Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Article
  • Published:

Eco-evolutionary interaction between microbiome presence and rapid biofilm evolution determines plant host fitness

Nature Ecology & Evolution volume 5, pages 670–676 (2021)Cite this article

Subjects

Abstract

Microbiomes are important to the survival and reproduction of their hosts. Although ecological and evolutionary processes can happen simultaneously in microbiomes, little is known about how microbiome eco-evolutionary dynamics determine host fitness. Here we show, using experimental evolution, that fitness of the aquatic plant Lemna minor is modified by interactions between the microbiome and the evolution of one member, Pseudomonas fluorescens. Microbiome presence promotes P. fluorescens’ rapid evolution to form biofilm, which reciprocally alters the microbiome’s species composition. These eco-evolutionary dynamics modify the host’s multigenerational fitness. The microbiome and non-evolving P. fluorescens together promote host fitness, whereas the microbiome with P. fluorescens that evolves biofilm reduces the beneficial impact on host fitness. Additional experiments suggest that the microbial effect on host fitness may occur through changes in microbiome production of auxin, a plant growth hormone. Our study, therefore, experimentally demonstrates the importance of the eco-evolutionary dynamics in microbiomes for host–microbiome interactions.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Fig. 1: The effect of microbiome presence on the biofilm evolution and abundance of P. fluorescens populations.
Fig. 2: The dissimilarity between microbiome communities tested by MANOVA and visualized by non-metric multidimensional scaling with axes NMDS1 versus NMDS2.
Fig. 3: The interactive effects of microbiome presence and P. fluorescens presence and evolution on L. minor fitness.
Fig. 4: Auxin production as a possible determinant for changes in L. minor fitness.
Fig. 5: Schematic summarizing the results of our study.

Similar content being viewed by others

Data availability

The data supporting the finding of this study are available on Figshare (https://doi.org/10.6084/m9.figshare.13644161). Source data are provided with this paper.

References

  1. Slobodkin, L. B. Growth and regulation of animal populations (Holt, Rinehart and Winston, 1961).

  2. Thompson, J. N. Rapid evolution as an ecological process. Trends Ecol. Evol. 13, 329–332 (1998).

    Article  CAS  PubMed  Google Scholar 

  3. Hendry, A. P. A critique for eco-evolutionary dynamics. Funct. Ecol. 33, 84–94 (2019).

    Article  Google Scholar 

  4. Turcotte, M. M., Reznick, D. N. & Hare, J. D. The impact of rapid evolution on population dynamics in the wild: experimental test of eco-evolutionary dynamics. Ecol. Lett. 14, 1084–1092 (2011).

    Article  PubMed  Google Scholar 

  5. Hairston, N. G. Jr, Ellner, S. P., Geber, M. A., Yoshida, T. & Fox, J. A. Rapid evolution and the convergence of ecological and evolutionary time. Ecol. Lett. 8, 1114–1127 (2005).

    Article  Google Scholar 

  6. Tan, J., Rattray, J. B., Yang, X. & Jiang, L. Spatial storage effect promotes biodiversity during adaptive radiation. Proc. R. Soc. Lond. B 284, 20170841 (2017).

    Google Scholar 

  7. Hart, S. P., Turcotte, M. M. & Levine, J. M. Effects of rapid evolution on species coexistence. Proc. Natl Acad. Sci. USA 116, 2112–2117 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Faillace, C. A. & Morin, P. J. Evolution alters the consequences of invasions in experimental communities. Nat. Ecol. Evol. 1, 0013 (2017).

    Article  Google Scholar 

  9. Vanbergen, A. J., Espíndola, A. & Aizen, M. A. Risks to pollinators and pollination from invasive alien species. Nat. Ecol. Evol. 2, 16–25 (2018).

    Article  PubMed  Google Scholar 

  10. Hendry, A. P. Eco-evolutionary dynamics (Princeton Univ. Press, 2016).

  11. Garud, N. R., Good, B. H., Hallatschek, O. & Pollard, K. S. Evolutionary dynamics of bacteria in the gut microbiome within and across hosts. PLoS Biol. 17, e3000102 (2019).

    Article  PubMed  PubMed Central  Google Scholar 

  12. Zhao, S. et al. Adaptive evolution within gut microbiomes of healthy people. Cell Host Microbe 25, 656–667 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. terHorst, C. P. & Zee, P. C. Eco-evolutionary dynamics in plant–soil feedbacks. Funct. Ecol. 30, 1062–1072 (2016).

