ALBERT

Description: BACKGROUND: The biological basis for the adverse prognosis of chr1q gain/amplification (1q+) present in ~30% of patients with multiple myeloma (MM) remains ill-defined. The transcription factor (TF) Pre-B-cell leukaemia homeobox 1 (PBX1), encoded on chr1q, acts as master regulator of early hematopoiesis and as an oncogene in leukemia and other malignancies. Herein, we hypothesized that PBX1 orchestrates proliferative regulatory networks that underpin the poor prognosis associated with 1q+ in MM. METHODS: We employed qPCR for mRNA quantification, western blotting and immunohistochemistry for protein analysis, lentiviral shRNA-mediated knock-down, Hoechst/Annexin V staining and flow-cytometry for apoptosis and cell cycle analysis, ChIPseq for cistrome and RNAseq after knock-down for transcriptome analysis. Additional data were obtained from MMRF/CoMMpass, Blueprint Consortium and Arkansas datasets. Computational analysis of clinical and "-omics" data was performed using standard bioinformatic work-flows; pathway enrichment analysis using EnrichR and GSEA. RESULTS: Combined genomic (WGS/WES) and transcriptomic (RNAseq) analysis of the CoMMpass dataset identified a subgroup of 1q+ MM patients (60%) characterized by aberrant PBX1 overexpression and amplification (PBX1amp); survival analysis revealed significantly worse outcome of this subgroup compared to 1q+ non-PBX1amp (p

Description: Overexpression of the transcription factor MAF, as a result of its juxtaposition to the IgH enhancer [MAF-translocated t(14;16)], is a myeloma-initiating event in 3-5% of patients with multiple myeloma (MM) and confers a poor prognosis. MAF is also overexpressed in another 40% of cases, often in co-operation with the oncogene MMSET. The mechanisms by which MAF overexpression impacts on the regulatory genome to generate the MAF-driven oncogenic transcriptome and its direct targets are not known. To address this, we employed a multi-layer -omics approach using primary myeloma plasma cells (PC) as well as myeloma cell lines (MMCL). First, we determined the chromatin accessibility and transcriptome profiles of MAF-translocated myeloma by performing ATAC-seq and RNA-seq, respectively, in purified bone marrow CD138+ PC from two patients with t(14;16) and three healthy donors. We identified 6,640 differentially accessible regions, 87% of which displayed enhanced chromatin accessibility in MAF samples compared to normal PC. Secondary analysis comparing this with ATAC-seq data from a set of 28 other MM samples, including hyperdiploid, MMSET and CCND1-translocated MM, revealed 33% of those regions to be MAF subgroup specific (1,949 regions), with the rest shared between MAF and other cytogenetic groups. Gene annotation and pathway enrichment analysis using GREAT confirmed overrepresentation of the MF myeloma patient signature, as previously identified in microarray datasets. RNA-seq detected significant upregulation of approximately 900 genes in MAF samples compared to normal counterparts, including MAF itself (top 4th hit) as well as its presumed targets (CCND2, ITGB7 and NUAK1). Next, we obtained the MAF cistrome using ChIP-seq in the MAF-translocated MMCL MM1.S and integrated it with the primary PC ATAC-seq data. This revealed that 31% (618/1,949) of the differentially accessible regions in MAF-translocated MM PC are also MAF-bound. Additional overlay with ENCODE ChromHMM epigenome map showed that 47% of MAF binding sites are on active enhancers and 42% on active promoters signifying potential direct regulation of the corresponding genes. Next, we superimposed the accessible and MAF-bound loci on the epigenomic landscapes of normal PC and other B-cell types using their corresponding ChromHMM maps (Blueprint consortium data). Interestingly, 56% (345/618) of the MAF-specific regions were not active in any stage of B cell development. This suggests that aberrant MAF overexpression and chromatin binding in PC is associated with de novo activation of these chromatin regions, over half of which (200/345; 58%) are enhancers; we termed these 'neo-enhancers'. Upon de novo motif analysis of MAF ChIP-seq in MAF-translocated JJN3 and MM1.S MMCL, we confirmed MAF as the first and, interestingly, IRF4 as the second top hit, suggesting a possible MAF-IRF4 functional interaction in myelomagenesis. Indeed, overlay of the accessible MAF-bound loci with IRF4 ChIP-seq data in MM1.S revealed 63% co-occupancy (including 62% of "neo-enhancers"), proposing a novel and extensive co-operative chromatin-based network between the two transcription factors. Final integration of the accessible MAF-bound regions with the paired transcriptomes of primary myeloma PC revealed a set 206 candidate enhancer-gene pairs. Strikingly, we identified two IRF4-cobound "neo-enhancers" linked to overexpression of TLR4 and CCR1, two genes known for their roles in myeloma cell proliferation and migration. We confirmed significant downregulation of both genes upon shRNA-mediated knockdown of MAF in the two MAF-translocated MMCL, MM1.S and JJN3, as well as the lethality of MAF depletion. Further, MAF overexpression in MAF-negative myeloma backgrounds led to transcriptional upregulation of these genes, further validating them as MAF targets. While CRISPR/Cas9i experiments targeting TLR4 are ongoing, preliminary results validated the functional role of the "neo-enhancer" in CCR1 gene expression. In conclusion, we demonstrate for the first time an extensive re-organisation of the PC chromatin conferred by oncogenic MAF in MM; we reveal its extensive co-operation with IRF4 in this process; we validate the directly MAF-regulated genes and functionally characterise neo-enhancers of key MAF-dependent genes that in addition to MAF itself are also critical for myeloma biology. Disclosures Hatjiharissi: Janssen: Honoraria. Caputo:GSK: Research Funding. Karadimitris:GSK: Research Funding.

