Co-culturing Hyphomicrobium nitrativorans strain NL23 and Methylophaga nitratireducenticrescens strain JAM1 allows sustainable denitrifying activities under marine conditions

Determination of NO₃⁻, NO₂⁻ and biomass

NO₃⁻ and NO₂⁻ were measured either by ionic chromatography as described by Mauffrey et al. (2017) or by colorimetry based on the method described by Schnetger & Lehners (2014) (File S1). In the colorimetric method, NO₃⁻ was reduced to NO₂⁻ with vanadium (III) chloride (VCl₃). NO₂⁻ concentrations were then measured with the Griess reagents. In parallel, NO₂⁻ concentrations already present in the medium were measured separately with the Griess reagents. The concentrations were determined with standard solutions. Linear response ranged from 0.1 to 2 mg-N/L (either with NO₃⁻ or NO₂⁻). Results from the NO₃⁻ reduction to NO₂⁻ by VCl₃ generated the NO_x concentrations (NO₃⁻ + NO₂⁻). NO₃⁻ concentrations were then calculated as NO_x –NO₂⁻.

The measurement of the protein content was carried out to determine the amount of biomass in our cultures or biofilm. One mL of suspended cultures was centrifuged at 16,000 g 1 min. The pellet was vortexed in 0.1 M NaOH, incubated 30 min at 70 °C, vortexed again and incubated another 30 min at 70 °C. For the biofilm, one to five supports were added and vortexed in three mL of 0.1M NaOH, and incubated as described before. The protein concentration in the biomass extracts was determined by the Quick StartTM Bradford Protein Assay (BioRad, Mississauga, ON, Canada) with bovine albumin serum as standard.

The denitrification rate was defined as the reduction rate of the NO_x, assuming that NO and N₂O were readily reduced (no or very low transient accumulation) as shown by Mauffrey et al. (2017) and Martineau, Mauffrey & Villemur (2015). The growth rates, the NO₃⁻ reduction rates and the denitrification rates were calculated by regression of the linear portion (the R² coefficients of determination in most cases > 0.9) of the culture growth (OD_600nm), of the NO₃⁻ concentrations and of the NO_x concentrations, respectively, over time for each replicate (OD h⁻¹; NO₃⁻ mM h⁻¹, NO_x mM h⁻¹). The specific NO₃⁻ reduction rates and the specific denitrification rates were reported as the NO₃⁻ reduction rates and the denitrification rates divided by the quantity of biomass (mg protein or OD_600nm), respectively, in a vial or in the reactor.

Culture media

The Instant Ocean (IO) seawater medium was bought from Aquarium systems (Mentor, OH, USA) and dissolved at 30 g/L. NaNO₃ was added at 21.4 mM (final concentration). The medium was adjusted at pH 7.5 and autoclaved. One ml per liter of autoclaved trace metal solution (per liter: 0.9 g FeSO₄.7H₂O, 0.03 g CuSO₄.5H₂O, 0.234 g MnCl₂.4H₂O and 0.363 g Na₂MoO₄.2H₂O) was added. Three mL of 0.2 µm-filtered methanol were added per liter of medium.

Planktonic pure cultures of H. nitrativorans strain NL23^T (ATCC BAA-2476) were performed in the 337a medium (per liter: 1.3 g KH₂PO₄, 1.13 g Na₂HPO₄, 0.5 g (NH₄)₂SO₄, 0.2 g MgSO₄.7H₂O). NaNO₃, if needed, was added at 21.4 mM (final concentration). The medium was adjusted at pH 7.5 and autoclaved. These 0.2 µm-filtered solutions were added per liter: five mL trace element solution (per liter: 309 mg CaCl₂.2H₂O, 200 mg FeSO₄.7H₂O, 100 mg Na₂MoO₄.2H₂O, 67 mg MnSO₄.H₂O), three mL methanol and one mL vitamin B₁₂ (0.1 mg/mL).