    Article  Google Scholar 

  14. Soto, M. J., Domínguez‐Ferreras, A., Pérez‐Mendoza, D., Sanjuán, J. & Olivares, J. Mutualism versus pathogenesis: the give‐and‐take in plant–bacteria interactions. Cell. Microbiol. 11, 381–388 (2009).

    Article  CAS  PubMed  Google Scholar 

  15. Marchetti, M. et al. Experimental evolution of a plant pathogen into a legume symbiont. PLoS Biol. 8, e1000280 (2010).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  16. Saikkonen, K., Wäli, P., Helander, M. & Faeth, S. H. Evolution of endophyte–plant symbioses. Trends Plant Sci. 9, 275–280 (2004).

    Article  CAS  PubMed  Google Scholar 

  17. Reese, A. T. & Dunn, R. R. Drivers of microbiome biodiversity: a review of general rules, feces, and ignorance. mBio 9, e01294-18 (2018).

    Article  PubMed  PubMed Central  Google Scholar 

  18. Miller, E. T., Svanbäck, R. & Bohannan, B. J. Microbiomes as metacommunities: understanding host-associated microbes through metacommunity ecology. Trends Ecol. Evol. 33, 926–935 (2018).

    Article  PubMed  Google Scholar 

  19. Griffin, E. A. et al. Plant host identity and soil macronutrients explain little variation in sapling endophyte community composition: is disturbance an alternative explanation? J. Ecol. 107, 1876–1889 (2019).

    Article  CAS  Google Scholar 

  20. Acosta, K. et al. Duckweed hosts a taxonomically similar bacterial assemblage as the terrestrial leaf microbiome. PLoS ONE 15, e0228560 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Sandler, G., Bartkowska, M., Agrawal, A. F. & Wright, S. I. Estimation of the SNP mutation rate in two vegetatively propagating species of duckweed. G3 10, 4191–4200 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Ishizawa, H., Kuroda, M., Morikawa, M. & Ike, M. Evaluation of environmental bacterial communities as a factor affecting the growth of duckweed Lemna minor. Biotechnol. Biofuels 10, 62 (2017).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  23. Zhang, Y. et al. Duckweed (Lemna minor) as a model plant system for the study of human microbial pathogenesis. PLoS ONE 5, e13527 (2010).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  24. Rainey, P. B. & Travisano, M. Adaptive radiation in a heterogeneous environment. Nature 394, 69–72 (1998).

    Article  CAS  PubMed  Google Scholar 

  25. Tan, J., Yang, X., He, Q., Hua, X. & Jiang, L. Earlier parasite arrival reduces the repeatability of host adaptive radiation. ISME J. 14, 2358–2360 (2020).

    Article  PubMed  PubMed Central  Google Scholar 

  26. Tan, J., Yang, X. & Jiang, L. Species ecological similarity modulates the importance of colonization history for adaptive radiation. Evolution 71, 1719–1727 (2017).

    Article  PubMed  Google Scholar 

  27. Meyer, J. R., Schoustra, S. E., Lachapelle, J. & Kassen, R. Overshooting dynamics in a model adaptive radiation. Proc. R. Soc. Lond. B 278, 392–398 (2011).

    Google Scholar 

  28. Tan, J., Kelly, C. K. & Jiang, L. Temporal niche promotes biodiversity during adaptive radiation. Nat. Commun. 4, 2102 (2013).

    Article  PubMed  CAS  Google Scholar 

  29. Spiers, A. J., Buckling, A. & Rainey, P. B. The causes of Pseudomonas diversity. Microbiology 146, 2345–2350 (2000).

    Article  CAS  PubMed  Google Scholar 

  30. Spiers, A. J., Bohannon, J., Gehrig, S. M. & Rainey, P. B. Biofilm formation at the air–liquid interface by the Pseudomonas fluorescens SBW25 wrinkly spreader requires an acetylated form of cellulose. Mol. Microbiol. 50, 15–27 (2003).