Description: Background: Carfilzomib (CFZ) is FDA approved at 27 mg/m2 D1,2,8,9,15,16 (except 20 mg/m2 D1,2, of cycle 1) to be given over 10 minutes with an overall response rate (ORR) of 23.7% (Siegel 2012). When CFZ is given as a 30 minute infusion, the dose can be safely escalated to 56 mg/m2, presumably due to a lower Cmax, on a twice weekly schedule with a higher ORR of 55% (Papadopoulos 2014). Our hypothesis was that the disease response of patients who progressed on CFZ 27 mg/m2 could recaptured by dose escalation to 56 mg/m2. Methods: Inclusion criteria were progressive disease (PD) at time of study entry, refractory to CFZ 27 mg/m2 without any Grade 3/4 toxicities, 〉 2 lines of therapy (including bortezomib and an IMID), measurable disease, adequate heme parameters (ANC 〉 1.0, plt 〉 50k), and organ function (Cr Cl 〉 15, cardiac ejection fraction (EF) 〉 40%). CFZ was given at 56 mg/m2 Day 1,2,8,9,15,16 over 30 minutes with dexamethasone (dex) 8 mg and ondansetron 8mg premedication. EF was monitored every 2 cycles. Results: 13 patients received study treatment. The median age was 64.5 (50% greater than age 65 yo) with 4.5 median lines of treatment over 4 years from MM diagnosis. 5 (38%) were high molecular with risk gain of 1q21 by FISH and 3 with concurrent deletion of p53. Also 67, 58, 67, and 100% were refractory to each of the following respectively: lenalidomide, pomalidomide (pom), bortezomib, & CFZ. Prior to study entry, the median duration of time on CFZ 27 mg/m2 before PD was 136 days. All but 1 patient had been receiving dex 40 mg weekly and 3 had been receiving triplet therapy - 2 with concomitant pom and 1 with ibrutiinib (on a clinical trial). Of the 12 patients evaluable for efficacy, responses include 1 VGPR, 4 PRs, & 6 SDs, for an ORR of 42% and a median DOR of 6.5 mos. The median PFS was 3.5 mos. Interestingly, 2 of the 3 patients who progressed on CFZ based triplet regimens prior to study entry achieved a PR with CFZ dose escalation. Grade 3/4 toxicities (regardless of drug attribution) were primarily heme, with neutropenia (36%), thrombocytopenia (8%) and anemia (22%) respectively. Grade 3/4 nonheme AEs included 4 hypertension (HTN), 1 acute dyspnea, 1 ggt elevation, 1 back pain and 1 leg pain. When ggt was added on to screening labs for the patient with grade 4 ggt elevation prompting study discontinuation, it was noted to be elevated to grade 3 even at baseline. Of the 4 patients with Grade 3/4 HTN, 1 required dose CFZ modification but the remaining 3 were classified as grade 3 only due to the addition of an anti-HTN medications and did not require any CFZ dose modifications. HTN in one these 3 patients was also was in the setting of bone pain and PD. In the 4 patients with serial measurements of brain naturetic peptide (BNP), there were no changes. Similarly, EF was monitored on study for all patients and there were no decreases in EF or symptoms of CHF. Conclusions: Consistent with previous data, including from the Endeavor study, CFZ 56 mg/m2 is efficacious and well tolerated with manageable HTN. Even in this heavily pretreated population refractory to CFZ 27 mg/m2 and dex 40 mg weekly refractory and with high molecular risk features, dose escalation of CFZ to 56 mg/m2 with only dex 16 mg weekly was able to recapture disease response at ORR and PFS that have already surpassed the preplanned futility analysis. By avoiding early dose escalation of those that may be at risk for likely idiosyncratic side effects, both safety and lower cost may be maximized. These findings support enrollment to the ongoing SWOG S1304 randomized study comparing CFZ 27 and 56 mg/m2. Disclosures Chari: Array BioPharma: Consultancy, Research Funding; Celgene: Consultancy, Membership on an entity's Board of Directors or advisory committees, Research Funding; Millennium/Takeda: Consultancy, Research Funding; Novartis: Consultancy, Research Funding; Onyx: Consultancy, Research Funding. Osman:Millennium / Takeda: Research Funding. Catamero:Onyx: Other: Lecturer; Millennium/Takeda: Other: Lecturer; Celgene: Honoraria, Other: Lecturer. Verina:Celgene: Other: Lecturer. Jagannath:Novartis: Honoraria; Janssen: Honoraria; Merck: Honoraria; Celgene: Honoraria; Bristol Myers Squibb: Honoraria.