Planktonic pure cultures of M. nitratireducenticrescens strain JAM1^T (ATCC BAA 2433) were performed in the Methylophaga 1403 medium (per liter: 24 g NaCl, 3 g MgCl₂. 6H₂O, 2 g MgSO₄.7H₂O, 0.5 g KCl, 1 g CaCl₂, 0.5 g Bis-tris, and NaNO₃ with final concentrations ranging from 0 to 21.4 mM). The medium was autoclaved, and these 0.2 µm-filtered solutions were added per liter: three mL methanol, 20 mL solution T (per 100 mL: 0.7 g KH₂PO₄, 10 g NH₄Cl, 10 g Bis-tris, 0.3 g citrate ferric ammonium, pH 8.0), one mL vitamin B₁₂ (0.1 mg/mL), 10 ml Wolf solution [per liter: 0.5 g EDTA, 3.0 g MgSO₄.7H₂O, 0.5 g MnSO₄.H₂O, 1.0 g NaCl, 0.1 g FeSO₄.7H₂O, 0.1 g Co(NO₃)₂.6H₂O, 0.1 g CaCl₂ (anhydrous), 0.1 g ZnSO₄.7H₂O, 0.010 g CuSO₄.5H₂O, 0.010 g AlK(SO₄)₂ (anhydrous), 0.010 g H₃BO₃, 0.010 g Na₂MoO₄.2H₂O, 0.001 g Na₂SeO₃ (anhydrous), 0.010 g Na₂WO₄.2H₂O, and 0.020 g NiCl₂.6H₂O, pH 8.0]. For some assays, the NaCl concentration was adjusted in this medium as needed (from 0% to 2.75%). For solid media, bacteriological agar (1.5% final concentration; Alpha Biosciences, Baltimore MD USA) was added before sterilization.

Planktonic pure cultures and co-cultures

A loop of frozen stock of strain JAM1 (Villeneuve et al., 2013) and strain NL23 (Martineau et al., 2013b) was spread onto Methylophaga 1403 or 337a agar plates supplemented with methanol and incubated for 2–7 days. The pre-cultures were derived by taking one to three colonies to inoculate the corresponding culture medium (Methylophaga 1403 and 337a) that were then incubated for 1 to 7 days under oxic conditions without NO₃⁻ (unless specified) and incubated at 30 °C at 150 rpm. The cells were then centrifuged and dispersed in the medium before use. For anoxic cultures, the sterile media were distributed (60 mL) in sterile serologic vials. The vials were purged of O₂ for 10 min with N₂ (Praxair, Mississauga, ON, Canada) and sealed with sterile septum caps. The planktonic co-cultures (anoxic conditions, Methylophaga 1403 medium) were inoculated with pre-cultures of strain JAM1 and of strain NL23 with a JAM1/NL23 ratio of 1:10 and a final cell dispersion of 0.1 OD_600nm. Cultures were incubated for 1–7 days at 30 °C. The medium was shaken before each sampling to disperse the biomass. No biofilm was apparent in the vial border.

Biofilm co-cultures in fed-batch reactor

The reactor is illustrated in Fig. S1 and the reactor operating procedures is described in the File S2. It consisted of an airtight 500-mL working volume. A flow cell consisting of a 50-mL tube was added in the recirculating circuit where two microscope slides were added to monitor cell attachment on the surface. The system was carefully washed with water and ethanol. Two hundred and sixty acid-washed Bioflow nine mm supports were added in the reactor, and filled with the proper autoclaved medium (Table 1). Throughout all the different operating conditions, the medium was recirculated with a peristaltic pump at 30 mL/min, and the reactor was run at room temperature (ca. 22 °C). To avoid high pressure building in the reactor because of the N₂ generated by the denitrifying conditions, a gas trap was added to the reactor with tubing connected to a graduated cylinder filled with water. Gas production was recorded by water displacement in the graduated cylinder (Fig. S1). Monitoring gas production during the whole operating processing allowed a quick evaluation of the performance of the reactor. Samples of the suspended biomass (one mL) were taken at sampling ports and centrifuged; the supernatant was used to determine the NO₃⁻ and NO₂⁻ concentrations. The pellets of some of these samples were kept for DNA or protein (or both) extractions. From the DNA extracts, the concentrations of strain JAM1 and strain NL23 in the suspended biomass were determined by qPCR.

