gibberellin-dioxygenases (GAox), which are involved in the biosynthesis and deactivation of gibberellin. In this manuscript, a comprehensive genome-wide analysis was carried out to find all GAox in Camellia sinensis. For the first time in a tea plant, 14 CsGAox genes, containing two domains, DIOX_N (PF14226) and 2OG-FeII_Oxy, were identified (PF03171). These genes all belong to 2-oxoglutarate-dependent dioxygenases (2-ODD), including four CsGA20ox (EC: 1.14.11.12), three CsGA3ox (EC: 1.14.11.15), and seven CsGA2ox (EC: 1.14.11.13). According to the phylogenetic classification as in Arabidopsis, the CsGAox genes spanned five subgroups. Each CsGAox shows tissue-specific expression patterns, although these vary greatly. Some candidate genes, which may play an important role in response to external abiotic stresses, have been identified with regards to patterns, such as CsGA20ox2, CsGA3ox2, CsGA3ox3, CsGA2ox1, CsGA2ox2, and CsGA2ox4. The bioactive GA levels may be closely related to the GA20ox, GA3ox and GA2ox genes. In addition, the candidate genes could be used as marker genes for abiotic stress resistance breeding in tea plants.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-09-28
    Description: Genes, Vol. 8, Pages 243: Genetic Association between Amyotrophic Lateral Sclerosis and Cancer Genes doi: 10.3390/genes8100243 Authors: Y-h. Taguchi Hsiuying Wang Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. An ALS drug, Riluzole, has been shown to induce two different anticancer effects on hepatocellular carcinoma (HCC). In light of this finding, we explore the relationship between ALS and cancer, especially for HCC, from the molecular biological viewpoint. We establish biomarkers that can discriminate between ALS patients and healthy controls. A principal component analysis (PCA) based unsupervised feature extraction (FE) is used to find gene biomarkers of ALS based on microarray gene expression data. Based on this method, 101 probes were selected as biomarkers for ALS with 95% high accuracy to discriminate between ALS patients and controls. Most of the genes corresponding to these probes are shown to be related to various cancers. These findings might provide a new insight for developing new therapeutic options or drugs for both ALS and cancer.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    Publication Date: 2017-10-01
    Description: Genes, Vol. 8, Pages 249: Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species Genes doi: 10.3390/genes8100249 Authors: Madhav Nepal Ethan Andersen Surendra Neupane Benjamin Benson Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis, we investigated nTNL orthologs in the genomes of common bean, Medicago, soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis, common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    Publication Date: 2017-10-03
    Description: Genes, Vol. 8, Pages 251: Dystrophin Dp116: A yet to Be Investigated Product of the Duchenne Muscular Dystrophy Gene Genes doi: 10.3390/genes8100251 Authors: Masafumi Matsuo Hiroyuki Awano Masaaki Matsumoto Masashi Nagai Tatsuya Kawaguchi Zhujun Zhang Hisahide Nishio The Duchenne muscular dystrophy (DMD) gene is one of the largest genes in the human genome. The gene exhibits a complex arrangement of seven alternative promoters, which drive the expression of three full length and four shorter isoforms. Dp116, the second smallest product of the DMD gene, is a Schwann cell‐specific isoform encoded by a transcript corresponding to DMD exons 56–79, starting from a promoter/exon S1 within intron 55. The physiological roles of Dp116 are poorly understood, because of its extensive homology with other isoforms and its expression in specific tissues. This review summarizes studies on Dp116, focusing on clinical findings and alternative activation of the upstream translation initiation codon that is predicted to produce Dp118.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    Publication Date: 2017-10-06
    Description: Genes, Vol. 8, Pages 259: Novel EDA or EDAR Mutations Identified in Patients with X-Linked Hypohidrotic Ectodermal Dysplasia or Non-Syndromic Tooth Agenesis Genes doi: 10.3390/genes8100259 Authors: Binghui Zeng Qi Zhao Sijie Li Hui Lu Jiaxuan Lu Lan Ma Wei Zhao Dongsheng Yu Abstract: Both X-linked hypohidrotic ectodermal dysplasia (XLHED) and non-syndromic tooth agenesis (NSTA) result in symptoms of congenital tooth loss. This study investigated genetic causes in two families with XLHED and four families with NSTA. We screened for mutations of WNT10A, EDA, EDAR, EDARADD, PAX9, MSX1, AXIN2, LRP6, and WNT10B through Sanger sequencing. Whole exome sequencing was performed for the proband of NSTA Family 4. Novel mutation c.1051G>T (p.Val351Phe) and the known mutation c.467G>A (p.Arg156His) of Ectodysplasin A (EDA) were identified in families with XLHED. Novel EDA receptor (EDAR) mutation c.73C>T (p.Arg25*), known EDA mutation c.491A>C (p.Glu164Ala), and known Wnt family member 10A (WNT10A) mutations c.511C>T (p.Arg171Cys) and c.742C>T (p.Arg248*) were identified in families with NSTA. The novel EDA and EDAR mutations were predicted as being pathogenic through bioinformatics analyses and structural modeling. Two variants of WNT10A, c.374G>A (p.Arg125Lys) and c.125A>G (p.Asn42Ser), were found in patients with NSTA. The two WNT10A variants were predicted to affect the splicing of message RNA, but minigene experiments showed normal splicing of mutated minigenes. This study uncovered the genetic foundations with respect to six families with XLHED or NSTA. We identified six mutations, of which two were novel mutations of EDA and EDAR. This is the first report of a nonsense EDAR mutation leading to NSTA.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    Publication Date: 2017-10-06
    Description: Genes, Vol. 8, Pages 258: Chromosomal Evolution in Lower Vertebrates: Sex Chromosomes in Neotropical Fishes Genes doi: 10.3390/genes8100258 Authors: Marcelo de Bello Cioffi Cassia Fernanda Yano Alexandr Sember Luiz Antônio Carlos Bertollo Abstract: Fishes exhibit the greatest diversity of species among vertebrates, offering a number of relevant models for genetic and evolutionary studies. The investigation of sex chromosome differentiation is a very active and striking research area of fish cytogenetics, as fishes represent one of the most vital model groups. Neotropical fish species show an amazing variety of sex chromosome systems, where different stages of differentiation can be found, ranging from homomorphic to highly differentiated sex chromosomes. Here, we draw attention on the impact of recent developments in molecular cytogenetic analyses that helped to elucidate many unknown questions about fish sex chromosome evolution, using excellent characiform models occurring in the Neotropical region, namely the Erythrinidae family and the Triportheus genus. While in Erythrinidae distinct XY and/or multiple XY-derived sex chromosome systems have independently evolved at least four different times, representatives of Triportheus show an opposite scenario, i.e., highly conserved ZZ/ZW system with a monophyletic origin. In both cases, recent molecular approaches, such as mapping of repetitive DNA classes, comparative genomic hybridization (CGH), and whole chromosome painting (WCP), allowed us to unmask several new features linked to the molecular composition and differentiation processes of sex chromosomes in fishes.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    Publication Date: 2017-10-06
    Description: Genes, Vol. 8, Pages 217: Alternative Splicing in Breast Cancer and the Potential Development of Therapeutic Tools Genes doi: 10.3390/genes8100217 Authors: Nancy Martínez-Montiel Maricruz Anaya-Ruiz Martín Pérez-Santos Rebeca Martínez-Contreras Alternative splicing is a key molecular mechanism now considered as a hallmark of cancer that has been associated with the expression of distinct isoforms during the onset and progression of the disease. The leading cause of cancer-related deaths in women worldwide is breast cancer, and even when the role of alternative splicing in this type of cancer has been established, the function of this mechanism in breast cancer biology is not completely decoded. In order to gain a comprehensive view of the role of alternative splicing in breast cancer biology and development, we summarize here recent findings regarding alternative splicing events that have been well documented for breast cancer evolution, considering its prognostic and therapeutic value. Moreover, we analyze how the response to endocrine and chemical therapies could be affected due to alternative splicing and differential expression of variant isoforms. With all this knowledge, it becomes clear that targeting alternative splicing represents an innovative approach for breast cancer therapeutics and the information derived from current studies could guide clinical decisions with a direct impact in the clinical advances for breast cancer patients nowadays.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    Publication Date: 2017-10-06
    Description: Genes, Vol. 8, Pages 256: The Genetic Basis of Pericentral Retinitis Pigmentosa—A Form of Mild Retinitis Pigmentosa Genes doi: 10.3390/genes8100256 Authors: Jason Comander Carol Weigel-DiFranco Matthew Maher Emily Place Aliete Wan Shyana Harper Michael Sandberg Daniel Navarro-Gomez Eric Pierce Pericentral retinitis pigmentosa (RP) is an atypical form of RP that affects the near-peripheral retina first and tends to spare the far periphery. This study was performed to further define the genetic basis of this phenotype. We identified a cohort of 43 probands with pericentral RP based on a comprehensive analysis of their retinal phenotype. Genetic analyses of DNA samples from these patients were performed using panel-based next-generation sequencing, copy number variations, and whole exome sequencing (WES). Mutations provisionally responsible for disease were found in 19 of the 43 families (44%) analyzed. These include mutations in RHO (five patients), USH2A (four patients), and PDE6B (two patients). Of 28 putatively pathogenic alleles, 15 (54%) have been previously identified in patients with more common forms of typical RP, while the remaining 13 mutations (46%) were novel. Burden testing of WES data successfully identified HGSNAT as a cause of pericentral RP in at least two patients, suggesting it is also a relatively common cause of pericentral RP. While additional sequencing might uncover new genes specifically associated with pericentral RP, the current results suggest that genetically pericentral RP is not a separate clinical entity, but rather is part of the spectrum of mild RP phenotypes.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    Publication Date: 2017-10-06
    Description: Genes, Vol. 8, Pages 257: Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale Genes doi: 10.3390/genes8100257 Authors: Liu He Shuhua Fu Zhichao Xu Jun Yan Jiang Xu Hong Zhou Jianguo Zhou Xinlian Chen Ying Li Kin Fai Au Hui Yao Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS) and single-molecule real-time (SMRT) sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET) and one sucrose transporter (SUT) are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT) and four cellulose synthase (Ces) genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF) genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-10-07