Description: Introduction: Congenital TTP (Thrombotic Thrombocytopenic Purpura) is a rare life-threatening inherited disorder, resulted from mutations in ADAMTS13 gene. Such mutations interfere with ADAMTS13 enzyme production or function, subsequently resulting in microangiopathic hemolytic anemia (MAHA) and microvascular thrombosis. The investigation of congenital TTP is challenging because of its rarity with an estimated prevalence ranging from 0.4 to 16.7 cases per million and about 150 identified mutations. Recently, we identified a cohort of patients with congenital TTP from three consanguineous families of Arab Bedouin origin in southern Israel. All patients have the same, previously unidentified mutation c.3772 delA in the ADAMTS13 gene. In this single center prospective cohort study, we present patients' genetic, clinical and laboratory data and results of the abnormal ADAMTS13 protein Western blot analysis. Methods: Patients with episodes of MAHA and thrombocytopenia were diagnosed with congenital TTP by abnormally low ADAMTS13 activity and absence of inhibitory autoantibodies (Table 1). Subsequently, patients were referred for genetic testing. Patients' DNA served for PCR amplification of the exons of ADAMTS13 (NM_139026) followed by direct sequencing of the PCR products. The mutation was found in exon 28, the primers used for PCR were forward: atgtccctatgtcccacctg and reverse: ctgtccagaatcacagcacaa (annealing temperature 61°C). Western blot analysis of the abnormal ADAMTS13 protein was performed according to the method previously described by Zheng et al, using antihuman ADAMTS13 rabbit polyclonal antibody (ab28274; Abcam, Cambridge, UK). Patients' clinical and laboratory parameters were collected at diagnosis and during follow-up. The study was approved by the institutional research ethics board. Results: We identified a novel mutation on chromosome 9:136323172del A (GRCh37/hg19) in coding exon 28, c.3772 del A (NM_139026), causing p.N1258T fs Ter 15 of ADAMTS13 gene close to the C-terminus of the 1427-amino acid long protein (Fig.1). We validated that all patients in our cohort are homozygous for the mutation. The mutation is found within the CUB1 domain and the frameshift is predicted to result in the loss of the next 169 highly conserved amino acids of the full-length protein that contains the CUB2 domain, normally responsible for cleavage of large VWF multimers under flow conditions. Our Western blot analysis of the abnormal protein (Fig. 2) demonstrates that a 170-190 Kd band is missing in plasma of five patients, compared to four controls. These results suggest that the mutation may interfere with the entire enzyme production. The cohort consists of 17 homozygotic patients (3 males and 14 females), all belong to three closely related families of Arab Bedouin descent with high rate of consanguinity. All 17 patients in this cohort have blood group A. This finding may represent genetic linkage disequilibrium between the ADAMTS13 gene and the transferase gene, both found on chromosome 9 in close proximity. Despite the fact that all the patients are homozygous for the same mutation and belong to three closely related families, their presenting symptoms and disease severity were markedly heterogenous (Table 1): eight of 14 female patients initially presented with complications of pregnancy, two presented with laboratory abnormalities, two presented with stroke and two asymptomatic female patients were recognized on family screening. Of three male patients, one presented with Budd-Chiari syndrome, one had laboratory abnormalities alone and one developed a stroke. Conclusion: To the best of our knowledge, this is one of the largest congenital TTP cohorts described in the literature. This cohort is unique due to the fact that all members carry the same, previously unreported, ADAMTS13 gene mutation in the CUB1 domain of the gene. Our findings support an assumption that environmental and hereditary modifiers may influence disease course. Further research of the involved families may enable us to expand the understanding of the pathophysiology and develop better treatment options for this understudied rare condition. Disclosures No relevant conflicts of interest to declare.