The same reactor vessel was used to carry out three reactors sequentially. Reactors 1 and 2 were inoculated with strain JAM1 and strain NL23 (biofilm co-cultures). Reactor 3 was inoculated with only strain NL23 (biofilm mono-culture). Results from reactor 1 allowed to adjust the conditions for reactor 2.

To initiate reactors 1 and 2 (co-cultures), inocula of strain NL23 (four 60 mL-vials) and strain JAM1 (three 60 mL-vials) were centrifuged (ca. 3 g wet weight, each), dispersed in 20 mL 0.5% NaCl Methylophaga 1403 medium, and added to the reactor filled with 500 mL of the same medium. To avoid strain JAM1 to outcompete strain NL23 for NO₃⁻, NO₃⁻was not added in the medium and the reactors were operated under the oxic conditions by injecting ambient air sterilely for 3 days with a peristaltic pump connected at the bottom of the reactor, after which air was no longer supplied and NO₃⁻ was added to create denitrifying conditions. For reactor 3, the inoculum of strain NL23 was added in the reactor with 0% NaCl Methylophaga 1403 medium, and the reactor was operated with no oxic cycle (no air bubbling) with NO₃⁻. The reactors were then run for a week, with additions of NO₃⁻ when needed, after which the medium was replaced by a fresh one. Only bacteria attached to supports and vessel were kept in the reactor; the planktonic bacteria were discarded. Upon NO₃⁻ and NO₂⁻ reductions, the medium was changed with fresh one. Medium was changed 30 times in reactor 1 during the 19 weeks of operating times, 57 times in reactor 2 over 17 weeks, and 27 times in reactor 3 over 8 weeks (File S2). In all cases, the media (Table 1) were not purged of O₂ with N₂ and were added in the reactor in open air. Rapid O₂ consumption by the bacterial cells provided conditions for denitrifying activities to occur. Indications that such conditions were met were by the reductions of NO₃⁻ and NO₂⁻ and substantial amount of gas production. When these production and reductions appeared stable (few days to weeks), the medium was replaced with a fresh one and the reactor was sampled at regular intervals for at least 24 h to measure the concentration of NO₃⁻ and NO₂⁻. Afterwards, one to two supports were collected, frozen at −20 °C until use for the extractions of proteins, DNA and ectoine. In some of the operating conditions (Table 1), supports were collected for RNA extractions (reactors 2 and 3). To do so, fresh medium was added in the reactor. When NO₃⁻ was near completely consumed, 10 supports were collected in a glove box flushed with N₂ and frozen immediately in liquid N₂, and kept at −70 °C until use to extract total RNA. In all cases, the taken supports were replaced with new ones in the reactor. After these steps, we proceeded with new medium (increasing concentration of methanol/NO₃⁻ or NaCl) as described in Table 1. When the different operating runs for reactor 1 were finished, all the colonized supports were frozen at −20 °C for further analysis. The vessel was then washed thoroughly and sterilized. New supports were added to start reactor 2. The same was done with reactor 3.

Ectoine

The protocol was based on Chen et al. (2015) and Zhang, Lang & Nagata (2009). The biofilm on one support was directly extracted with 2 mL of methanol/chloroform/water (10:5:4) with intermittent strong agitation for 3 h. The extract was then centrifuged at 16,000 g for 10 min. One mL of the supernatant was extracted with one mL chloroform/water (1:1) with agitation for 30 min. The extract was then centrifuged at 16,000 g for 10 min. The water phase was collected and dried at 35 °C with N₂ for 30 min. The extract was then dissolved in one mL water and filtered on 0.2 µm filter. The stable isotopically labelled internal standard 5,6,7,8-tetradeutero-4-hydroxy-2-heptylquinoline (HHQ-d₄) was added in the samples (2.66 µg/mL final concentration). HHQ-d₄ was provided by the laboratory of Eric Déziel (INRS, Laval, QC, Canada). Ectoine ((S)-2-methyl-1,4,5,6-tetrahydropyrimidine-4-carboxylic acid, 97% purity) was bought at Sigma Aldrich (Oakville, ON, Canada), and used to derive a standard curve.