    Description: Genes, Vol. 8, Pages 260: Intercompartmental Piecewise Gene Transfer Genes doi: 10.3390/genes8100260 Authors: Przemyslaw Szafranski Gene relocation from the residual genomes of organelles to the nuclear genome still continues, although as a scaled down evolutionary phenomenon, limited in occurrence mostly to protists (sensu lato) and land plants. During this process, the structural integrity of transferred genes is usually preserved. However, the relocation of mitochondrial genes that code for respiratory chain and ribosomal proteins is sometimes associated with their fragmentation into two complementary genes. Herein, this review compiles cases of piecewise gene transfer from the mitochondria to the nucleus, and discusses hypothesized mechanistic links between the fission and relocation of those genes.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    Publication Date: 2017-10-07
    Description: Genes, Vol. 8, Pages 261: Expression Profiling of Mitogen-Activated Protein Kinase Genes Reveals Their Evolutionary and Functional Diversity in Different Rubber Tree (Hevea brasiliensis) Cultivars Genes doi: 10.3390/genes8100261 Authors: Xiang Jin Liping Zhu Qi Yao Xueru Meng Guohua Ding Dan Wang Quanliang Xie Zheng Tong Chengcheng Tao Li Yu Hongbin Li Xuchu Wang Rubber tree (Hevea brasiliensis) is the only commercially cultivated plant for producing natural rubber, one of the most essential industrial raw materials. Knowledge of the evolutionary and functional characteristics of kinases in H. brasiliensis is limited because of the long growth period and lack of well annotated genome information. Here, we reported mitogen-activated protein kinases in H. brasiliensis (HbMPKs) by manually checking and correcting the rubber tree genome. Of the 20 identified HbMPKs, four members were validated by proteomic data. Protein motif and phylogenetic analyses classified these members into four known groups comprising Thr-Glu-Tyr (TEY) and Thr-Asp-Tyr (TDY) domains, respectively. Evolutionary and syntenic analyses suggested four duplication events: HbMPK3/HbMPK6, HbMPK8/HbMPK9/HbMPK15, HbMPK10/HbMPK12 and HbMPK11/HbMPK16/HbMPK19. Expression profiling of the identified HbMPKs in roots, stems, leaves and latex obtained from three cultivars with different latex yield ability revealed tissue- and variety-expression specificity of HbMPK paralogues. Gene expression patterns under osmotic, oxidative, salt and cold stresses, combined with cis-element distribution analyses, indicated different regulation patterns of HbMPK paralogues. Further, Ka/Ks and Tajima analyses suggested an accelerated evolutionary rate in paralogues HbMPK10/12. These results revealed HbMPKs have diverse functions in natural rubber biosynthesis, and highlighted the potential possibility of using MPKs to improve stress tolerance in future rubber tree breeding.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    Publication Date: 2017-10-11
    Description: Genes, Vol. 8, Pages 263: Analysis of the Impact of Known SPINK1 Missense Variants on Pre-mRNA Splicing and/or mRNA Stability in a Full-Length Gene Assay Genes doi: 10.3390/genes8100263 Authors: Hao Wu Arnaud Boulling David Cooper Zhao-Shen Li Zhuan Liao Claude Férec Jian-Min Chen It is increasingly appreciated that missense variants may not only alter protein structure and function but may also influence pre-mRNA splicing and/or mRNA stability. Here we explore this issue in the context of currently known SPINK1 missense variants using a full-length gene assay. We demonstrated that 4 (17%) out of 24 variants tested significantly reduced pre-mRNA splicing and/or stability as compared with the wild-type. However, since the strongest effect observed was a 23% reduction from normal, the contribution of SPINK1 missense variants to the clinical phenotype through an impact on mRNA processing alone may be relatively minor compared with their effects in relation to protein structure/function.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    Publication Date: 2017-10-14
    Description: Genes, Vol. 8, Pages 273: The History of Tree and Shrub Taxa on Bol'shoy Lyakhovsky Island (New Siberian Archipelago) since the Last Interglacial Uncovered by Sedimentary Ancient DNA and Pollen Data Genes doi: 10.3390/genes8100273 Authors: Heike Zimmermann Elena Raschke Laura Epp Kathleen Stoof-Leichsenring Lutz Schirrmeister Georg Schwamborn Ulrike Herzschuh Ecosystem boundaries, such as the Arctic-Boreal treeline, are strongly coupled with climate and were spatially highly dynamic during past glacial-interglacial cycles. Only a few studies cover vegetation changes since the last interglacial, as most of the former landscapes are inundated and difficult to access. Using pollen analysis and sedimentary ancient DNA (sedaDNA) metabarcoding, we reveal vegetation changes on Bol’shoy Lyakhovsky Island since the last interglacial from permafrost sediments. Last interglacial samples depict high levels of floral diversity with the presence of trees (Larix, Picea, Populus) and shrubs (Alnus, Betula, Ribes, Cornus, Saliceae) on the currently treeless island. After the Last Glacial Maximum, Larix re-colonised the island but disappeared along with most shrub taxa. This was probably caused by Holocene sea-level rise, which led to increased oceanic conditions on the island. Additionally, we applied two newly developed larch-specific chloroplast markers to evaluate their potential for tracking past population dynamics from environmental samples. The novel markers were successfully re-sequenced and exhibited two variants of each marker in last interglacial samples. SedaDNA can track vegetation changes as well as genetic changes across geographic space through time and can improve our understanding of past processes that shape modern patterns.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    Publication Date: 2017-10-14
    Description: Genes, Vol. 8, Pages 271: Effects of Conjugated Linoleic Acid Supplementation on the Expression Profile of miRNAs in Porcine Adipose Tissue Genes doi: 10.3390/genes8100271 Authors: Qi Wang Renli Qi Hong Liu Jing Wang Wenming Huang Feiyun Yang Jinxiu Huang Conjugated linoleic acids (CLAs) play a major role in adipocyte differentiation and lipid metabolism in animals. MicroRNAs (miRNAs) appear to be involved in many biological processes in adipose tissue. However, the specific influence on miRNAs by CLA supplementation in porcine adipose tissue remains unclear. Thus, we continuously added 1.5% CLA to the pig diet from the embryo stage to the finishing period and conducted a high-throughput sequencing approach to analyse the changes in adipose tissue miRNAs. We identified 283 known porcine miRNAs, and 14 miRNAs were differentially expressed in response to CLA treatment. A Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the targets of the 14 differentially expressed miRNAs were involved in the Wnt signalling pathway. The CLA treatment downregulated the gene expression of PPARγ, C/EBPα, FAS, and FATP1 in both subcutaneous and abdominal fat tissues; the analysis showed that ssc-miR-21 expression was significantly correlated with PPARγ expression (p<0.05), and speculated that ssc-miR-21 might influence adipogenesis through PPARγ. In conclusion, our study analysed the miRNA profiles in porcine adipose tissues by CLA treatment, and demonstrated that miRNAs are important regulators of fat lipogenesis. This study provides valuable information for the molecular regulatory mechanism of CLA on adipose tissue.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    Publication Date: 2017-10-14
    Description: Genes, Vol. 8, Pages 270: The Effect of Intra-articular Injection of Autologous Microfragmented Fat Tissue on Proteoglycan Synthesis in Patients with Knee Osteoarthritis Genes doi: 10.3390/genes8100270 Authors: Damir Hudetz Igor Borić Eduard Rod Željko Jeleč Andrej Radić Trpimir Vrdoljak Andrea Skelin Gordan Lauc Irena Trbojević-Akmačić Mihovil Plečko Ozren Polašek Dragan Primorac Osteoarthritis (OA) is one of the leading musculoskeletal disorders in the adult population. It is associated with cartilage damage triggered by the deterioration of the extracellular matrix tissue. The present study explores the effect of intra-articular injection of autologous microfragmented adipose tissue to host chondrocytes and cartilage proteoglycans in patients with knee OA. A prospective, non-randomized, interventional, single-center, open-label clinical trial was conducted from January 2016 to April 2017. A total of 17 patients were enrolled in the study, and 32 knees with osteoarthritis were assessed. Surgical intervention (lipoaspiration) followed by tissue processing and intra-articular injection of the final microfragmented adipose tissue product into the affected knee(s) was performed in all patients. Patients were assessed for visual analogue scale (VAS), delayed gadolinium-enhanced magnetic resonance imaging of cartilage (dGEMRIC) and immunoglobulin G (IgG) glycans at the baseline, three, six and 12 months after the treatment. Magnetic resonance sequence in dGEMRIC due to infiltration of the anionic, negatively charged contrast gadopentetate dimeglumine (Gd-DTPA2−) into the cartilage indicated that the contents of cartilage glycosaminoglycans significantly increased in specific areas of the treated knee joint. In addition, dGEMRIC consequently reflected subsequent changes in the mechanical axis of the lower extremities. The results of our study indicate that the use of autologous and microfragmented adipose tissue in patients with knee OA (measured by dGEMRIC MRI) increased glycosaminoglycan (GAG) content in hyaline cartilage, which is in line with observed VAS and clinical results.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-10-14
    Description: Genes, Vol. 8, Pages 272: Chromosomal Evolution in Chiroptera Genes doi: 10.3390/genes8100272 Authors: Cibele Sotero-Caio Robert Baker Marianne Volleth Chiroptera is the second largest order among mammals, with over 1300 species in 21 extant families. The group is extremely diverse in several aspects of its natural history, including dietary strategies, ecology, behavior and morphology. Bat genomes show ample chromosome diversity (from 2n = 14 to 62). As with other mammalian orders, Chiroptera is characterized by clades with low, moderate and extreme chromosomal change. In this article, we will discuss trends of karyotypic evolution within distinct bat lineages (especially Phyllostomidae, Hipposideridae and Rhinolophidae), focusing on two perspectives: evolution of genome architecture, modes of chromosomal evolution, and the use of chromosome data to resolve taxonomic problems.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    Publication Date: 2017-10-18