Description: Abstract 2867 Background: Multiple myeloma (MM) is a highly resistant hematological neoplasia that remains an incurable disease. A leading drug in MM treatment is bortezomib, a selective proteasome inhibitor. Current treatment protocols have extended the overall survival of patients with MM, however, ultimately the disease becomes refractory to all forms of treatments and therefore drugs with new mechanisms of action are urgently needed. Experimental and clinical observations suggest that thyroid hormones (T3 and T4) modulate neoplastic cells and activate MAPK pathway through binding to αv β3 integrin, commonly overexpressed in cancer. Tetraiodothyroacetic acid (tetrac), a non-agonist T4 analog, selectively blocks T3 and T4 binding to αv β3 receptor site. MM cells interact with αv β3 for invasion/growth and thyroid diseases were associated with increased MM risk. We recently demonstrated the thyroid hormones- αv β3-MAPK axis in myeloma cells. In the current study we further show that T3 and T4 antagonize bortezomib action via MAPK activation and that in the presence of tetrac bortezomib action is significantly enhanced. Methods: Cell lines: MM cell lines (RPMI-8226, ARK, ARP-1, U266 and CAG) are cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS/antibiotics. Before addition of T3 or T4, cells are grown for 48 hours without serum. Bone marrow (BM) aspirates were obtained from patients with MM treated at the Meir Medical Center. Signed institutional review board–approved written informed consent was obtained from all patients. Primary MM cells were separated on Ficoll gradient and were cultured in RPMI 1640. Reagents and chemicals: T3, T4, tetrac, MAPK inhibitor (U0126), autophagy inhibitor (3MA) and pan caspase inhibitor, Z-VAD. Cells were treated with T3 or T4 (1nM-100nM and 1μM) in the presence/absence of tetrac (100nM and 1μM) and/or bortezomib (25nM) and tested by several methods: Cell number. Cell proliferation assay: WST-1 (10% final concentration) is incubated at 37°C for 2 h and read using microELISA reader at 440nm. Cell cycle: Cells are harvested, fixed and stained with DNA propidium iodide (PI) (50 μg/ml) /RNAse A (10mg/ml) and analyzed for DNA content by FACS. Analysis of apoptosis/necrosis: Cells (105) are incubated with 5 μl Annexin V (FITC conjugated)/5 μl PI and analyzed by FACS. Expression of apoptotic genes (real-time PCR). Results were repeated 2–3 times in triplicates and were analyzed using unpaired students t test. Results and discussion: Results demonstrate that T3 and T4 at near physiological and supra physiological levels, increased myeloma cell viability by 15–50% and cell number by 30%-60%. This increased viability was blocked by U0126, indicating involvement of the MAPK pathway. In parallel a 20–25% reduction in cell death and of pro-apoptotic genes expression was documented following treatment with the hormones. Co-treatment of myeloma cell lines with T3 or T4 reduced bortezomib cytotoxicity and increased cell survival in a MAPK-dependent manner. Pretreatment of MM cell lines and primary cells from MM patients with tetrac, 48 hours before the addition of bortezomib, resulted in a synergistic cytotoxic effect. The effect of tetrac was blocked using a pan-caspase inhibitor (Z-VAD) but not by an autophagy inhibitor (3MA), suggesting apoptosis-related cell death. Conclusions: We present here novel data demonstrating that T3 and T4 may oppose bortezomib action via MAPK activation. Blocking the thyroid hormones- αv β3 axis using tetrac, promotes bortezomib cytotoxicity, suggesting this approach as a promising adjunct therapy in MM. Disclosures: No relevant conflicts of interest to declare.