Fifteen-µL of the samples were analysed by a HPLC-coupled to a mass spectrometer (Waters, Milford, MA, USA). The Waters 2795 HPLC system was equipped with a Kinetex (100 x 4.6 mm) 2.6-µm C8 reverse-phase LC column (Phenomenex, Torrance, CA, USA). The mobile phase was a gradient of 1% acetic acid in water (solvent A) and 1% acetic acid in acetonitrile (solvent B) programmed as follows: initial 2% solvent B (0–4 min), 2–70% solvent B (4–5 min), 100% solvent B (5–8 min), then hold 3 min and followed by 3 min of re-equilibration. HPLC flow rate was 400 µL/min split to 40 µL/min by a Valco tee splitter. The Quattro Premier XE mass spectrometer was equipped with a Z-spray interface using electro-spray ionization in positive mode (ESI-MS/MS). Multiple Reaction Monitoring (MRM) mode was used to quantify ectoine. MassLynx and QuanLynx software (Ver. 4.1) were used. The capillary voltage was set at 3.0 kV and the cone voltage at 30 V. The source temperature was kept at 120 °C. N₂ was used as nebulising and drying gas at flow rates of 15 and 100 mL/min, respectively. In MRM mode, the following transitions were monitored: for ectoine 143 →98 and for the internal standard HHQ-d₄ 248 →163. The pressure of the collision gas (argon) was set at 2 × 10⁻³ mTorr and the collision energy at 30 V for all transitions. The area of each chromatographic peak was integrated and the ectoine/HHQ-D₄ response ratio was used to create the calibration curve (R² = 0.9945) and to quantify the concentration of ectoine in the samples.

Fluorescence in situ hybridization (FISH)

The biofilm that colonized the microscope slides in the flow cell chamber was fixed with 4% cold paraformaldehyde in PBS for 60 min, and washed twice with water. The biofilm was dehydrated for 3 min successively in 50%, 80% and 95% ethanol/water, and then air dried. Hybridization buffer for both probes consisted of 20% formamide, 20 mM Tris-HCl pH 8.0, 0.01% SDS and 0.9 M NaCl. The probe concentrations used were between 10 to 20 ng/µL. Hybridization was carried out in an Omnislide in situ thermal cycler (Thermo Electron Corporation, Waltham, Mass., USA) for 3 h at 46 °C, followed by 2 min at 48 °C. Slides were washed 20 min at 48 °C, in 20 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.01% SDS and 210 mM NaCl. FISH samples were mounted with Prolong Gold agent containing DAPI (Molecular Probes, Fisherscientific, Ottawa, ON Canada). The probes for Methylophaga spp. (MPH-730-Atto488; 5′CAGTAATGGCCCAGTGAGTCGCC 3′) (Janvier, Regnault & Grimont, 2003) and for Hyphomicrobium spp. (Hypho-Cy3; 5′TCCGTACCGATAGGAAGATT 3′) (Juretschko et al., 2002) were synthesized by Biomers.net (Ulm, Germany) and AlphaDNA (Montreal, QC, Canada), respectively. Slides were examined on an epifluorescence Leica DM3000 microscope.

DNA and RNA extraction, qPCR and RT-qPCR, and RNA sequencing

DNA and RNA extractions of the planktonic biomass and of the biofilm from 1 to 4 supports were performed as described (Villemur et al., 2019; Mauffrey et al., 2017; Mauffrey, Martineau & Villemur, 2015). Concentrations of strain JAM1 and strain NL23 were performed by qPCR with primers targeting narG1 and napA, respectively, as described by Geoffroy et al. (2018) (Table 2). Standard curves were performed with PCR-amplified DNA fragments of narG1 and napA from strain JAM1 genome and strain NL23 genome, respectively (Table 2).

RT-qPCR were performed as described by Mauffrey et al. (2017) with primers targeting narG1 and narG2 for strain JAM1, napA and nirK for strain NL23, and the reference genes rpoB and dnaG specific for each strain (Table 2). The standard curves were performed with dilutions of the respective genomic DNA.