    Description: Genes, Vol. 8, Pages 274: Transcriptomic Analysis of Long Non-Coding RNAs and Coding Genes Uncovers a Complex Regulatory Network That Is Involved in Maize Seed Development Genes doi: 10.3390/genes8100274 Authors: Ming Zhu Min Zhang Lijuan Xing Wenzong Li Haiyang Jiang Lei Wang Miaoyun Xu Long non-coding RNAs (lncRNAs) have been reported to be involved in the development of maize plant. However, few focused on seed development of maize. Here, we identified 753 lncRNA candidates in maize genome from six seed samples. Similar to the mRNAs, lncRNAs showed tissue developmental stage specific and differential expression, indicating their putative role in seed development. Increasing evidence shows that crosstalk among RNAs mediated by shared microRNAs (miRNAs) represents a novel layer of gene regulation, which plays important roles in plant development. Functional roles and regulatory mechanisms of lncRNAs as competing endogenous RNAs (ceRNA) in plants, particularly in maize seed development, are unclear. We combined analyses of consistently altered 17 lncRNAs, 840 mRNAs and known miRNA to genome-wide investigate potential lncRNA-mediated ceRNA based on “ceRNA hypothesis”. The results uncovered seven novel lncRNAs as potential functional ceRNAs. Functional analyses based on their competitive coding-gene partners by Gene Ontology (GO) and KEGG biological pathway demonstrated that combined effects of multiple ceRNAs can have major impacts on general developmental and metabolic processes in maize seed. These findings provided a useful platform for uncovering novel mechanisms of maize seed development and may provide opportunities for the functional characterization of individual lncRNA in future studies.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    Publication Date: 2017-11-22
    Description: Genes, Vol. 8, Pages 335: Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress Genes doi: 10.3390/genes8110335 Authors: Lining Wang Xiangli Wu Wei Gao Mengran Zhao Jinxia Zhang Chenyang Huang Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    Publication Date: 2017-11-22
    Description: Genes, Vol. 8, Pages 334: Homoeologous Recombination of the V1r1-V1r2 Gene Cluster of Pheromone Receptors in an Allotetraploid Lineage of Teleosts Genes doi: 10.3390/genes8110334 Authors: Lei Zhong Weimin Wang In contrast to other olfactory receptor families that exhibit frequent lineage-specific expansions, the vomeronasal type 1 receptor (V1R) family exhibits a canonical six-member repertoire in teleosts. V1r1 and V1r2 are present in no more than one copy in all examined teleosts, including salmons, which are ancient polyploids, implying strict evolutionary constraints. However, recent polyploids have not been examined. Here, we identified a young allotetraploid lineage of weatherfishes and investigated their V1r1-V1r2 cluster. We found a novel pattern that the parental V1r1-V1r2 clusters had recombined in the tetraploid genome and that the recombinant was nearly fixed in the tetraploid population. Subsequent analyses suggested strong selective pressure, for both a new combination of paralogs and homogeneity among gene duplicates, acting on the V1r1-V1r2 pair.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    Publication Date: 2017-11-23
    Description: Genes, Vol. 8, Pages 339: Role of Non-Coding RNAs in the Etiology of Bladder Cancer Genes doi: 10.3390/genes8110339 Authors: Caterina Gulìa Stefano Baldassarra Fabrizio Signore Giuliano Rigon Valerio Pizzuti Marco Gaffi Vito Briganti Alessandro Porrello Roberto Piergentili According to data of the International Agency for Research on Cancer and the World Health Organization (Cancer Incidence in Five Continents, GLOBOCAN, and the World Health Organization Mortality), bladder is among the top ten body locations of cancer globally, with the highest incidence rates reported in Southern and Western Europe, North America, Northern Africa and Western Asia. Males (M) are more vulnerable to this disease than females (F), despite ample frequency variations in different countries, with a M:F ratio of 4.1:1 for incidence and 3.6:1 for mortality, worldwide. For a long time, bladder cancer was genetically classified through mutations of two genes, fibroblast growth factor receptor 3 (FGFR3, for low-grade, non-invasive papillary tumors) and tumor protein P53 (TP53, for high-grade, muscle-invasive tumors). However, more recently scientists have shown that this disease is far more complex, since genes directly involved are more than 150; so far, it has been described that altered gene expression (up- or down-regulation) may be present for up to 500 coding sequences in low-grade and up to 2300 in high-grade tumors. Non-coding RNAs are essential to explain, at least partially, this ample dysregulation. In this review, we summarize the present knowledge about long and short non-coding RNAs that have been linked to bladder cancer etiology.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    Publication Date: 2017-11-23
    Description: Genes, Vol. 8, Pages 337: The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems Genes doi: 10.3390/genes8110337 Authors: Gérard Guédon Virginie Libante Charles Coluzzi Sophie Payot Nathalie Leblond-Bourget Conjugation is a key mechanism of bacterial evolution that involves mobile genetic elements. Recent findings indicated that the main actors of conjugative transfer are not the well-known conjugative or mobilizable plasmids but are the integrated elements. This paper reviews current knowledge on “integrative and mobilizable elements” (IMEs) that have recently been shown to be highly diverse and highly widespread but are still rarely described. IMEs encode their own excision and integration and use the conjugation machinery of unrelated co-resident conjugative element for their own transfer. Recent studies revealed a much more complex and much more diverse lifecycle than initially thought. Besides their main transmission as integrated elements, IMEs probably use plasmid-like strategies to ensure their maintenance after excision. Their interaction with conjugative elements reveals not only harmless hitchhikers but also hunters that use conjugative elements as target for their integration or harmful parasites that subvert the conjugative apparatus of incoming elements to invade cells that harbor them. IMEs carry genes conferring various functions, such as resistance to antibiotics, that can enhance the fitness of their hosts and that contribute to their maintenance in bacterial populations. Taken as a whole, IMEs are probably major contributors to bacterial evolution.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    Publication Date: 2017-11-23
    Description: Genes, Vol. 8, Pages 338: Connections between Transcription Downstream of Genes and cis-SAGe Chimeric RNA Genes doi: 10.3390/genes8110338 Authors: Katarzyna Chwalenia Fujun Qin Sandeep Singh Panjapon Tangtrongstittikul Hui Li cis-Splicing between adjacent genes (cis-SAGe) is being recognized as one way to produce chimeric fusion RNAs. However, its detail mechanism is not clear. Recent study revealed induction of transcriptions downstream of genes (DoGs) under osmotic stress. Here, we investigated the influence of osmotic stress on cis-SAGe chimeric RNAs and their connection to DoGs. We found,the absence of induction of at least some cis-SAGe fusions and/or their corresponding DoGs at early time point(s). In fact, these DoGs and their cis-SAGe fusions are inversely correlated. This negative correlation was changed to positive at a later time point. These results suggest a direct competition between the two categories of transcripts when total pool of readthrough transcripts is limited at an early time point. At a later time point, DoGs and corresponding cis-SAGe fusions are both induced, indicating that total readthrough transcripts become more abundant. Finally, we observed overall enhancement of cis-SAGe chimeric RNAs in KCl-treated samples by RNA-Seq analysis.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    Publication Date: 2017-11-29
    Description: Genes, Vol. 8, Pages 349: The Potential of Zebrafish as a Model Organism for Improving the Translation of Genetic Anticancer Nanomedicines Genes doi: 10.3390/genes8120349 Authors: C. Gutiérrez-Lovera A.J. Vázquez-Ríos J. Guerra-Varela L. Sánchez M. de la Fuente In the last few decades, the field of nanomedicine applied to cancer has revolutionized cancer treatment: several nanoformulations have already reached the market and are routinely being used in the clinical practice. In the case of genetic nanomedicines, i.e., designed to deliver gene therapies to cancer cells for therapeutic purposes, advances have been less impressive. This is because of the many barriers that limit the access of the therapeutic nucleic acids to their target site, and the lack of models that would allow for an improvement in the understanding of how nanocarriers can be tailored to overcome them. Zebrafish has important advantages as a model species for the study of anticancer therapies, and have a lot to offer regarding the rational development of efficient delivery of genetic nanomedicines, and hence increasing the chances of their successful translation. This review aims to provide an overview of the recent advances in the development of genetic anticancer nanomedicines, and of the zebrafish models that stand as promising tools to shed light on their mechanisms of action and overall potential in oncology.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-11-29
    Description: Genes, Vol. 8, Pages 353: Circular RNAs (circRNAs) in Health and Disease Genes doi: 10.3390/genes8120353 Authors: Shahnaz Haque Lorna Harries Splicing events do not always produce a linear transcript. Circular RNAs (circRNAs) are a class of RNA that are emerging as key new members of the gene regulatory milieu, which are produced by back-splicing events within genes. In circRNA formation, rather than being spliced in a linear fashion, exons can be circularised by use of the 3′ acceptor splice site of an upstream exon, leading to the formation of a circular RNA species. circRNAs have been demonstrated across species and have the potential to present genetic information in new orientations distinct from their parent transcript. The importance of these RNA players in gene regulation and normal cellular homeostasis is now beginning to be recognised. They have several potential modes of action, from serving as sponges for micro RNAs and RNA binding proteins, to acting as transcriptional regulators. In accordance with an important role in the normal biology of the cell, perturbations of circRNA expression are now being reported in association with disease. Furthermore, the inherent stability of circRNAs conferred by their circular structure and exonuclease resistance, and their expression in blood and other peripheral tissues in association with endosomes and microvesicles, renders them excellent candidates as disease biomarkers. In this review, we explore the state of knowledge on this exciting class of transcripts in regulating gene expression and discuss their emerging role in health and disease.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-12-01