Description: Abstract 2964 Background: Basic/epidemiological/clinical data has established that thyroid hormones (T3/T4) may modulate neoplastic cells and T3/T4 deprivation removes this stimulus. Recently, growing body of epidemiological and clinical evidence suggests improved survival in individuals with primary/secondary hypothyroidism in a variety of tumor types, e.g., breast, lung, renal, prostate, head and neck, glioblastoma and more. On the other hand, hyperthyroidism was associated with an increased risk of lung and prostate cancers in a large-based population study as well as in pancreatic and ovarian cancers. Finally, enhanced response rates to chemo/radiation therapy in hypothyroidism patients have also been reported in preclinical/clinical studies. Taken together, these observations suggest a role for T3 and T4 in tumor growth and a protective effect of hypothyroidism in various cancer types. T3/T4 affects cell division/angiogenesis by activating MAPK/PI3K pathways through binding integrin αvβ3, an integrin over-expressed on many cancer cells. Thyroid binding site upon the integrin is at close proximity to its well known RGD recognition site and is blocked by tetrac, a natural analog of T4. Interestingly, in multiple myeloma (MM), a highly resistant hematological malignancy, the tumor cells interact with αvβ3 for their invasion/proliferation and thyroid diseases were associated with increased MM risk. As most MM patients still resist treatment, drugs with new mechanisms of action are urgently needed. We have recently demonstrated that, similar to results obtained from other cancer types, thyroid hormones induce myeloma cell viability and proliferation through MAPK activation. In the current study, we further studied the ability of thyroid hormones to induce MAPK activation in myeloma cells. We show that this MAPK induction is quick, specific and is initiated through thyroid hormones binding to the integrin αvβ3 receptor site and propose ways to block this potent action. Methods: Cell lines: MM cell lines, RPMI 8226 and CAG are cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS/antibiotics. Reagents and chemicals: T3, T4, tetrac, RGD and RGE peptides, αvβ3 monoclonal antibodies (LM609), phosphorylated and total MAPK ERK1/2 antibodies. Cell proliferation assay: WST-1 (10% final concentration) is incubated at 37°C for 2 h and read using microELISA reader at 440nm. Flow cytometry: Cell cycle: Cells are harvested, fixed and stained with DNA propidium iodide (PI) (50 μ g/ml)/RNAse A (10mg/ml) and analyzed for DNA content by FACS. Analysis of apoptosis/necrosis: Cells (105) are incubated with 10 μ l Annexin V (FITC conjugated)/5 μ l PI and analyzed by FACS. Western blotting: Whole cell lysates were separated on 8–12% polyacrylamid gels and analyzed by western blot using above indicated antibodies. Results were repeated 2–4 times, in triplicates and were analyzed using unpaired students t test. Results and Discussion: Results demonstrate that physiological T3 and T4 concentrations (1nM and 100nM respectively), induce within minutes MAPK activation in myeloma cells, lasting up to 24 hours. This induction is completely blocked by a selective MAPK inhibitor, U0126. We further show that this thyroid-induced MAPK activation is initiated through αvβ3 integrin site, by using specific functional antibody to the integrin (LM609), as well as blocking the binding site using RGD but not RGE peptides. In addition, by using a T4 analog, tetrac, that selectively blocks thyroid hormones binding to the integrin site, we demonstrate a novel and specific way to block the induction of MAPK by T3 and T4. We present here indications that thyroid hormones induce a quick and potent MAPK activation in myeloma cells, similar to reports from other cancer types. This MAPK activation can be blocked using several inhibitors, including tetrac, previously demonstrated by us as a sensitizer of bortezomib action in myeloma. Conclusions: In order to surpass myeloma cancer treatment resistance, new mechanisms of action are urgently needed. Our unique approach, by inhibiting thyroid-induced MAPK pathway initiated at the αvβ3 integrin site, may potentially become a new promising chemosensitizing treatment in this disease. Disclosures: No relevant conflicts of interest to declare.