The RNA samples were sequenced at the Centre d’expertise et de services Génome Québec Montreal QC, (Canada) (Sequencing type: Illumina NovaSeq 6000 S4 PE100 - 25M reads; Library Type: rRNA-depleted for bacteria). The sequencing data were uploaded to the Galaxy web platform, and we used the public server at usegalaxy.org to analyze the data (Afgan et al., 2018). Raw reads were filtered to remove low quality reads using FASTX toolkit by discarding any reads with more than 10% nucleotides with a PHRED score <20. The resulting reads were aligned to the genome of M. nitratireducenticrescens strain JAM1 (GenBank accession number CP003390.3) and to the genome of H. nitrativorans strain NL23 (CP006912.1) using Bowtie2 with default parameters. BEDtools were used to assign the number of reads to the respective genes in the genome, which were then normalized as transcripts per million (TPM). Because the samples were from one reactor run, statistical analysis could not have been performed. However, an arbitrary variation of 10% in the read values revealed that the ratio of TPM of a gene from one condition to another of >2 or <0.5 is significantly different.

Growth and NO₃⁻ affinity

We compared the growth pattern of M. nitratireducenticrescens strain JAM1 and H. nitrativorans strain NL23 cultured under anoxic conditions. Strain NL23 cultures showed a 48 to 72-h lag before growth occurred, whereas strain JAM1 cultures presented no such lag (Fig. 1A). Strain NL23 anoxic cultures reached higher level of biomass than strain JAM1 anoxic cultures. We then measured the NO₃⁻ affinity by both strains, which can be an important factor of competition between them for growth. Planktonic anoxic pure cultures of strain JAM1 and strain NL23 were performed with different concentrations of NO₃⁻ to derive their respective maximum growth rates (µmax) and half-saturation constants of NO₃⁻ concentration for growth (Table 3). The µmax of strain JAM1 cultures were 68% higher than those of strain NL23 cultures (Fig. 1B, Table 3). Strain NL23 cultures showed some growth inhibition at 107 mM NO₃⁻ (Fig. 1B). To assess the affinity of these strains toward NO₃⁻ for growth, the µmax/Ks ratio was calculated (Healey, 1980) (Table 3). This ratio in strain JAM1 cultures was twice higher than that of strain NL23 cultures. The NO₃⁻ reduction rates in the strain NL23 cultures increased linearly with the increase of NO₃⁻ concentrations (from 2 to 40 mM) in the medium (Fig. 1C). These rates reached a plateau at 24 mM NO₃⁻ in strain JAM1 cultures, and showed no significant changes at higher concentrations. The specific NO₃⁻ reduction rates (rates normalized by the biomass) were however, relatively constant for both strains whatever the NO₃⁻ concentrations (Fig. 1D). These specific rates were six times higher (p < 0.001) in strain JAM1 cultures (average 4.48 ± 0.96 NO₃⁻ h⁻¹ OD⁻¹) than in strain NL23 cultures (average 0.77 ± 0.32 NO₃⁻ h⁻¹ OD⁻¹). All these results suggest that strain JAM1 cells process NO₃⁻ (uptake and reduction) at a higher rate than strain NL23.

Anoxic planktonic co-cultures

Co-cultures were first attempted under planktonic conditions to assess the effect on the denitrifying activities of culturing both strains together. Initially, we wanted to perform planktonic co-cultures under marine conditions as both strains originated from a marine denitrification system. However, strain NL23 planktonic growth is impaired when the culture medium is >1% NaCl (Martineau, Mauffrey & Villemur, 2015), impeding planktonic co-cultures under marine conditions. We found that the Methylophaga culture medium (Methylophaga 1403) with 0.5% NaCl instead of 2.4% can sustain both strains with minimal growth defect. This medium was used to perform our anoxic planktonic co-culture assays. Higher levels of strain NL23 in the inoculum (JAM1/NL23 ratio of 1:10) had to be used because of the higher affinity of strain JAM1 towards NO₃⁻ as shown above. In the first co-culture attempts, both inocula were derived from oxic pre-cultures. Anoxic planktonic mono-cultures of both strains were performed in parallel also in this medium as control. Our results showed that the co-cultures could not reduce NO₂⁻ (Fig. 2A). The NO₃⁻ reduction rates were similar between the co-cultures (0.68 ± 0.01 mM-NO₃⁻ h⁻¹) and strain JAM1 mono-cultures (0.82 ± 0.02 mM-NO₃⁻ h⁻¹), and NO₂⁻ accumulated in the medium (Figs. 2A, 2C). The proportion of strain NL23 at the end of the co-cultures was 1.6% (Fig. 2B).