    Description: Genes, Vol. 8, Pages 358: Phylogenetic Analysis of the SNORD116 Locus Genes doi: 10.3390/genes8120358 Authors: Deborah Good Matthew Kocher The SNORD116 small nucleolar RNA locus (SNORD116@) is contained within the long noncoding RNA host gene SNHG14 on human chromosome 15q11-q13. The SNORD116 locus is a cluster of 28 or more small nucleolar (sno) RNAs; C/D box (SNORDs). Individual RNAs within the cluster are tandem, highly similar sequences, referred to as SNORD116-1, SNORD116-2, etc., with the entire set referred to as SNORD116@. There are also related SNORD116 loci on other chromosomes, and these additional loci are conserved among primates. Inherited chromosomal 15q11-q13 deletions, encompassing the SNORD116@ locus, are causative for the paternally-inherited/maternally-imprinted genetic condition, Prader–Willi syndrome (PWS). Using in silico tools, along with molecular-based and sequenced-based confirmation, phylogenetic analysis of the SNORD116@ locus was performed. The consensus sequence for the SNORD116@ snoRNAs from various species was determined both for all the SNORD116 snoRNAs, as well as those grouped using sequence and location according to a human grouping convention. The implications of these findings are put in perspective for studying SNORD116 in patients with inherited Prader–Willi syndrome, as well as model organisms.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    Publication Date: 2017-12-02
    Description: Genes, Vol. 8, Pages 360: Synthesis of Rhizobial Exopolysaccharides and Their Importance for Symbiosis with Legume Plants Genes doi: 10.3390/genes8120360 Authors: Małgorzata Marczak Andrzej Mazur Piotr Koper Kamil Żebracki Anna Skorupska Rhizobia dwell and multiply in the soil and represent a unique group of bacteria able to enter into a symbiotic interaction with plants from the Fabaceae family and fix atmospheric nitrogen inside de novo created plant organs, called nodules. One of the key determinants of the successful interaction between these bacteria and plants are exopolysaccharides, which represent species-specific homo- and heteropolymers of different carbohydrate units frequently decorated by non-carbohydrate substituents. Exopolysaccharides are typically built from repeat units assembled by the Wzx/Wzy-dependent pathway, where individual subunits are synthesized in conjunction with the lipid anchor undecaprenylphosphate (und-PP), due to the activity of glycosyltransferases. Complete oligosaccharide repeat units are transferred to the periplasmic space by the activity of the Wzx flippase, and, while still being anchored in the membrane, they are joined by the polymerase Wzy. Here we have focused on the genetic control over the process of exopolysaccharides (EPS) biosynthesis in rhizobia, with emphasis put on the recent advancements in understanding the mode of action of the key proteins operating in the pathway. A role played by exopolysaccharide in Rhizobium–legume symbiosis, including recent data confirming the signaling function of EPS, is also discussed.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    Publication Date: 2017-11-18
    Description: Genes, Vol. 8, Pages 330: The HMGA1 Pseudogene 7 Induces miR-483 and miR-675 Upregulation by Activating Egr1 through a ceRNA Mechanism Genes doi: 10.3390/genes8110330 Authors: Marco De Martino Giuseppe Palma Amalia Azzariti Claudio Arra Alfredo Fusco Francesco Esposito Several studies have established that pseudogene mRNAs can work as competing endogenous RNAs and, when deregulated, play a key role in the onset of human neoplasias. Recently, we have isolated two HMGA1 pseudogenes, HMGA1P6 and HMGA1P7. These pseudogenes have a critical role in cancer progression, acting as micro RNA (miRNA) sponges for HMGA1 and other cancer-related genes. HMGA1 pseudogenes were found overexpressed in several human carcinomas, and their expression levels positively correlate with an advanced cancer stage and a poor prognosis. In order to investigate the molecular alterations following HMGA1 pseudogene 7 overexpression, we carried out miRNA sequencing analysis on HMGA1P7 overexpressing mouse embryonic fibroblasts. Intriguingly, the most upregulated miRNAs were miR-483 and miR-675 that have been described as key regulators in cancer progression. Here, we report that HMGA1P7 upregulates miR-483 and miR-675 through a competing endogenous RNA mechanism with Egr1, a transcriptional factor that positively regulates miR-483 and miR-675 expression.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    Publication Date: 2017-11-18
    Description: Genes, Vol. 8, Pages 327: New Insights into Phasmatodea Chromosomes Genes doi: 10.3390/genes8110327 Authors: Thomas Liehr Olesya Buleu Tatyana Karamysheva Alexander Bugrov Nikolai Rubtsov Currently, approximately 3000 species of stick insects are known; however, chromosome numbers, which range between 21 and 88, are known for only a few of these insects. Also, centromere banding staining (C-banding) patterns were described for fewer than 10 species, and fluorescence in situ hybridization (FISH) was applied exclusively in two Leptynia species. Interestingly, 10–25% of stick insects (Phasmatodea) are obligatory or facultative parthenogenetic. As clonal and/or bisexual reproduction can affect chromosomal evolution, stick insect karyotypes need to be studied more intensely. Chromosome preparation from embryos of five Phasmatodea species (Medauroidea extradentata, Sungaya inexpectata, Sipyloidea sipylus, Phaenopharos khaoyaiensis, and Peruphasma schultei) from four families were studied here by C-banding and FISH applying ribosomal deoxyribonucleic acid (rDNA) and telomeric repeat probes. For three species, data on chromosome numbers and structure were obtained here for the first time, i.e., S. inexpectata, P. khaoyaiensis, and P. schultei. Large C-positive regions enriched with rDNA were identified in all five studied, distantly related species. Some of these C-positive blocks were enriched for telomeric repeats, as well. Chromosomal evolution of stick insects is characterized by variations in chromosome numbers as well as transposition and amplification of repetitive DNA sequences. Here, the first steps were made towards identification of individual chromosomes in Phasmatodea.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    Publication Date: 2017-11-18
    Description: Genes, Vol. 8, Pages 325: Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding Genes doi: 10.3390/genes8110325 Authors: Yueting Dai Wenying Su Chentao Yang Bing Song Yu Li Yongping Fu Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    Publication Date: 2017-12-05
    Description: Genes, Vol. 8, Pages 363: Molecular Investigation of the Stem Snap Point in Textile Hemp Genes doi: 10.3390/genes8120363 Authors: Marc Behr Sylvain Legay Jean-Francois Hausman Stanley Lutts Gea Guerriero Fibre crops are important natural resources, as they sustainably provide bast fibres, an economically-valuable raw material used in the textile and biocomposite sectors. Among fibre crops, textile hemp (Cannabis sativa L.) is appreciated for its long and strong gelatinous bast fibres. The stem of fibre crops is a useful system for cell wall-oriented studies, because it shows a strong tissue polarity with a lignified inner core and a cellulosic hypolignified cortex, as well as a basipetal lignification gradient. Along the stem axis of fibre crops, a specific region, denoted snap point, marks the transition from elongation (above it) to fibre thickening (below it). After empirically determining the snap point by tilting the plant, we divided the stem segment containing it into three non-overlapping consecutive regions measuring 1 cm each, and carried out targeted RT-qPCR on cell wall-related genes separately, in outer and inner tissues. Different gene clusters can be observed, two of which are the major gene groups, i.e., one group with members expressed at higher levels in the inner tissues, and one group whose genes are more expressed in the cortex. The present results provide a molecular validation that the snap point is characterised by a gradient of events associated with the shift from fibre elongation to thickening.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    Publication Date: 2017-12-05
    Description: Genes, Vol. 8, Pages 364: Delivery Mode and the Transition of Pioneering Gut-Microbiota Structure, Composition and Predicted Metabolic Function Genes doi: 10.3390/genes8120364 Authors: Noel Mueller Hakdong Shin Aline Pizoni Isabel Werlang Ursula Matte Marcelo Goldani Helena Goldani Maria Dominguez-Bello Cesarean (C-section) delivery, recently shown to cause excess weight gain in mice, perturbs human neonatal gut microbiota development due to the lack of natural mother-to-newborn transfer of microbes. Neonates excrete first the in-utero intestinal content (referred to as meconium) hours after birth, followed by intestinal contents reflective of extra-uterine exposure (referred to as transition stool) 2 to 3 days after birth. It is not clear when the effect of C-section on the neonatal gut microbiota emerges. We examined bacterial DNA in carefully-collected meconium, and the subsequent transitional stool, from 59 neonates [13 born by scheduled C-section and 46 born by vaginal delivery] in a private hospital in Brazil. Bacterial DNA was extracted, and the V4 region of the 16S rRNA gene was sequenced using the Illumina MiSeq (San Diego, CA, USA) platform. We found evidence of bacterial DNA in the majority of meconium samples in our study. The bacterial DNA structure (i.e., beta diversity) of meconium differed significantly from that of the transitional stool microbiota. There was a significant reduction in bacterial alpha diversity (e.g., number of observed bacterial species) and change in bacterial composition (e.g., reduced Proteobacteria) in the transition from meconium to stool. However, changes in predicted microbiota metabolic function from meconium to transitional stool were only observed in vaginally-delivered neonates. Within sample comparisons showed that delivery mode was significantly associated with bacterial structure, composition and predicted microbiota metabolic function in transitional-stool samples, but not in meconium samples. Specifically, compared to vaginally delivered neonates, the transitional stool of C-section delivered neonates had lower proportions of the genera Bacteroides, Parabacteroides and Clostridium. These differences led to C-section neonates having lower predicted abundance of microbial genes related to metabolism of amino and nucleotide sugars, and higher abundance of genes related to fatty-acid metabolism, amino-acid degradation and xenobiotics biodegradation. In summary, microbiota diversity was reduced in the transition from meconium to stool, and the association of delivery mode with microbiota structure, composition and predicted metabolic function was not observed until the passing of the transitional stool after meconium.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    Publication Date: 2017-12-06
