ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

feed icon rss

Ihre E-Mail wurde erfolgreich gesendet. Bitte prüfen Sie Ihren Maileingang.

Leider ist ein Fehler beim E-Mail-Versand aufgetreten. Bitte versuchen Sie es erneut.

Vorgang fortführen?

Exportieren
Filter
  • Rats  (3)
  • *Animals, Laboratory
  • American Association for the Advancement of Science (AAAS)  (3)
  • 1985-1989  (3)
Sammlung
Verlag/Herausgeber
  • American Association for the Advancement of Science (AAAS)  (3)
Erscheinungszeitraum
Jahr
  • 1
    Publikationsdatum: 1989-12-01
    Beschreibung: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 2
    Publikationsdatum: 1987-10-02
    Beschreibung: Epidermal growth factor (EGF) is a potent polypeptide mitogen originally isolated from the adult male mouse submaxillary gland. It also acts as a gastrointestinal hormone. EGF-immunoreactive material has recently been identified within neuronal fibers and terminals in rodent brain. In the present study, EGF was found to enhance survival and process outgrowth of primary cultures of subneocortical telencephalic neurons of neonatal rat brain in a dose-dependent manner. This effect was observed with EGF concentrations as low as 100 picograms per milliliter (0.016 nanomolar) and was dependent on the continuous presence of EGF in the medium. Similar effects were observed with basic fibroblast growth factor, but several other growth-promoting substances, including other mitogens for glial elements, were without effect. Thus EGF, in addition to its mitogenic and hormonal activities, may act as a neurite elongation and maintenance factor for select neurons of the rodent central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, R S -- Kornblum, H I -- Leslie, F M -- Bradshaw, R A -- NS19319/NS/NINDS NIH HHS/ -- NS19964/NS/NINDS NIH HHS/ -- T32-CA0905A/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1987 Oct 2;238(4823):72-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Chemistry, College of Medicine, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3498986" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Animals, Newborn ; Brain/*cytology ; Cell Survival/drug effects ; Cells, Cultured ; Epidermal Growth Factor/*physiology ; Growth Substances/pharmacology ; Rats
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
  • 3
    facet.materialart.
    Unbekannt
    American Association for the Advancement of Science (AAAS)
    Publikationsdatum: 1985-06-28
    Beschreibung: Both elemental distribution and ion transport in cultured cells have been imaged by ion microscopy. Morphological and chemical information was obtained with a spatial resolution of approximately 0.5 micron for sodium, potassium, calcium, and magnesium in freeze-fixed, cryofractured, and freeze-dried normal rat kidney cells and Chinese hamster ovary cells. Ion transport was successfully demonstrated by imaging Na+-K+ fluxes after the inhibition of Na+- and K+ -dependent adenosine triphosphatase with ouabain. This method allows measurements of elemental (isotopic) distribution to be related to cell morphology, thereby providing the means for studying ion distribution and ion transport under different physiological, pathological, and toxicological conditions in cell culture systems.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chandra, S -- Morrison, G H -- R01GM24314/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1985 Jun 28;228(4707):1543-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2990033" target="_blank"〉PubMed〈/a〉
    Schlagwort(e): Animals ; Calcium/analysis ; Cell Line ; Cells, Cultured ; Cricetinae ; Elements/*analysis ; Female ; Freeze Fracturing ; Kidney/*ultrastructure ; Magnesium/analysis ; Microscopy/methods ; Ouabain/pharmacology ; Ovary/*ultrastructure ; Potassium/analysis ; Rats ; Sodium/analysis ; Sodium-Potassium-Exchanging ATPase/antagonists & inhibitors ; Tissue Distribution
    Print ISSN: 0036-8075
    Digitale ISSN: 1095-9203
    Thema: Biologie , Chemie und Pharmazie , Informatik , Medizin , Allgemeine Naturwissenschaft , Physik
    Standort Signatur Erwartet Verfügbarkeit
    BibTip Andere fanden auch interessant ...
Schließen ⊗
Diese Webseite nutzt Cookies und das Analyse-Tool Matomo. Weitere Informationen finden Sie hier...