Other planktonic co-cultures were performed by inoculating strain NL23 that was derived this time from pre-cultures cultured under anoxic conditions to stimulate its denitrification pathway. These co-cultures were capable of denitrification (Fig. 2D). The NO₃⁻ reduction rates were similar between the co-cultures (1.17 ±0.05 mM-NO₃⁻ h⁻¹) and strain JAM1 mono-cultures (1.00 ± 0.03 mM-NO₃⁻ h⁻¹) (Figs. 2D, 2F). NO₂⁻ accumulated transiently after NO₃⁻ reduction in the co-cultures and then was completely consumed after 36 h (Fig. 2D). The denitrification rates of the co-cultures were twice higher (t-test, p = 0.0038) (0.91 ± 0.03 mM-NO_x h⁻¹) than those in strain NL23 mono-cultures (0.43 ± 0.02 mM-NO_x h⁻¹). The proportion of strain NL23 was about 12 times higher in these co-cultures than that in the first co-culture assays (19.7% vs 1.6%; Fig. 2E). The total concentrations of both strains in these co-cultures (18.8 ± 2.4 × 10⁸ gene copies/mL) were three times higher than those in the first co-culture assays (6.1 ± 1.2 × 10⁸ gene copies/mL), suggesting better growth for both strains.

Biofilm co-cultures

As mentioned before, planktonic co-cultures could not be performed under marine conditions without impairing strain NL23 growth. As strain JAM1 and strain NL23 were isolated from a biofilm, developing a biofilm co-culture provided a mean to assess the adaptability of strain NL23 to marine conditions. Two reactors with Bioflow nine mm supports and containing the Methylophaga 1403 medium at 0.5% NaCl were inoculated with both strains, and operated under fed-batch mode and denitrifying conditions. The reactors were run for several weeks, with several medium changes where the planktonic cells were discarded, for the biofilm to build up and the denitrifying activities to establish. The biofilm was then acclimated with increasing concentrations of NaCl (Table 1; File S2). Finally, the Methylophaga 1403 medium was replaced with the commercial Instant Ocean (IO) marine medium to mimic the original bioprocess. A third reactor was operated under the same conditions, this time with only strain NL23. The three reactors were run sequentially. Results from reactor 1 allowed us to adjust the conditions for reactor 2.

In reactor 1, the NO₃⁻ reduction rates and the denitrification rates (represented by the NO_x reduction rates) ranged both between 1.6 and 5.1 mM h⁻¹ (average 2.9 mM h⁻¹) when operating with the Methylophaga 1403 medium at 0.5%, 1% and 2% NaCl (Table 4). At 2.75% NaCl, these two rates were lower (1.4 mM h⁻¹) with a transient NO₂⁻ accumulation that peaked at 14 mM after 8 h (Table 4), suggesting a decrease in the denitrification performance. When the reactor was run with the IO medium, a 48-fold decrease occurred in the denitrification rates with accumulation of NO₂⁻ and a very low rate of its reduction afterwards (File S4). The gas production was absent reflecting low denitrifying activities. We suspected that the absence of the supplements (Wolf solution, solution T, and B₁₂ vitamin) that were present in the Methylophaga 1403 medium could have caused this defect. After 12 days following re-addition of these supplements, the activities were partially restored (Table 4).

In reactor 2, the NO₃⁻ reduction rates were higher than those measured in reactor 1 when operating with the Methylophaga medium at 0.5%, 1% and 2% NaCl (Table 4), and ranged between 2.6 and 5.3 mM h⁻¹ (average 3.5 mM h⁻¹). These higher NO₃⁻ reduction rates could have had an impact on the reactor performance by generating transient NO₂⁻ accumulation that peaked between 7 to 13 mM after 2 to 4 h under these three conditions. Consequently of these transient accumulations, the denitrification rates in reactor 2 was lower than those in reactor 1 with values ranging between 0.9 and 1.3 mM h⁻¹ (average 1.1 mM h⁻¹). One reason of such differences between the two reactors is the higher proportion of strain NL23 in reactor 1, which ranged between 6.1 to 21.4% in these three conditions, compared to reactor 2 where these proportions ranged between 1.8 to 5.9% (Table 5). A higher proportion of the JAM1 strain would reduce NO₃⁻ faster and therefore generate NO₂⁻ faster than what strain NL23 could reduce at the same time. When reactor 2 was operated at 2.75% NaCl, the NO₃⁻ reduction rate and the denitrification rate increased by 36% and 101% respectively, in contrast to a 3.6-fold decrease of these rates in reactor 1 operating under the same conditions. A 5-fold decrease in proportion of strain NL23 (from 12.3% to 2.3%) in reactor 1 could explain these decreases, whereas this proportion stayed at similar level in reactor 2 (1.8% and 1.3%; Table 5). To avoid the detrimental effects observed in reactor 1, reactor 2 was run with the IO medium containing the supplements. The gas production, the NO₃⁻ reduction and denitrification rates, and the transient NO₂⁻ accumulation were similar than those observed in the other operating conditions (Table 4). Also, the proportions of strain NL23 in the suspended biomass were at similar levels (1.2 and 3.0%) than those measured in the previous operating conditions. In reactor 1, the proportion of strain NL23 was below 1% when operated with the IO medium (Table 5).

During the first four operating conditions, reactor 2 showed increases from 4.1 to 8.9 mM h⁻¹ mg protein⁻¹ in the specific denitrification rates (Table 4). No protein measurements were performed in reactor 1, except at the end of the running operations. When reactor 2 was operated with the IO medium, the specific denitrification rate decreased by 4.5 times. Once again, to avoid detrimental effect on the denitrifying activities, the supplements were removed one by one (except for trace metal elements) by operating the reactor for a few days between each removal. In all cases, complete denitrification occurred in less than 24 h, and gas production was constant throughout the operating conditions (Table 4).

In reactor 3 (run with only strain NL23), the NO₃ ⁻ reduction rate and the denitrification rate were at 5.1 mM h⁻¹ when operating with the Methylophaga 1403 medium at 0% NaCl. These rates dropped by 50% when operating at 0.5% and 1% (2.7 mM h⁻¹; Table 4). At 2.0% NaCl, the NO₃⁻ reduction rate was still at 2.7 mM h⁻¹, but NO₂⁻ accumulated and peaked at 13 mM after 8 h from which it was slowly reduced (File S4). Consequently, the denitrification rate was 5 times lower during this operating conditions compared to the previous conditions (2.7 to 0.53 mM h⁻¹; Table 4). At 2.75% NaCl, the NO₃⁻ reduction rate was at similar level than the previous operating conditions, at 3.2 mM h⁻¹ (Table 4). NO₂⁻ was still accumulated up to 16 mM after 6 h, but showed very low rate of reduction, where 11 mM NO₂⁻ was still present after 96 h (File S4). The denitrification rate was further down at 0.11 mM h⁻¹. The reactor also showed low gas production. When the reactor was run with the IO medium, it showed the same behavior of the previous operating conditions with the denitrification rate at 0.11 mM h⁻¹ as well as low gas production.

The levels of both strains were also determined in the biofilm of reactor 2 (Table 5). The proportions of strain NL23 were 3–4 times higher in the biofilm (4.3 to 10.9%) than in the suspended biomass, suggesting better environment for strain NL23 to grow. In reactor 3, with the increase of NaCl concentrations in the medium, the concentrations of strain NL23 decreased in both the suspended biomass and the biofilm (Table 5).