Description: Background: Melphalan in combination with dexamethasone is an active and the standard regimen in AL amyloidosis. Unfortunately very often patients relapse and other drugs are needed. Bendamustine is a bifunctional alkylating agent approved for the treatment of CLL, NHL, and MM in Europe and the US. But its safety and efficacy in AL amyloidosis is not known. In an effort to investigate the activity of Ben/Dex and improve the outcome of patients with relapsed AL we conduct a multi-center, Phase 2 study of Ben/Dex in AL (NCT01222260) and report data of an updated unplanned interim analysis. First data were reported at ASH 2014 (Abstr.3480). Methods: All patients had relapsed AL after a median of 2 prior therapies (range 1-4). Patients with very advanced cardiac involvement (NYHA Class IIIB/IV) were excluded. Patients with NYHA Class IIIA, NT-proBNP ≥ 1800 ng/L or BNP ≥ 400 ng/L, abnormal cTnT or cTnI could be included after evaluation by cardiology to determine the risk associated with the treatment. Patients with a CrCl ³ 15 mL/min were considered for the trial if they were not in active renal failure. This Phase IIa clinical trial uses a two-stage optimal Simon design enrolling 13 patients in the first stage. Since at least three patients experienced hematologic PR or better, the trial proceeded to the second stage treating an additional 16 patients. If 9 or more patients out of the total of 29 patients evaluable for response experience a hematologic PR or better, the treatment will be considered worthy of further development. The primary objective is to determine the partial hematologic response rate (PR). Secondary objectives included overall hematologic response (OHR) rate, organ response rate (OrRR) (Palladini et al., JCO 2012), time to failure (TTF), toxicities (adverse events at least possibly related to treatment), overall survival (OS) and the assessment of expression of genes associated with ER stress. Patients were assigned to bendamustine according to CrCl: CrCl ≥ 60 mL/min: 100 mg/m2 IV on day 1 and 2 of each cycle, CrCl 59-15 mL/min: 90 mg/m2 IV on day 1 and 2 of each cycle. The option to dose escalate was available to qualifying subjects including escalating to dose level (+)1: 120 mg/m2 (if CrCl ≥ 60 mL/min at the time of inclusion into the study) and 100 mg/m2 (if CrCl 59 - 15 mL/min at the time of inclusion into the study). Dexamethasone was started at 20-40mg weekly according to the performance status of the patient. The duration of each cycle was 28 days. Results: As of 7/15/15, 26 patients have received treatment and 28 patients have been enrolled. Median age of enrolled patients was 66 (range 44-77). Enrolled patients received a median of 1.5 prior regimens (range 1-4). Twelve of the enrolled patients received prior autologous stem cell transplant. Median number of cycles for treated patients is 3.5 (range is 1-12), with 4 patients still receiving treatment. Of note, only 2 patients discontinued treatment due to disease progression. Only 9 patients discontinued treatment due to AE. Most common drug-related AEs (all grades, 〉25%) included fatigue (39%), nausea (35%) and Anemia (27%),. No grade ≥3 drug-related AE occured in 〉20% of patients. Of note, no cardiac events were observed, including any increase in NT-proBNP.Of 24 patients eligible for response evaluation, 11 (46%) have responded hematologically, including (≥PR 42%, CR 4%). The median time to best response of treatment (partial response or better) was 1.57 months (range 0.97 to 15.1 months). The CR occurred in a patient after 5 cycles suggesting that this heavily pretreated patient population needs longer treatment to achieve response. Better responses were especially observed in less heavily treated patients. With a median follow-up of 13.4 months (range 1.5 to 30.3 months) the median OS has not been reached yet (Figure 1). The median PFS is 11.5 months (95% CI,1.5-29.1months) (Figure 2). Conclusions: In our updated unplanned interim analysis we found that Bendamustine in combination with dexamethasone is feasible and effective in pretreated AL amyloidosis with impaired organ function (NYHA IIIB and creatinine clearance of 30-15 mL/min were allowed). Cardiac events related to Bendamustine were not observed. Preliminary hematologic response rates are promising in this pretreated patient population, and organ assessments are ongoing. Further study of this approach is warranted. Figure 1. Figure 1. Figure 2. Figure 2. Disclosures Lentzsch: Axiom: Speakers Bureau; Celgene: Membership on an entity's Board of Directors or advisory committees; Janssen: Membership on an entity's Board of Directors or advisory committees; BMS: Membership on an entity's Board of Directors or advisory committees; Novartis: Membership on an entity's Board of Directors or advisory committees. Off Label Use: Will discuss the use of Bendamustine and Dexamethasone under clinical trial NCT01222260. Comenzo:Takeda Millennium: Research Funding; Prothena: Research Funding; Takeda Millennium: Membership on an entity's Board of Directors or advisory committees; Prothena: Membership on an entity's Board of Directors or advisory committees; Janssen: Research Funding; Karyopharm: Research Funding. Zonder:Celgene: Membership on an entity's Board of Directors or advisory committees, Other: research support; Prothena: Membership on an entity's Board of Directors or advisory committees; Seattle Genetics: Membership on an entity's Board of Directors or advisory committees; BMS: Membership on an entity's Board of Directors or advisory committees. Osman:Millennium / Takeda: Research Funding.

Description: Abstract 2836 Poster Board II-812 Background: Multiple myeloma (MM) is a plasma cell neoplasia accounting for more than 10% of hematological malignancies. Since the disease was first described in England around 1850, MM has been very resistant to treatment with common relapses. It has a poor prognosis with a median survival of 3–5 years, despite all treatment approaches. In recent years, evidence has been provided that thyroid hormones (T3 and T4) may play a permissive role in various cancer cells including breast, brain, prostate and lung, enhancing tumor cell proliferation. Deprivation of these hormones decreases cancer cell proliferation and enhances cell death and response rates to chemotherapy and radiation therapy. It was recently discovered that T3 and T4 exert their proliferating actions through binding to aVb3 integrin, a common cell surface receptor, leading to mitogen-activated protein kinase (MAPK) activation and downstream intra cellular and nuclear events. Interestingly, aVb3 expression is increased during tumor progression and a spectrum of cancer cells, including MM, interact with this central integrin for their invasion, spreading and proliferation. In the current study, we hypothesized that that MM cells, similar to other cancer cells, are thyroid hormones sensitive and aimed to further investigate and characterize their effects on cell survival, proliferation and MAPK signaling. In addition, the additive/ supra additive effects of hypothyroid induction in MM cells on bortezomib's activity were evaluated. Methods: Cell lines: MM cell lines, RPMI 8226, U266, ARP1, ARK and CAG are cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS/antibiotics. Reagents and chemicals: Bortezomib (Velcade) is obtained from the hospital pharmacy. T3, T4, tetrac RGD and RGE peptides (Sigma-Aldrich). PE conjugatedb3 monoclonal antibodies (LM609) and mouse IgG are from Chemicon International. phosphorylated MAPK ERK1/2, p38, JunK antibodies are from Cell Signaling (Danvers, MA). Alpha tubulin and PCNA antibodies are from Santa Cruz Biothecnology (Santa Cruz, CA, USA) WST-1 cell proliferation assay: WST-1 (10% final concentration) is incubated at 37°C for 2 h and read using microELISA reader at 440nm. Flow cytometry : Cell cycle: Cells are harvested, fixed and stained with DNA propidium iodide (PI) (50 μg/ml) /RNAse A (10mg/ml) and analyzed for DNA content by FACS. Analysis of apoptosis/necrosis: Cells (105) are incubated with 10 μl Annexin V (FITC conjugated)/5 μl PI and analyzed by FACS (Annexin+/PI-, early apoptosis; Annexin+/PI+, late apoptosis/necrosis). aVb3 in MM cells: Cells are harvested in RPMI 1640 and directly labeled with PE-aVb3 mAbs (10 mg/ml) and analyzed by FACS. Isotype-matched antibody, serves as negative control.Western blotting: Whole cell lysates were separated on 5-8% polyacrylamid gels and analyzed by western blot using antibodies for phosphorylated MAPK ERK1/2, p38, JunK and PCNA.Statistical analyses: Results were analyzed using unpaired students t test. Results: The sensitivity of myeloma cells to thyroid hormones was explored by addition of increasing concentrations of T3 and T4 to several myeloma cell lines. Results demonstrate that T3 and T4 significantly induced proliferation and cell number in these cells in accordance with PCNA protein elevation. This proliferating action was MAPK related, with phosphor ERK1/2, p38 and JunK elevated in a dose dependent manner. Mimicking hypothyroidism in the cells by using condition medium or T4 analog that block thyroid hormones binding to the integrin, tetrac, inhibited proliferation, increased apoptosis/necrosis and produced G2M arrest. Moreover, supra additive/additive “drug sparing” effects of tetrac-botezomib were observed with significant reduction in survival and increase in apoptosis. Discussion: We present here, for the first time in myeloma, indication that myeloma cells, similar tp reports from other cancer types, are thyroid hormones sensitive and that hypothyroidism induction inhibits cell proliferation and sensitizes response to bortezomib. Conclusions: As most MM patients still relapse, new drugs combinations are needed to overcome resistance. Our novel chemosensitizing approach may potentially demonstrate the importance of thyroid hormones status in this disease and may suggest a protective effect of sub clinical hypothyroidism in MM as a useful and unique adjunct for MM therapy. Disclosures: No relevant conflicts of interest to declare.