    Description: Genes, Vol. 8, Pages 365: Genome-Wide Comprehensive Analysis the Molecular Phylogenetic Evaluation and Tissue-Specific Expression of SABATH Gene Family in Salvia miltiorrhiza Genes doi: 10.3390/genes8120365 Authors: Bin Wang Shiqiang Wang Zhezhi Wang The plant SABATH gene family is a group of O-methyltransferases (O-MTs), which belongs to the S-adenosyl-l-methionine-dependent methyltransferases (SAM-MTs). The resulting reaction products of SABATH genes play an important role in various processes of plant development. In this study, a total of 30 SABATH genes were detected in Salvia miltiorrhiza, which is an important medicinal plant, widely used to treat cardiovascular disease. Multiple sequence alignment and phylogenetic analyses showed that SmSABATH genes could be classified into three groups. The ratios of non-synonymous (Ka) and synonymous (Ks) substitution rates of 11 pairs paralogous of SmSABATH genes revealed that the SmSABATH genes had gone through purifying selection. Positive selection analyses using site models and branch-site models indicated that SmSABATH genes had undergone selective pressure for adaptive evolution. Functional divergence analyses suggested that the SmSABATH subgroup genes were divergent in terms of functions and positive selection sites that contributed to a functional divergence among the subgroups that were detected. Tissue-specific expression showed that the SABATH gene family in S. miltiorrhiza was primarily expressed in stems and leaves.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    Publication Date: 2017-12-06
    Description: Genes, Vol. 8, Pages 368: scRNASeqDB: A Database for RNA-Seq Based Gene Expression Profiles in Human Single Cells Genes doi: 10.3390/genes8120368 Authors: Yuan Cao Junjie Zhu Peilin Jia Zhongming Zhao Single-cell RNA sequencing (scRNA-Seq) is rapidly becoming a powerful tool for high-throughput transcriptomic analysis of cell states and dynamics at the single cell level. Both the number and quality of scRNA-Seq datasets have dramatically increased recently. A database that can comprehensively collect, curate, and compare expression features of scRNA-Seq data in humans has not yet been built. Here, we present scRNASeqDB, a database that includes almost all the currently available human single cell transcriptome datasets (n = 38) covering 200 human cell lines or cell types and 13,440 samples. Our online web interface allows users to rank the expression profiles of the genes of interest across different cell types. It also provides tools to query and visualize data, including Gene Ontology and pathway annotations for differentially expressed genes between cell types or groups. The scRNASeqDB is a useful resource for single cell transcriptional studies. This database is publicly available at bioinfo.uth.edu/scrnaseqdb/.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    Publication Date: 2017-12-06
    Description: Genes, Vol. 8, Pages 366: Current Research on Non-Coding Ribonucleic Acid (RNA) Genes doi: 10.3390/genes8120366 Authors: Jing Wang David Samuels Shilin Zhao Yu Xiang Ying-Yong Zhao Yan Guo Non-coding ribonucleic acid (RNA) has without a doubt captured the interest of biomedical researchers. The ability to screen the entire human genome with high-throughput sequencing technology has greatly enhanced the identification, annotation and prediction of the functionality of non-coding RNAs. In this review, we discuss the current landscape of non-coding RNA research and quantitative analysis. Non-coding RNA will be categorized into two major groups by size: long non-coding RNAs and small RNAs. In long non-coding RNA, we discuss regular long non-coding RNA, pseudogenes and circular RNA. In small RNA, we discuss miRNA, transfer RNA, piwi-interacting RNA, small nucleolar RNA, small nuclear RNA, Y RNA, single recognition particle RNA, and 7SK RNA. We elaborate on the origin, detection method, and potential association with disease, putative functional mechanisms, and public resources for these non-coding RNAs. We aim to provide readers with a complete overview of non-coding RNAs and incite additional interest in non-coding RNA research.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    Publication Date: 2017-12-06
    Description: Genes, Vol. 8, Pages 369: Comparative Analysis of Cotton Small RNAs and Their Target Genes in Response to Salt Stress Genes doi: 10.3390/genes8120369 Authors: Zujun Yin Xiulan Han Yan Li Junjuan Wang Delong Wang Shuai Wang Xiaoqiong Fu Wuwei Ye Small RNAs play an important role in regulating plant responses to abiotic stress. Depending on the method of salt application, whether sudden or gradual, plants may experience either salt shock or salt stress, respectively. In this study, small RNA expression in response to salt shock and long-term salt stress in parallel experiments was described. Cotton small RNA libraries were constructed and sequenced under normal conditions, as well as sudden and gradual salt application. A total of 225 cotton microRNAs (miRNAs) were identified and of these 24 were novel miRNAs. There were 88 and 75 miRNAs with differential expression under the salt shock and long-term salt stress, respectively. Thirty one transcripts were found to be targets of 20 miRNA families. Eight targets showed a negative correlation in expression with their corresponding miRNAs. We also identified two TAS3s with two near-identical 21-nt trans-acting small interfering RNA (tasiRNA)-Auxin Response Factors (ARFs) that coaligned with the phases D7(+) and D8(+) in three Gossypium species. The miR390/tasiRNA-ARFs/ARF4 pathway was identified and showed altered expression under salt stress. The identification of these small RNAs as well as elucidating their functional significance broadens our understanding of post-transcriptional gene regulation in response to salt stress.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    Publication Date: 2017-12-06
    Description: Genes, Vol. 8, Pages 367: Histone MacroH2A1: A Chromatin Point of Intersection between Fasting, Senescence and Cellular Regeneration Genes doi: 10.3390/genes8120367 Authors: Oriana Lo Re Manlio Vinciguerra Histone variants confer chromatin unique properties. They have specific genomic distribution, regulated by specific deposition and removal machineries. Histone variants, mostly of canonical histones H2A, H2B and H3, have important roles in early embryonic development, in lineage commitment of stem cells, in the converse process of somatic cell reprogramming to pluripotency and, in some cases, in the modulation of animal aging and life span. MacroH2A1 is a variant of histone H2A, present in two alternatively exon-spliced isoforms macroH2A1.1 and macroH2A1.2, regulating cell plasticity and proliferation, during pluripotency and tumorigenesis. Furthermore, macroH2A1 participates in the formation of senescence-associated heterochromatic foci (SAHF) in senescent cells, and multiple lines of evidence in genetically modified mice suggest that macroH2A1 integrates nutritional cues from the extracellular environment to transcriptional programs. Here, we review current molecular evidence based on next generation sequencing data, cell assays and in vivo models supporting different mechanisms that could mediate the function of macroH2A1 in health span and life span. We will further discuss context-dependent and isoform-specific functions. The aim of this review is to provide guidance to assess histone variant macroH2A1 potential as a therapeutic intervention point.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    Publication Date: 2017-12-09
    Description: Genes, Vol. 8, Pages 373: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Genes doi: 10.3390/genes8120373 Authors: Eric Iverson David Goodman Madeline Gorchels Kenneth Stedman Viruses with spindle or lemon-shaped virions are rare in the world of viruses, but are common in viruses of archaeal extremophiles, possibly due to the extreme conditions in which they thrive. However, the structural and genetic basis for the unique spindle shape is unknown. The best-studied spindle-shaped virus, Sulfolobus Spindle-shaped Virus 1 (SSV1), is composed mostly of the major capsid protein VP1. Similar to many other viruses, proteolytic cleavage of VP1 is thought to be critical for virion formation. Unlike half of the genes in SSV1, including the minor capsid protein gene VP3, the VP1 gene does not tolerate deletion or transposon insertion. To determine the role of the VP1 gene and its proteolysis for virus function, we developed techniques for site-directed mutagenesis of the SSV1 genome and complemented deletion mutants with VP1 genes from other SSVs. By analyzing these mutants, we demonstrate that the N-terminus of the VP1 protein is required, but the N-terminus, or entire SSV1 VP1 protein, can be exchanged with VP1s from other SSVs. However, the conserved glutamate at the cleavage site is not essential for infectivity. Interestingly, viruses containing point mutations at this position generate mostly abnormal virions.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    Publication Date: 2017-12-09
    Description: Genes, Vol. 8, Pages 372: Tissue-Specific Transcriptome Analysis Reveals Multiple Responses to Salt Stress in Populus euphratica Seedlings Genes doi: 10.3390/genes8120372 Authors: Le Yu Jianchao Ma Zhimin Niu Xiaotao Bai Wenli Lei Xuemin Shao Ningning Chen Fangfang Zhou Dongshi Wan Salt stress is one of the most crucial factors impacting plant growth, development and reproduction. However, information regarding differences in tissue-specific gene expression patterns, which may improve a plant’s tolerance to salt stress, is limited. Here, we investigated the gene expression patterns in tissues of Populus euphratica Oliv. seedlings using RNA sequencing (RNA-Seq) technology. A total of 109.3 million, 125bp paired-end clean reads were generated, and 6428, 4797, 2335 and 3358 differentially expressed genes (DEGs) were identified in leaf, phloem, xylem and root tissues, respectively. While the tissue-specific DEGs under salt stress had diverse functions, “membrane transporter activity” was the most significant leaf function, whereas “oxidation–reduction process” was the most significant function in root tissue. Further analysis of the tissue-specific DEGs showed that the expression patterns or functions of gene families, such as SOS, NHX, GolS, GPX, APX, RBOHF and CBL, were diverse, suggesting that calcium signaling, reactive oxygen species (ROS) and salt overly sensitive (SOS) pathways are all involved in ionic homeostasis in tissues from P. euphratica seedlings. The DEGs, for example the up-regulated antioxidant genes, contribute to ROS-scavenging induced by salt stress but result in decreased Na+ concentrations in root vasculature cells and in xylem sap, while the down-regulated rbohF leads to the reverse results. These results suggest that the divergence of DEGs expression patterns contribute to maintenance of ionic and ROS homeostasis in tissues and improve plant salinity tolerance. We comprehensively analyzed the response of P. euphratica seedlings to salt stress and provide helpful genetic resources for studying plant-abiotic stress interactions.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    Publication Date: 2017-12-12