An indication of the level of specific denitrifying activities in the reactors was to divide the denitrification rates (mM-NO_x h⁻¹; Table 4) by the estimated total number of cells (strain NL23 and strain JAM1) in the reactor (suspended biomass and biofilm) as determined by qPCR (Table 5). These specific denitrification rates, translated per billion of cells (or gene copies), were at similar levels in reactor 2 during the different operating phases (Table 5). In reactor 3, the denitrification rates per billion cells were between 12 to 25 times higher than in reactor 2. It was at its lowest with medium at 2.0% NaCl, suggesting decreases in denitrification efficiency by strain NL23 cells.

Ectoine in the biofilm co-culture

We measured the level of the osmoprotectant ectoine in the biofilm of reactor 2 (Table 4). Increasing amount of ectoine was noticed with the increase of NaCl concentration in the reactor.

Biofilm structure

The colonization of surface by both strains was followed in the reactor with a flow chamber that was connected to the reactor and containing microscope slides (Fig. S1). Figures 3A and 3B showed uniform dispersed clusters of cells throughout the surface after one to five days of colonization. FISH assays showed that strain NL23 was lower in concentration than strain JAM1 in the biofilm (Figs. 3C and 3D), which concurs with the qPCR results. No specific pattern of distribution of both strains was noticed in the biofilm.

Gene expression of denitrification genes in biofilm co-culture and mono-culture

The impact of the operating conditions in the reactors on the expression of denitrification genes of key reductases were assessed by measuring in the biofilm the levels of transcripts by RT-qPCR of both nar genes (narG1 and narG2) for strain JAM1, and napA and nirK for strain NL23. The transcript levels of narG1 did not change in the biofilm co-culture of reactor 2 operated at 0.5% and 2.75% NaCl, and with the IO medium (Table 6). For narG2, the transcript levels in the biofilm co-culture raised by about 2–3 times when the operating conditions in reactor 2 increased in NaCl concentration from 0.5% to 2.75% or when the medium was changed for the IO medium (Table 6).

The napA transcript levels in the biofilm co-culture of reactor 2 had an 11-fold decrease when the operating conditions changed from 0.5% NaCl to 2.75% NaCl, or a 17-fold decrease when the medium was changed for the IO medium (Table 6). The napA transcript levels were similar in the biofilm mono-culture of reactor 3 operated with 0.5% and 2.0% NaCl. Finally, the nirK transcript levels showed no significant difference between the different operating conditions in reactors 2 and 3, except in reactor 2 operated with the IO medium with a 6-fold decrease compared to reactor 2 operated with 0.5% NaCl (Table 6).

The transcriptomic analysis

The impact of the operating conditions in gene expression of the pathways of denitrification and nitrogen assimilation were assessed by deriving the transcriptome of biofilm samples taken from reactors 2 and 3 operated under different conditions (Fig. 4). Except for napGH, no substantial changes were found in the relative transcript levels of the denitrification genes between the three operating conditions in reactor 2 (0.5% and 2.75% NaCl and IO) for both strains, and in the two operating conditions in reactor 3 (0.5% and 2.0% NaCl) for strain NL23 (Figs. 4A and 4B). Compared to reactor 2 operated with 0.5% NaCl, the relative transcript levels of napGH showed 3- to 4-fold increases in reactor 2 operated with 2.75% NaCl and with the IO medium, and a 9.3-fold increase in reactor 3 operated with 2% NaCl (Fig. 4B).

The type of medium (Methylophaga 1403 medium and IO medium) had a great impact on the N-assimilation pathways in both strains. Higher relative transcript levels were observed in both strains in reactors 2 and 3 (up to 105-fold increase in strain NL23) that were running with the IO medium for genes encoding ammonium transporters, and genes involved in the NO₃⁻ transformation in ammonium (Fig. 4C).

Finally, strain JAM1 showed 4- to-5-fold increases in the relative transcript levels of genes involved in ectoine synthesis in reactor 2 operated with 2.75% NaCl and with the IO medium, compared to the level found in the reactor 2 operated with 0.5% NaCl (Fig. 4A).