Description: Abstract 4534 Myelofibrosis is a clonal myeloproliferative disorder, characterized by ineffective hematopoesis and bone marrow fibrosis. The disease can present de novo or secondary to an antecedent chronic myeloproliferative neoplasm such as essential thrombocythemia (ET) or polycythemia vera (PV). Allogeneic hematopoetic stem cell transplantation (AHSCT) is a curative approach for myelofibrosis, and produces durable donor engraftment and regression of myelofibrosis in approximately 50% of eligible patients. We retrospectively evaluated 31 consecutive patients that were treated for MF with AHSCT at our institution between 1998 and 2011. Thirty-one patients, 33 to 70 years of age, with a median age of 47, males 17 and females 14 with primary myelofibrosis or myelofibrosis evolving from antecedent polycythemia vera 4 (12%) or essential thrombocythemia 10 (32%) received AHSCT. Seven (22%) patients had transformed to acute myeloid leukemia prior to transplant. JAK 2 V617F was present in 15 patients, 9 patients were JAK 2 wild type, 5 patients were not tested and 2 were unknown. Patients received AHSCT from related (n= 11) or unrelated (n= 20) donors. Fourteen patients (45%) had a normal karyotype, 16 patients (51%) had an abnormal karyotype and one was unknown. Twenty eight patients received reduced intensity conditioning regimen and three received a fully ablative transplant. The source of stem cells was marrow in 4 patients and peripheral blood in 27 patients. Median time to neutrophil engraftment was 13 days in 28 patients (90%) and three patients had primary graft failure and were re-transplanted. One of the patients receiving a second AHSCT is alive and in complete hematological remission 19 months post-transplant.Twenty-eight patients showed 95–100% donor chimerism at day 30. Two patients had mixed chimerism at day 90. Twenty-six patients (83%) survive more than 100 days, 3 patients died (10%) from relapsed/progressive disease, and 5 (16%) from TRM. However at a median follow up of 31 months post-transplant 15 patients (48%)survived, 11 (45%)with chronic myelofibrosis, and 4 out of 7(57%)who had transformed to AML prior to transplant. Of note all five patients who were greater than 65 years of age at the time of transplant engrafted and enjoyed full hematological and clinical remission, one of these individuals subsequently died of a solid tumor. In addition, one of the patients with AML had an extramedullary relapsed 36 months post-transplant. One of the unanticipated complications observed in these patients who underwent AHSCT was massive peripheral edema in some cases anasarca of unclear etiology that required diuresis and albumin infusions and that occasionally preceded the date of engraftment and persisted for several weeks after engraftment. We conclude that AHSCT is an important therapeutic modality for not only PMF patients 65 years of age and individuals with blastic transformation of MF. Disclosures: No relevant conflicts of interest to declare.

Description: Abstract 1388 Poster Board I-410 Introduction: A common problem with chemotherapy treatments is reduced dose-intensities from treatment delays due to chemotherapy induced toxicities. In 2004, Lyman and colleagues assessed the overall incidence of reduced dose-intensities for 4,522 non-Hodgkin's lymphoma (NHL) patients. They determined that 53% of the patients, due to treatment delays of 〉7 days (24%) or reduced doses of 〉15% (40%), received a relative dose intensity (RDI) of 15% and 10 patients (17%) had treatment delays of 〉7 days. The mean RDI was 91% and the median was 95%. There was minimal difference between the average RDIs for the treating regimens (CHOP = 91%, R-CHOP 14 = 91%, R-CHOP 21 = 91% and R-CVP = 88%). Patients over the age of 65 received an average RDI of 85% whereas patients under the age of 65 received an average RDI of 94%. Stage I patients (n=10, 16.7%) received an average RDI of 95%, stage II patients (n=11, 18.3%) received an average RDI of 90%, stage III patients (n=17, 28.5%) received an average RDI of 92%, and stage IV patients (n=22, 36.5%) received an average RDI of 87%. Forty-seven patients (78.3%) had a complete response to chemotherapy (average RDI = 92%), 4 patients (6.7%) exhibited a partial response (average RDI = 90.75%), 5 patients (8.3%) showed signs of stable disease (average RDI = 80.6%), and 4 patients (6.7%) had progressive disease (average RDI = 91%). The overall 2 year survival rate for all patients was 93.3%: the survival rate of patients with RDIs 85% were both 93.3%. Conclusion: Both the mean and median RDI we found were higher than those found in the study by Lyman et al (91% and 95% respectively compared to 81% and 86%), and only 25% of patients received