    Article  CAS  PubMed  Google Scholar 

  31. Bantinaki, E. et al. Adaptive divergence in experimental populations of Pseudomonas fluorescens. III. Mutational origins of wrinkly spreader diversity. Genetics 176, 441–453 (2007).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. McDonald, M. J., Gehrig, S. M., Meintjes, P. L., Zhang, X.-X. & Rainey, P. B. Adaptive divergence in experimental populations of Pseudomonas fluorescens. IV. Genetic constraints guide evolutionary trajectories in a parallel adaptive radiation. GENETICS 183, 1041–1053 (2009).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Bailey, S. F., Dettman, J. R., Rainey, P. B. & Kassen, R. Competition both drives and impedes diversification in a model adaptive radiation. Proc. R. Soc. Lond. B 280, 20131253 (2013).

    Google Scholar 

  34. Hansen, S. K., Rainey, P. B., Haagensen, J. A. & Molin, S. Evolution of species interactions in a biofilm community. Nature 445, 533–536 (2007).

    Article  CAS  PubMed  Google Scholar 

  35. Flemming, H.-C. et al. Biofilms: an emergent form of bacterial life. Nat. Rev. Microbiol. 14, 563–575 (2016).

    Article  CAS  PubMed  Google Scholar 

  36. Ahmad, F., Ahmad, I. & Khan, M. S. Screening of free-living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiol. Res. 163, 173–181 (2008).

    Article  CAS  PubMed  Google Scholar 

  37. El-Sayed, W. S., Akhkha, A., El-Naggar, M. Y. & Elbadry, M. In vitro antagonistic activity, plant growth promoting traits and phylogenetic affiliation of rhizobacteria associated with wild plants grown in arid soil. Front. Microbiol. 5, 651 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  38. Gómez, P. & Buckling, A. Real-time microbial adaptive diversification in soil. Ecol. Lett. 16, 650–655 (2013).

    Article  PubMed  Google Scholar 

  39. Spor, A., Koren, O. & Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat. Rev. Microbiol. 9, 279–290 (2011).

    Article  CAS  PubMed  Google Scholar 

  40. Walters, W. A. et al. Large-scale replicated field study of maize rhizosphere identifies heritable microbes. Proc. Natl Acad. Sci. USA 115, 7368–7373 (2018).

    Article  PubMed  PubMed Central  Google Scholar 

  41. Veach, A. M. et al. Rhizosphere microbiomes diverge among Populus trichocarpa plant-host genotypes and chemotypes, but it depends on soil origin. Microbiome 7, 76 (2019).

    Article  PubMed  PubMed Central  Google Scholar 

  42. Lennon, J. T. & Martiny, J. B. Rapid evolution buffers ecosystem impacts of viruses in a microbial food web. Ecol. Lett. 11, 1178–1188 (2008).

    Article  PubMed  Google Scholar 

  43. Pantel, J. H., Duvivier, C. & Meester, L. D. Rapid local adaptation mediates zooplankton community assembly in experimental mesocosms. Ecol. Lett. 18, 992–1000 (2015).

    Article  PubMed  Google Scholar 

  44. Faillace, C. A. & Morin, P. J. Evolution alters post-invasion temporal dynamics in experimental communities. J. Anim. Ecol. 89, 285–298 (2020).

    Article  PubMed  Google Scholar 

  45. Omilian, A. R., Cristescu, M. E. A., Dudycha, J. L. & Lynch, M. Ameiotic recombination in asexual lineages of Daphnia. Proc. Natl Acad. Sci. USA 103, 18638–18643 (2006).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  46. Mao, Y., Botella, J. R., Liu, Y. & Zhu, J.-K. Gene editing in plants: progress and challenges. Natl Sci. Rev. 6, 421–437 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of Bacteria and Archaea. Science 327, 167–170 (2010).

    Article  CAS  PubMed  Google Scholar 

  48. Yang, L. et al. Promotion of plant growth and in situ degradation of phenol by an engineered Pseudomonas fluorescens strain in different contaminated environments. Soil Biol. Biochem. 43, 915–922 (2011).

    Article  CAS  Google Scholar 

  49. Zabłocka-Godlewska, E., Przystaś, W. & Grabińska-Sota, E. Decolourization of diazo Evans blue by two strains of Pseudomonas fluorescens isolated from different wastewater treatment plants. Water Air Soil Pollut. 223, 5259–5266 (2012).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  50. Paulsen, I. T. et al. Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5. Nat. Biotechnol. 23, 873–878 (2005).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Rainey, P. B. Adaptation of Pseudomonas fluorescens to the plant rhizosphere. Environ. Microbiol. 1, 243–257 (1999).