    Description: Genes, Vol. 8, Pages 381: An Expanded Multi-Organ Disease Phenotype Associated with Mutations in YARS Genes doi: 10.3390/genes8120381 Authors: Anna Tracewska-Siemiątkowska Lonneke Haer-Wigman Danielle Bosch Deborah Nickerson Michael Bamshad University of Washington Center for Mendelian Genomics Maartje van de Vorst Nanna Rendtorff Claes Möller Ulrika Kjellström Sten Andréasson Frans Cremers Lisbeth Tranebjærg Whole exome sequence analysis was performed in a Swedish mother–father-affected proband trio with a phenotype characterized by progressive retinal degeneration with congenital nystagmus, profound congenital hearing impairment, primary amenorrhea, agenesis of the corpus callosum, and liver disease. A homozygous variant c.806T > C, p.(F269S) in the tyrosyl-tRNA synthetase gene (YARS) was the only identified candidate variant consistent with autosomal recessive inheritance. Mutations in YARS have previously been associated with both autosomal dominant Charcot-Marie-Tooth syndrome and a recently reported autosomal recessive multiorgan disease. Herein, we propose that mutations in YARS underlie another clinical phenotype adding a second variant of the disease, including retinitis pigmentosa and deafness, to the spectrum of YARS-associated disorders.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    Publication Date: 2017-12-12
    Description: Genes, Vol. 8, Pages 378: The Genome of the Beluga Whale (Delphinapterus leucas) Genes doi: 10.3390/genes8120378 Authors: Steven Jones Gregory Taylor Simon Chan René Warren S. Hammond Steven Bilobram Gideon Mordecai Curtis Suttle Kristina Miller Angela Schulze Amy Chan Samantha Jones Kane Tse Irene Li Dorothy Cheung Karen Mungall Caleb Choo Adrian Ally Noreen Dhalla Angela Tam Armelle Troussard Heather Kirk Pawan Pandoh Daniel Paulino Robin Coope Andrew Mungall Richard Moore Yongjun Zhao Inanc Birol Yussanne Ma Marco Marra Martin Haulena The beluga whale is a cetacean that inhabits arctic and subarctic regions, and is the only living member of the genus Delphinapterus. The genome of the beluga whale was determined using DNA sequencing approaches that employed both microfluidic partitioning library and non-partitioned library construction. The former allowed for the construction of a highly contiguous assembly with a scaffold N50 length of over 19 Mbp and total reconstruction of 2.32 Gbp. To aid our understanding of the functional elements, transcriptome data was also derived from brain, duodenum, heart, lung, spleen, and liver tissue. Assembled sequence and all of the underlying sequence data are available at the National Center for Biotechnology Information (NCBI) under the Bioproject accession number PRJNA360851A.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    Publication Date: 2017-12-12
    Description: Genes, Vol. 8, Pages 379: The Genome of the Northern Sea Otter (Enhydra lutris kenyoni) Genes doi: 10.3390/genes8120379 Authors: Samantha Jones Martin Haulena Gregory Taylor Simon Chan Steven Bilobram René Warren S. Hammond Karen Mungall Caleb Choo Heather Kirk Pawan Pandoh Adrian Ally Noreen Dhalla Angela Tam Armelle Troussard Daniel Paulino Robin Coope Andrew Mungall Richard Moore Yongjun Zhao Inanc Birol Yussanne Ma Marco Marra Steven Jones The northern sea otter inhabits coastal waters of the northern Pacific Ocean and is the largest member of the Mustelidae family. DNA sequencing methods that utilize microfluidic partitioned and non-partitioned library construction were used to establish the sea otter genome. The final assembly provided 2.426 Gbp of highly contiguous assembled genomic sequences with a scaffold N50 length of over 38 Mbp. We generated transcriptome data derived from a lymphoma to aid in the determination of functional elements. The assembled genome sequence and underlying sequence data are available at the National Center for Biotechnology Information (NCBI) under the BioProject accession number PRJNA388419.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    Publication Date: 2017-12-12
    Description: Genes, Vol. 8, Pages 380: The Alteration of Nasopharyngeal and Oropharyngeal Microbiota in Children with MPP and Non-MPP Genes doi: 10.3390/genes8120380 Authors: Zhiwei Lu Wenkui Dai Yanhong Liu Qian Zhou Heping Wang Dongfang Li Zhenyu Yang Yinhu Li Gan Xie Shuaicheng Li Yuejie Zheng Background: In recent years, the morbidity of Mycoplasma pneumoniae pneumonia (MPP) has increased significantly in China. A growing number of studies indicate that imbalanced respiratory microbiota is associated with various respiratory diseases. Methods: We enrolled 119 children, including 60 pneumonia patients and 59 healthy children. Nasopharyngeal (NP) and oropharyngeal (OP) sampling was performed for 16S ribosomal RNA (16S rRNA) gene analysis of all children. Sputum and OP swabs were obtained from patients for pathogen detection. Results: Both the NP and OP microbiota of patients differ significantly from that of healthy children. Diseased children harbor lower microbial diversity and a simpler co-occurrence network in NP and OP. In pneumonia patients, NP and OP microbiota showed greater similarities between each other, suggesting transmission of NP microbiota to the OP. Aside from clinically detected pathogens, NP and OP microbiota analysis has also identified possible pathogens in seven cases with unknown infections. Conclusion: NP and OP microbiota in MPP and non-MPP are definitely similar. Respiratory infection generates imbalanced NP microbiota, which has the potential to transmit to OP. Microbiota analysis also promises to compliment the present means of detecting respiratory pathogens.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    Publication Date: 2017-12-13
    Description: Genes, Vol. 8, Pages 362: Functional Characterization of the Versatile MYB Gene Family Uncovered Their Important Roles in Plant Development and Responses to Drought and Waterlogging in Sesame Genes doi: 10.3390/genes8120362 Authors: Marie Mmadi Komivi Dossa Linhai Wang Rong Zhou Yanyan Wang Ndiaga Cisse Mame Sy Xiurong Zhang The MYB gene family constitutes one of the largest transcription factors (TFs) modulating various biological processes in plants. Although genome-wide analysis of this gene family has been carried out in some species, only three MYB members have been functionally characterized heretofore in sesame (Sesamum indicum L.). Here, we identified a relatively high number (287) of sesame MYB genes (SIMYBs) with an uncommon overrepresentation of the 1R-subfamily. A total of 95% of SIMYBs was mapped unevenly onto the 16 linkage groups of the sesame genome with 55 SIMYBs tandemly duplicated. In addition, molecular characterization, gene structure, and evolutionary relationships of SIMYBs were established. Based on the close relationship between sesame and Arabidopsis thaliana, we uncovered that the functions of SIMYBs are highly diverse. A total of 65% of SIMYBs were commonly detected in five tissues, suggesting that they represent key TFs modulating sesame growth and development. Moreover, we found that SIMYBs regulate sesame responses to drought and waterlogging, which highlights the potential of SIMYBs towards improving stress tolerance in sesame. This work presents a comprehensive picture of the MYB gene family in sesame and paves the way for further functional validation of the members of this versatile gene family.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    Publication Date: 2017-12-16
    Description: Genes, Vol. 8, Pages 388: Regulatory Elements Located in the Upstream Region of the Rhizobium leguminosarum rosR Global Regulator Are Essential for Its Transcription and mRNA Stability Genes doi: 10.3390/genes8120388 Authors: Kamila Rachwał Paulina Lipa Iwona Wojda José-María Vinardell Monika Janczarek Rhizobium leguminosarum bv. trifolii is a soil bacterium capable of establishing a symbiotic relationship with clover (Trifolium spp.). Previously, the rosR gene, encoding a global regulatory protein involved in motility, synthesis of cell-surface components, and other cellular processes was identified and characterized in this bacterium. This gene possesses a long upstream region that contains several regulatory motifs, including inverted repeats (IRs) of different lengths. So far, the role of these motifs in the regulation of rosR transcription has not been elucidated in detail. In this study, we performed a functional analysis of these motifs using a set of transcriptional rosR-lacZ fusions that contain mutations in these regions. The levels of rosR transcription for different mutant variants were evaluated in R. leguminosarum using both quantitative real-time PCR and β-galactosidase activity assays. Moreover, the stability of wild type rosR transcripts and those with mutations in the regulatory motifs was determined using an RNA decay assay and plasmids with mutations in different IRs located in the 5′-untranslated region of the gene. The results show that transcription of rosR undergoes complex regulation, in which several regulatory elements located in the upstream region and some regulatory proteins are engaged. These include an upstream regulatory element, an extension of the -10 element containing three nucleotides TGn (TGn-extended -10 element), several IRs, and PraR repressor related to quorum sensing.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    Publication Date: 2017-12-16
    Description: Genes, Vol. 8, Pages 389: Transcriptome Analysis of Paraburkholderia phymatum under Nitrogen Starvation and during Symbiosis with Phaseolus Vulgaris Genes doi: 10.3390/genes8120389 Authors: Martina Lardi Yilei Liu Gabriela Purtschert Samanta Bolzan de Campos Gabriella Pessi Paraburkholderia phymatum belongs to the β-subclass of proteobacteria. It has recently been shown to be able to nodulate and fix nitrogen in symbiosis with several mimosoid and papilionoid legumes. In contrast to the symbiosis of legumes with α-proteobacteria, very little is known about the molecular determinants underlying the successful establishment of this mutualistic relationship with β-proteobacteria. In this study, we performed an RNA-sequencing (RNA-seq) analysis of free-living P. phymatum growing under nitrogen-replete and -limited conditions, the latter partially mimicking the situation in nitrogen-deprived soils. Among the genes upregulated under nitrogen limitation, we found genes involved in exopolysaccharides production and in motility, two traits relevant for plant root infection. Next, RNA-seq data of P. phymatum grown under free-living conditions and from symbiotic root nodules of Phaseolus vulgaris (common bean) were generated and compared. Among the genes highly upregulated during symbiosis, we identified—besides the nif gene cluster—an operon encoding a potential cytochrome o ubiquinol oxidase (Bphy_3646-49). Bean root nodules induced by a cyoB mutant strain showed reduced nitrogenase and nitrogen fixation abilities, suggesting an important role of the cytochrome for respiration inside the nodule. The analysis of mutant strains for the RNA polymerase transcription factor RpoN (σ54) and its activator NifA indicated that—similar to the situation in α-rhizobia—P. phymatum RpoN and NifA are key regulators during symbiosis with P. vulgaris.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    Publication Date: 2017-12-16
    Description: Genes, Vol. 8, Pages 391: Isolation and Characterization of Ftsz Genes in Cassava Genes doi: 10.3390/genes8120391 Authors: Meng-Ting Geng Yi Min Yuan Yao Xia Chen Jie Fan Shuai Yuan Lei Wang Chong Sun Fan Zhang Lu Shang Yun-Lin Wang Rui-Mei Li Shao-Ping Fu Rui-Jun Duan Jiao Liu Xin-Wen Hu Jian-Chun Guo The filamenting temperature-sensitive Z proteins (FtsZs) play an important role in plastid division. In this study, three FtsZ genes were isolated from the cassava genome, and named MeFtsZ1, MeFtsZ2-1, and MeFtsZ2-2, respectively. Based on phylogeny, the MeFtsZs were classified into two groups (FtsZ1 and FtsZ2). MeFtsZ1 with a putative signal peptide at N-terminal, has six exons, and is classed to FtsZ1 clade. MeFtsZ2-1 and MeFtsZ2-2 without a putative signal peptide, have seven exons, and are classed to FtsZ2 clade. Subcellular localization found that all the three MeFtsZs could locate in chloroplasts and form a ring in chloroplastids. Structure analysis found that all MeFtsZ proteins contain a conserved guanosine triphosphatase (GTPase) domain in favor of generate contractile force for cassava plastid division. The expression profiles of MeFtsZ genes by quantitative reverse transcription-PCR (qRT-PCR) analysis in photosynthetic and non-photosynthetic tissues found that all of the MeFtsZ genes had higher expression levels in photosynthetic tissues, especially in younger leaves, and lower expression levels in the non-photosynthetic tissues. During cassava storage root development, the expressions of MeFtsZ2-1 and MeFtsZ2-2 were comparatively higher than MeFtsZ1. The transformed Arabidopsis of MeFtsZ2-1 and MeFtsZ2-2 contained abnormally shape, fewer number, and larger volume chloroplasts. Phytohormones were involved in regulating the expressions of MeFtsZ genes. Therefore, we deduced that all of the MeFtsZs play an important role in chloroplast division, and that MeFtsZ2 (2-1, 2-2) might be involved in amyloplast division and regulated by phytohormones during cassava storage root development.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    Publication Date: 2017-12-16
    Description: Genes, Vol. 8, Pages 390: Requirements for Efficient Thiosulfate Oxidation in Bradyrhizobium diazoefficiens Genes doi: 10.3390/genes8120390 Authors: Sachiko Masuda Hauke Hennecke Hans-Martin Fischer One of the many disparate lifestyles of Bradyrhizobium diazoefficiens is chemolithotrophic growth with thiosulfate as an electron donor for respiration. The employed carbon source may be CO2 (autotrophy) or an organic compound such as succinate (mixotrophy). Here, we discovered three new facets of this capacity: (i) When thiosulfate and succinate were consumed concomitantly in conditions of mixotrophy, even a high molar excess of succinate did not exert efficient catabolite repression over the use of thiosulfate. (ii) Using appropriate cytochrome mutants, we found that electrons derived from thiosulfate during chemolithoautotrophic growth are preferentially channeled via cytochrome c550 to the aa3-type heme-copper cytochrome oxidase. (iii) Three genetic regulators were identified to act at least partially in the expression control of genes for chemolithoautotrophic thiosulfate oxidation: RegR and CbbR as activators, and SoxR as a repressor.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-12-30
    Description: Genes, Vol. 9, Pages 9: Signaling Pathways Driving Aberrant Splicing in Cancer Cells Genes doi: 10.3390/genes9010009 Authors: Vânia Gonçalves Joana Pereira Peter Jordan Aberrant profiles of pre-mRNA splicing are frequently observed in cancer. At the molecular level, an altered profile results from a complex interplay between chromatin modifications, the transcriptional elongation rate of RNA polymerase, and effective binding of the spliceosome to the generated transcripts. Key players in this interplay are regulatory splicing factors (SFs) that bind to gene-specific splice-regulatory sequence elements. Although mutations in genes of some SFs were described, a major driver of aberrant splicing profiles is oncogenic signal transduction pathways. Signaling can affect either the transcriptional expression levels of SFs or the post-translational modification of SF proteins, and both modulate the ratio of nuclear versus cytoplasmic SFs in a given cell. Here, we will review currently known mechanisms by which cancer cell signaling, including the mitogen-activated protein kinases (MAPK), phosphatidylinositol 3 (PI3)-kinase pathway (PI3K) and wingless (Wnt) pathways but also signals from the tumor microenvironment, modulate the activity or subcellular localization of the Ser/Arg rich (SR) proteins and heterogeneous nuclear ribonucleoproteins (hnRNPs) families of SFs.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    Publication Date: 2018-01-04
    Description: Genes, Vol. 9, Pages 13: Correction: Reinauer et al., The Clinical Course of Patients with Preschool Manifestation of Type 1 Diabetes Is Independent of the HLA DR-DQ Genotype. Genes 2017, 8, 146 Genes doi: 10.3390/genes9010013 Authors: Christina Reinauer Joachim Rosenbauer Christina Bächle Christian Herder Michael Roden Sian Ellard Elisa De Franco Beate Karges Reinhard Holl Jürgen Enczmann Thomas Meissner The article entitled “The Clinical Course of Patients with Preschool Manifestation of Type 1 Diabetes is Independent of the HLA DR-DQ Genotype” contained a calculation error in Table 2 and the statistical methods used were not completely described.[...]
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    Publication Date: 2017-09-16
    Description: Genes, Vol. 8, Pages 228: Isoform Sequencing Provides a More Comprehensive View of the Panax ginseng Transcriptome Genes doi: 10.3390/genes8090228 Authors: Ick-Hyun Jo Jinsu Lee Chi Hong Dong Lee Wonsil Bae Sin-Gi Park Yong Ahn Young Kim Jang Kim Jung Lee Dong Hyun Sung-Keun Rhee Chang Hong Kyong Bang Hojin Ryu Korean ginseng (Panax ginseng C.A. Meyer) has been widely used for medicinal purposes and contains potent plant secondary metabolites, including ginsenosides. To obtain transcriptomic data that offers a more comprehensive view of functional genomics in P. ginseng, we generated genome-wide transcriptome data from four different P. ginseng tissues using PacBio isoform sequencing (Iso-Seq) technology. A total of 135,317 assembled transcripts were generated with an average length of 3.2 kb and high assembly completeness. Of those unigenes, 67.5% were predicted to be complete full-length (FL) open reading frames (ORFs) and exhibited a high gene annotation rate. Furthermore, we successfully identified unique full-length genes involved in triterpenoid saponin synthesis and plant hormonal signaling pathways, including auxin and cytokinin. Studies on the functional genomics of P. ginseng seedlings have confirmed the rapid upregulation of negative feed-back loops by auxin and cytokinin signaling cues. The conserved evolutionary mechanisms in the auxin and cytokinin canonical signaling pathways of P. ginseng are more complex than those in Arabidopsis thaliana. Our analysis also revealed a more detailed view of transcriptome-wide alternative isoforms for 88 genes. Finally, transposable elements (TEs) were also identified, suggesting transcriptional activity of TEs in P. ginseng. In conclusion, our results suggest that long-read, full-length or partial-unigene data with high-quality assemblies are invaluable resources as transcriptomic references in P. ginseng and can be used for comparative analyses in closely related medicinal plants.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    Publication Date: 2017-09-19
    Description: Genes, Vol. 8, Pages 226: Salt-Stress Response Mechanisms Using de Novo Transcriptome Sequencing of Salt-Tolerant and Sensitive Corchorus spp. Genotypes Genes doi: 10.3390/genes8090226 Authors: Zemao Yang Ruike Lu Zhigang Dai An Yan Qing Tang Chaohua Cheng Ying Xu Wenting Yang Jianguang Su High salinity is a major environmental stressor for crops. To understand the regulatory mechanisms underlying salt tolerance, we conducted a comparative transcriptome analysis between salt-tolerant and salt-sensitive jute (Corchorus spp.) genotypes in leaf and root tissues under salt stress and control conditions. In total, 68,961 unigenes were identified. Additionally, 11,100 unigenes (including 385 transcription factors (TFs)) exhibited significant differential expression in salt-tolerant or salt-sensitive genotypes. Numerous common and unique differentially expressed unigenes (DEGs) between the two genotypes were discovered. Fewer DEGs were observed in salt-tolerant jute genotypes whether in root or leaf tissues. These DEGs were involved in various pathways, such as ABA signaling, amino acid metabolism, etc. Among the enriched pathways, plant hormone signal transduction (ko04075) and cysteine/methionine metabolism (ko00270) were the most notable. Eight common DEGs across both tissues and genotypes with similar expression profiles were part of the PYL-ABA-PP2C (pyrabactin resistant-like/regulatory components of ABA receptors-abscisic acid-protein phosphatase 2C). The methionine metabolism pathway was only enriched in salt-tolerant jute root tissue. Twenty-three DEGs were involved in methionine metabolism. Overall, numerous common and unique salt-stress response DEGs and pathways between salt-tolerant and salt-sensitive jute have been discovered, which will provide valuable information regarding salt-stress response mechanisms and help improve salt-resistance molecular breeding in jute.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-09-19
    Description: Genes, Vol. 8, Pages 230: Satellite DNA: An Evolving Topic Genes doi: 10.3390/genes8090230 Authors: Manuel Garrido-Ramos Satellite DNA represents one of the most fascinating parts of the repetitive fraction of the eukaryotic genome. Since the discovery of highly repetitive tandem DNA in the 1960s, a lot of literature has extensively covered various topics related to the structure, organization, function, and evolution of such sequences. Today, with the advent of genomic tools, the study of satellite DNA has regained a great interest. Thus, Next-Generation Sequencing (NGS), together with high-throughput in silico analysis of the information contained in NGS reads, has revolutionized the analysis of the repetitive fraction of the eukaryotic genomes. The whole of the historical and current approaches to the topic gives us a broad view of the function and evolution of satellite DNA and its role in chromosomal evolution. Currently, we have extensive information on the molecular, chromosomal, biological, and population factors that affect the evolutionary fate of satellite DNA, knowledge that gives rise to a series of hypotheses that get on well with each other about the origin, spreading, and evolution of satellite DNA. In this paper, I review these hypotheses from a methodological, conceptual, and historical perspective and frame them in the context of chromosomal organization and evolution.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    Publication Date: 2017-09-21