    Article  CAS  PubMed  Google Scholar 

  52. Gilbert, S. et al. Bacterial production of indole related compounds reveals their role in association between duckweeds and endophytes. Front. Chem. 6, 265 (2018).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  53. Bailey, M. J., Lilley, A. K., Thompson, I. P., Rainey, P. B. & Ellis, R. J. Site directed chromosomal marking of a fluorescent pseudomonad isolated from the phytosphere of sugar beet; stability and potential for marker gene transfer. Mol. Ecol. 4, 755–764 (1995).

    Article  CAS  PubMed  Google Scholar 

  54. Spiers, A. J. & Rainey, P. B. The Pseudomonas fluorescens SBW25 wrinkly spreader biofilm requires attachment factor, cellulose fibre and LPS interactions to maintain strength and integrity. Microbiology 151, 2829–2839 (2005).

    Article  CAS  PubMed  Google Scholar 

  55. Lind, P. A., Libby, E., Herzog, J. & Rainey, P. B. Predicting mutational routes to new adaptive phenotypes. eLife 8, e38822 (2019).

    Article  PubMed  PubMed Central  Google Scholar 

  56. O’Brien, P. A., Webster, N. S., Miller, D. J. & Bourne, D. G. Host–microbe coevolution: applying evidence from model systems to complex marine invertebrate holobionts. mBio 10, e02241-18 (2019).

    Article  PubMed  PubMed Central  Google Scholar 

  57. Theis, K. R. et al. Getting the hologenome concept right: an eco-evolutionary framework for hosts and their microbiomes. mSystems 1, e00028-16 (2016).

    Article  PubMed  PubMed Central  Google Scholar 

  58. Landolt, E. Biosystematic Investigations in the Family of Duckweeds (Lemnaceae), Volume 2. The Family of Lemnaceae, A Monographic Study, Volume 1 (Geobotanical Institute, ETH Zurich, 1986).

  59. Ziegler, P., Sree, K. S. & Appenroth, K.-J. Duckweeds for water remediation and toxicity testing. Toxicol. Environ. Chem. 98, 1127–1154 (2016).

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank P. Rainey for providing us with the two P. fluorescens strains and J. Armstrong, D. Conover and A. Morris for collecting and genotyping L. minor. We thank J. Everett, L. Leak, S. Subramanian, E. Elliott and R. Dabundo for assistance with the experiment and K. Kohl, L. Rzodkiewicz, E. Gluck-Thaler, N. Wei and C. Wood for comments that improved the manuscript. This project is supported by a British Ecological Society Research Grant (LRB17/1023).

Author information

Authors and Affiliations

  1. Department of Biological Sciences, University of Pittsburgh, Pittsburgh, PA, USA

    Jiaqi Tan, Julia E. Kerstetter & Martin M. Turcotte

  2. Department of Biological Sciences, Louisiana State University, Baton Rouge, LA, USA

    Jiaqi Tan

Authors
  1. Jiaqi Tan
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Julia E. Kerstetter
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Martin M. Turcotte
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

J.T. and M.M.T. conceived the idea and designed the study. J.T. and J.E.K. performed the experiments. J.T., J.E.K. and M.M.T. analysed the data and wrote the manuscript.

Corresponding author

Correspondence to Jiaqi Tan.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Nature Ecology & Evolution thanks the anonymous reviewers for their contribution to the peer review of this work.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 Results of the mutual invasion experiments between the various P. fluorescens lineages.

The goal of these experiments is to test whether the ancestral free-living SBW25 (smooth morph, SM) is ecologically similar to the isogenic PBR716 (SM) with the three operon knock-outs. We also quantified the ecological differences between wrinkly spreader (WS) and SM of SBW25 for comparison. Between SM of PBR716 and SM of SBW25, we first quantified their growth in monoculture (rmono) in aqueous microcosms. We set the initial abundance at ~106 CFU (0.01x of carrying capacity). We quantified bacterial abundance after 24 h of growth and calculated rmono as ln (abundance). We quantified their invading growth (rinvading) in a culture of the other strain that had been already growing to high abundance for 24 h. The growth of the invading strain was calculated based on its final abundance after 24 h static incubation. Please note that SBW25 strain we used carried a neutral lacZ marker while PBR716 did not. Therefore, we distinguished the SM of the two strains based on their colony color on with X-gal (SBW25, blue; PBR716, white). All treatments were replicated four times. We quantified the competitive response (S) of one strain to the other as 1- rinvading/rmono. S close to 1 indicates stronger interaction and potentially higher ecological similarity between two strains, while that close to 0 indicates weaker interaction and lower ecological similarity. We showed that higher competitive responses between SM of PBR716 and SM of SBW25 than those between SM and WS of SBW25. Values are means (± 1 s.e.; n = 4). Treatments sharing the same letter are not statistically different.