    Description: Genes, Vol. 8, Pages 236: Zebrafish in Translational Cancer Research: Insight into Leukemia, Melanoma, Glioma and Endocrine Tumor Biology Genes doi: 10.3390/genes8090236 Authors: Aurora Idilli Francesca Precazzini Maria Mione Viviana Anelli Over the past 15 years, zebrafish have emerged as a powerful tool for studying human cancers. Transgenic techniques have been employed to model different types of tumors, including leukemia, melanoma, glioblastoma and endocrine tumors. These models present histopathological and molecular conservation with their human cancer counterparts and have been fundamental for understanding mechanisms of tumor initiation and progression. Moreover, xenotransplantation of human cancer cells in embryos or adult zebrafish offers the advantage of studying the behavior of human cancer cells in a live organism. Chemical-genetic screens using zebrafish embryos have uncovered novel druggable pathways and new therapeutic strategies, some of which are now tested in clinical trials. In this review, we will report on recent advances in using zebrafish as a model in cancer studies—with specific focus on four cancer types—where zebrafish has contributed to novel discoveries or approaches to novel therapies.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    Publication Date: 2017-09-22
    Description: Genes, Vol. 8, Pages 237: Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin Genes doi: 10.3390/genes8100237 Authors: Mayra Eduardoff Catarina Xavier Christina Strobl Andrea Casas-Vargas Walther Parson The analysis of mitochondrial DNA (mtDNA) has proven useful in forensic genetics and ancient DNA (aDNA) studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR) is commonly sequenced using established Sanger-type Sequencing (STS) protocols involving fragment sizes down to approximately 150 base pairs (bp). Recent developments include Massively Parallel Sequencing (MPS) of (multiplex) PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC) methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less), and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples), and tested challenging forensic samples (n = 2) as well as compromised solid tissue samples (n = 15) up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS method for final implementation in forensic genetic laboratories.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    Publication Date: 2017-09-22
    Description: Genes, Vol. 8, Pages 238: Development of Genome-Wide SSR Markers from Angelica gigas Nakai Using Next Generation Sequencing Genes doi: 10.3390/genes8100238 Authors: Jinsu Gil Yurry Um Serim Kim Ok Kim Sung Koo Chinreddy Reddy Seong-Cheol Kim Chang Hong Sin-Gi Park Ho Kim Dong Lee Byung-Hoon Jeong Jong-Wook Chung Yi Lee Angelica gigas Nakai is an important medicinal herb, widely utilized in Asian countries especially in Korea, Japan, and China. Although it is a vital medicinal herb, the lack of sequencing data and efficient molecular markers has limited the application of a genetic approach for horticultural improvements. Simple sequence repeats (SSRs) are universally accepted molecular markers for population structure study. In this study, we found over 130,000 SSRs, ranging from di- to deca-nucleotide motifs, using the genome sequence of Manchu variety (MV) of A. gigas, derived from next generation sequencing (NGS). From the putative SSR regions identified, a total of 16,496 primer sets were successfully designed. Among them, we selected 848 SSR markers that showed polymorphism from in silico analysis and contained tri- to hexa-nucleotide motifs. We tested 36 SSR primer sets for polymorphism in 16 A. gigas accessions. The average polymorphism information content (PIC) was 0.69; the average observed heterozygosity (HO) values, and the expected heterozygosity (HE) values were 0.53 and 0.73, respectively. These newly developed SSR markers would be useful tools for molecular genetics, genotype identification, genetic mapping, molecular breeding, and studying species relationships of the Angelica genus.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    Publication Date: 2017-09-27
    Description: Genes, Vol. 8, Pages 241: Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus Genes doi: 10.3390/genes8100241 Authors: Lin Zhu Jian Zhu Zhixue Liu Zhengyi Wang Cheng Zhou Hong Wang Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae-derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1. Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    Publication Date: 2017-09-29
    Description: Genes, Vol. 8, Pages 245: BARHL1 Is Downregulated in Alzheimer’s Disease and May Regulate Cognitive Functions through ESR1 and Multiple Pathways Genes doi: 10.3390/genes8100245 Authors: Debmalya Barh María García-Solano Sandeep Tiwari Antaripa Bhattacharya Neha Jain Daniel Torres-Moreno Belén Ferri Artur Silva Vasco Azevedo Preetam Ghosh Kenneth Blum Pablo Conesa-Zamora George Perry The Transcription factor BarH like homeobox 1 (BARHL1) is overexpressed in medulloblastoma and plays a role in neurogenesis. However, much about the BARHL1 regulatory networks and their functions in neurodegenerative and neoplastic disorders is not yet known. In this study, using a tissue microarray (TMA), we report for the first time that BARHL1 is downregulated in hormone-negative breast cancers and Alzheimer’s disease (AD). Furthermore, using an integrative bioinformatics approach and mining knockout mouse data, we show that: (i) BARHL1 and Estrogen Receptor 1 (ESR1) may constitute a network that regulates Neurotrophin 3 (NTF3)- and Brain Derived Neurotrophic Factor (BDNF)-mediated neurogenesis and neural survival; (ii) this is probably linked to AD pathways affecting aberrant post-translational modifications including SUMOylation and ubiquitination; (iii) the BARHL1-ESR1 network possibly regulates β-amyloid metabolism and memory; and (iv) hsa-mir-18a, having common key targets in the BARHL1-ESR1 network and AD pathway, may modulate neuron death, reduce β-amyloid processing and might also be involved in hearing and cognitive decline associated with AD. We have also hypothesized why estrogen replacement therapy improves AD condition. In addition, we have provided a feasible new mechanism to explain the abnormal function of mossy fibers and cerebellar granule cells related to memory and cognitive decline in AD apart from the Tau and amyloid pathogenesis through our BARHL1-ESR1 axis.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    facet.materialart.
    Unknown
    Molecular Diversity Preservation International (MDPI)
    In: Genes
    Publication Date: 2017-10-01
    Description: Genes, Vol. 8, Pages 250: Effects of Antidiabetic Drugs on Gut Microbiota Composition Genes doi: 10.3390/genes8100250 Authors: Sophie Montandon François Jornayvaz Gut microbiota forms a catalog of about 1000 bacterial species; which mainly belong to the Firmicutes and Bacteroidetes phyla. Microbial genes are essential for key metabolic processes; such as the biosynthesis of short-chain fatty acids (SCFA); amino acids; bile acids or vitamins. It is becoming clear that gut microbiota is playing a prevalent role in pathologies such as metabolic syndrome; type 2 diabetes (T2D); inflammatory and bowel diseases. Obesity and related diseases; notably type 2 diabetes, induce gut dysbiosis. In this review; we aim to cover the current knowledge about the effects of antidiabetic drugs on gut microbiota diversity and composition as well as the potential beneficial effects mediated by specific taxa. Metformin is the first-line treatment against T2D. In addition to its glucose-lowering and insulin sensitizing effects, metformin promotes SCFA-producing and mucin-degrading bacteria. Other antidiabetic drugs discussed in this review show positive effects on dysbiosis; but without any consensus specifically regarding the Firmicutes to Bacteroidetes ratio. Thus, beneficial effects might be mediated by specific taxa.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    Publication Date: 2017-10-03
    Description: Genes, Vol. 8, Pages 252: Network‐Based Method for Identifying Co‐ Regeneration Genes in Bone, Dentin, Nerve and Vessel Tissues Genes doi: 10.3390/genes8100252 Authors: Lei Chen Hongying Pan Yu‐Hang Zhang Kaiyan Feng XiangYin Kong Tao Huang Yu‐Dong Cai Bone and dental diseases are serious public health problems. Most current clinical treatments for these diseases can produce side effects. Regeneration is a promising therapy for bone and dental diseases, yielding natural tissue recovery with few side effects. Because soft tissues inside the bone and dentin are densely populated with nerves and vessels, the study of bone and dentin regeneration should also consider the co‐regeneration of nerves and vessels. In this study, a network‐based method to identify co‐regeneration genes for bone, dentin, nerve and vessel was constructed based on an extensive network of protein–protein interactions. Three procedures were applied in the network‐based method. The first procedure, searching, sought the shortest paths connecting regeneration genes of one tissue type with regeneration genes of other tissues, thereby extracting possible co‐regeneration genes. The second procedure, testing, employed a permutation test to evaluate whether possible genes were false discoveries; these genes were excluded by the testing procedure. The last procedure, screening, employed two rules, the betweenness ratio rule and interaction score rule, to select the most essential genes. A total of seventeen genes were inferred by the method, which were deemed to contribute to co‐regeneration of at least two tissues. All these seventeen genes were extensively discussed to validate the utility of the method.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    Publication Date: 2017-10-04
    Description: Genes, Vol. 8, Pages 253: Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene Genes doi: 10.3390/genes8100253 Authors: Ana Gonçalves Jorge Oliveira Teresa Coelho Ricardo Taipa Manuel Melo-Pires Mário Sousa Rosário Santos A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD.
    Electronic ISSN: 2073-4425
    Topics: Biology
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    Publication Date: 2017-10-04
    Description: Genes, Vol. 8, Pages 255: De Novo Assembly and Analysis of Tartary Buckwheat (Fagopyrum tataricum Garetn.) Transcriptome Discloses Key Regulators Involved in Salt-Stress Response Genes doi: 10.3390/genes8100255 Authors: Qi Wu Xue Bai Wei Zhao Dabing Xiang Yan Wan Jun Yan Liang Zou Gang Zhao Soil salinization has been a tremendous obstacle for agriculture production. The regulatory networks underlying salinity adaption in model plants have been extensively explored. However, limited understanding of the salt response mechanisms has hindered the planting and production in Fagopyrum tataricum, an economic and health-beneficial plant mainly distributing in southwest China. In this study, we performed physiological analysis and found that salt stress of 200 mM NaCl solution significantly affected the relative water content (RWC), electrolyte leakage (EL), malondialdehyde (MDA) content, peroxidase (POD) and superoxide dismutase (SOD) activities in tartary buckwheat seedlings. Further, we conducted transcriptome comparison between control and salt treatment to identify potential regulatory components involved in F. tataricum salt responses. A total of 53.15 million clean reads from control and salt-treated libraries were produced via an Illumina sequencing approach