Source data

Extended Data Fig. 2 The abundance of the microbiome species subject to three P. fluorescens treatments (No Pf, non-evolving PBR716, and evolving SBW25).

The microbiome contained Bacillus pumilus (BP), Agrobacterium tumefaciens (AT), Sphingomonas elodea (SE), Rhizobium rosettiformans (RR), Chryseobacterium hispalense (CH), Duganella radices (DR), Variovorax paradoxus (VP), and Flavobacterium buctense (FB) (n for each species = 12). Bacillus aryabhattai was isolated from L. minor epiphyte, but appeared only in the medium, and was therefore not shown here. Boxes show medians and interquartile ranges with whiskers for 10th and 90th percentiles. Stars indicate that the abundance of A. tumefaciens and R. rosettiformans was significantly influenced by P. fluorescens presence or evolution.

Source data

Extended Data Fig. 3 The abundance of L. minor in each L. minor genotype treatment.

Boxes show medians and interquartile ranges with whiskers for 10th and 90th percentiles (n = 4). Treatments sharing the same letter are not statistically different (P > 0.05). Pf stands for Pseudomonas fluorescens. L. minor was genotyped with two microsatellite primers R5C (F: TGATGCCAGTAGATCCGGC R: ACGCCTGAACACGATTGATG) and R15B (F: GTGACAGCGTATCCTTGTGC R: TCAGCGGCAAGATCATCAAG).

Source data

Extended Data Fig. 4 The concentration of available phosphorus.

Values are means (± 1 s.e.; n = 3). Pf stands for Pseudomonas fluorescens. Treatments sharing the same letter are not statistically different (P > 0.05).

Source data

Extended Data Fig. 5 The correlation between auxin production and L. minor fitness.

After the main experiment ended, we plated the culture from each microcosm on agar plates to quantify the abundance of bacterial species/genotypes. We isolated each present species/genotype and re-assembled the microbiome in a new microcosm with L. minor. The microbiome was incubated for a week to allow them to propagate and equilibrate. Then, we added them into a new microcosm without L. minor to quantify auxin concentration after 24 h. The average level of auxin production of the six experimental treatments (microbiome presence/absence × P. fluorescens treatments) were calculated and presented in Fig. 4. Here, we plot the number of L. minor individuals of each treatment (data collected from the main eperiment, y-axis data, ln-transformed before the analysis) against auxin production (x-axis; N = 72). We implemented both a linear (y=a – bx) and asymptotic (y=a – [a – b] exp [–cx]) model in R. The asymptotic model had a lower AIC value (asymptotic 529.410, linear 557.702; P values for both models is smaller than 0.001) and thus better predict the relationship between auxin production and L. minor fitness.

Source data

Supplementary information

Source data

Source Data Fig. 1

Source data for wrinkly spreader proportion and P. fluorescens abundance.

Source Data Fig. 2

Source data for NMDS.

Source Data Fig. 3

Source data for L. minor fitness.

Source Data Fig. 4

Source data for microbiome-auxin-production assay and auxin-addition experiment.

Source Data Extended Data Fig. 1

Source data for SBW25 and PBR716 competitive responses.

Source Data Extended Data Fig. 2

Source data for bacterial abundance.

Source Data Extended Data Fig. 3

Source data for the fitness of the three L. minor genotypes.

Source Data Extended Data Fig. 4

Source data for phosphorus concentration.

Source Data Extended Data Fig. 5

Source data for the auxin–L. minor fitness correlation.

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Tan, J., Kerstetter, J.E. & Turcotte, M.M. Eco-evolutionary interaction between microbiome presence and rapid biofilm evolution determines plant host fitness. Nat Ecol Evol 5, 670–676 (2021). https://doi.org/10.1038/s41559-021-01406-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/s41559-021-01406-2

This article is cited by

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing