ALBERT

Description: Enhanced angiogenesis is a hallmark of cancer. Pleiotrophin (PTN) is an angiogenic factor that is produced by many different human cancers and stimulates tumor blood vessel formation when it is expressed in malignant cancer cells. Recent studies show that monocytes may give rise to vascular endothelium. In these studies, we show that PTN combined with macrophage colony-stimulating factor (M-CSF) induces expression of vascular endothelial cell (VEC) genes and proteins in human monocyte cell lines and monocytes from human peripheral blood (PB). Monocytes induce VEC gene expression and develop tube-like structures when they are exposed to serum or cultured with bone marrow (BM) from patients with multiple myeloma (MM) that express PTN, effects specifically blocked with antiPTN antibodies. When coinjected with human MM cells into severe combined immunodeficient (SCID) mice, green fluorescent protein (GFP)–marked human monocytes were found incorporated into tumor blood vessels and expressed human VEC protein markers and genes that were blocked by anti-PTN antibody. Our results suggest that vasculogenesis in human MM may develop from tumoral production of PTN, which orchestrates the transdifferentiation of monocytes into VECs.

Description: Autologous stem cell transplantation has become an important therapy in multiple myeloma (MM). To develop adequate autograft purging methods, it is necessary to determine whether antigens expressed on early hematopoietic progenitors exist on malignant cells. The Ig heavy chain produced by the MM cells shows evidence of prior somatic mutation without intraclonal diversity. As a result, this sequence can be used as a specific marker to detect all members of the malignant clone. The Ig heavy chain sequence expressed by the MM cells was obtained in five patients with advanced disease. Patient specific oligonucleotide primers were designed based on the complementarity determining regions (CDR) of each MM Ig sequence and used to amplify DNA by polymerase chain reaction for the detection of malignant cells. A highly purified collection of CD34+ cells was obtained after passage of the initial bone marrow cells through an immunoadsorption column and fluorescence- activated cell sorting. Despite an assay sensitivity of 1 tumor cell in 2,500 to 44,000 normal cells, none of the CD34+ samples showed product with the myeloma-specific CDR primers. Therefore, positive selection for cells bearing this antigen should yield a tumor-free autograft capable of providing hematopoietic recovery after myeloablative chemotherapy.

Description: Enhanced angiogenesis is a hallmark of solid tumors and hematological malignancies, and anti-angiogenic therapeutic approaches have recently shown significant benefit in the clinic. As a result, many anti-angiogenic agents are currently in early development. Very few methods have been used to evaluate the anti-angiogenic activity of these agents using an ex vivo assay. Unfortunately, currently available methods are both time consuming and costly. We have developed a novel approach to test the anti-angiogenic activity of new agents in a rapid, accurate and inexpensive way. This model consists of using a combined chorioallantoic membrane (CAM) and feather bud (FB) assay. The CAM already has a well developed vascular network and provides an ideal microenvironment and the FB serves as an active biological testing tool for evaluating angiogenesis. FB is a component of epithelial and mesenchymal cells. The method consists of using fertilized chick eggs incubated horizontally at 37.5°C in a humidified incubator and windowed by day 8. Another set of E8 chicken embryonic skins are collected under a dissecting microscope to isolate FB. The FB is treated with drugs or control reagents and implanted onto the CAM. The eggs are sealed with an adhesive tape and incubated for an additional 2–4 days. The endothelial cells of CAM proliferate and migrate into the FB after two days. After 4 days of culture, both blood vessel formation and FB development are determined by microscopy. New blood vessels in FB are analyzed by H&E and immunohistochemical (IHC) staining and expression of endothelial genes and proteins using RT-PCR and Western blot analysis, respectively. First, we establish that the compound being tested should only affect endothelial proliferation or migration and not kill the epithelial and mesenchymal tissues. We have used this new method to investigate several compounds. First, we evaluated the anti-angiogenic agent fumagillin (1μM) and minocycline (100nM). Although neither drug had any cytotoxic effects on the epithelial and mesenchymal tissues when cultured alone, marked inhibition of FB development occurred on the CAM in a dose-dependent fashion with both drugs as determined by microscopy and IHC. In addition, Western blot analysis showed marked inhibition of Tie-2 protein expression in a dose-dependent fashion in the presence of these drugs. Zoledronic acid, a potent bisphosphonate which has recently been shown to harbor anti-angiogenic activity, was found to markedly inhibit FB development in the presence of this drug at a concentration of 10 μM whereas less effect was observed at 2 μM. This drug did not have any direct effect on epithelial and mesenchymal cells when these tissues were cultured alone. We then examined gene and protein expression of the FB cells on CAM that were treated with zoledronic acid. Both FLK-1 and Tie-2 transcript and protein levels were significantly reduced in a dose-dependent fashion following treatment with zoledronic acid as assessed by RT-PCR and Western blot analysis. We are currently testing the potential anti-angiogenic effects of many other novel drugs using this new model. Overall, the present findings demonstrate that the CAM/ FB angiogenesis model is likely to be a reliable, fast, sensitive, and economical system to screen the anti-angiogenic effects of new agents.

Description: Introduction: Despite the advances for treating multiple myeloma (MM) patients (pts), it remains an incurable B-cell malignancy. Thus, the objective for treating these pts is to prolong overall survival (OS) and preserve quality of life. New classes of drugs in the past decade have improved OS for MM pts; however, most of the studies conducted to predict outcome and predict factors that determine OS have relied on older data sets derived from large institutions including pts not receiving treatment there and lacking accurate follow up of pts as well as information from centers in which therapeutic choices are limited. These studies have suggested that depth of response, specifically complete response (CR), and lower International Staging System (ISS) staging at diagnosis predict improved OS. We have now analyzed data on all MM pts who have received treatment in a single clinic specializing in MM. Methods: Data was obtained from all MM pts who received treatment in a single clinic specializing in MM that was established 10 years ago. Kaplan-Meier analysis was used to generate all survival curves and the log-rank test was used to measure difference between curves, with P minimal response (MR; n=135), 〉 partial response (PR; n=107), PR (n=72), or CR (n=35). The OS of pts who had achieved a CR with at least one regimen (n=83 [38% of pts]) was not different than among pts never achieving CR (n=135 [62% of pts]; P=0.1173). In order to further determine whether depth of response predicts OS during the patient’s course of disease, OS was determined based on the best response ever achieved to any anti-myeloma regimen. There was no significant difference in OS between patients who achieved a CR (n=84) with any treatment regimen compared to those who attained an MR or PR (n=108), PR (n=73), MR (n=35) or those who had achieved only an SD (n=11). However, OS among pts who achieved CR, 〉 PR, ≥ MR, or 〉 SD (SD+MR+PR+CR) was better than among those who had only demonstrated PD during their course of disease (P

Description: Dominant negative inhibition is most commonly seen when a mutant subunit of a multi-subunit protein is co-expressed with the wild-type protein so that assembly of a functional oligomer is impaired. Studies have shown that TRAF6 plays a key role in the regulation of NF-κB through the IL-1R/TLR-TRAF6-TAK1-TAB1-TAB2-IkB-NF-κB pathway. We previously demonstrated that TRAF6 is an important factor for the activation of nuclear factor (NF)-κB signaling in multiple myeloma cell proliferation through the c-Jun N-terminal kinase (JNK) pathway and the pathway can be silenced by TRAF6 siRNA. (H. Chen et al. Oncogene, 2006). We targeted the TRAF6 function domain by designing primers targeting positive 1115 to 1818 (Forward: ggctagcatgtcagaggtccggaatttggag (Nhe1) Reverse: cgaagtactgatgcaggggtatagctcgagc (Xho1)) for hTRAF6dn according to GeneBank (NCBI) nucleotide sequence of human TRAF6 (#U78798). We cloned TRAF6 negative domain cDNA into PCRII-TOPO vector and subsequently re-cloned into the pLenti6.2 expression vector (pLenti6.2-hTRAF6dn). All constructs were confirmed by sequencing. Viral titers for all transfections were determined to be 107 plaque-forming units/ml. Expression levels as determined by flow cytometric analysis were 〉95% for all lentivirally encoded GFP gene products. The pLenti6.2-hTRAF6dn vector continually expressed the peptide for TRAF6dn during tumor cell proliferation. We found that TRAF6dn began to inhibit MM cell proliferation in the U266 myeloma cell line after 72 hours of culture and most prominently on day 6. However, the inhibition of RPMI8226 cell proliferation by TRAFdn started after 24 hours of culture whereas effects on inducing MM cell apoptosis were most prominent at 72 hours. The decrease in cell proliferation and increase in cell apoptosis occurred in a dose-dependent fashion. We also examined the effects of TRAF6dn on the NF-κB and JNK pathway since this signaling pathway is associated with cell cycle effects in myeloma. Phosphorylated NF-κB protein levels were reduced using the TRAF6dn expression vector. We also determined the phosphorylation of JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. The results showed that the phosphorylation of JNKK is clearly reduced following blocking the TRAF6 function domain with the TRAF6dn. Furthermore, we examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. The transcriptional activity of c-Jun is regulated by SAPK/JNK binding to c-Jun and phosphorylation of c-Jun at Ser63/73. We found that total endogenous c-Jun is reduced after blocking the TRAF6 function domain with TRAF6dn in the RPMI8226 and U266 MM cell lines. Comparing TRAF6dn with TRAF6 siRNA, only the TRAF6dn inhibited the TRAF6 function domain. These studies suggest that the TRAF6dn peptide may impede myeloma cell signaling pathways resulting in inhibition of tumor cell growth and may represent a new approach to treating patients with MM.

Description: Introduction: In addition to breast and colorectal cancers, multiple myeloma has also been associated with vitamin D deficiency. Given the role of vitamin D in calcium absorption and bone metabolism, it is crucial to maintain sufficient levels for multiple myeloma patients because of their high risk of bone-related complications. We hypothesized that there was a high prevalence of vitamin D deficiency and insufficiency among multiple myeloma patients. We also hypothesized that there is inadequate screening of vitamin D levels throughout community oncology clinics nationwide. Methods: This study both evaluated multiple myeloma patients from a single medical practice specializing in this B-cell malignancy who had a 25-OH vitamin D level determined, and separately determined the proportion of oncology sites that screen for this vitamin among their patients. Charts were reviewed from the medical practice specializing in multiple myeloma, and only the first vitamin D determination was analyzed in the study. Demographics and the presence of the following complications at the time or within 1 year from when vitamin D levels were assessed: peripheral neuropathy, skeletal-related events and bone disease. We defined skeletal-related events as pathological fractures, spinal cord compression or requirement for radiation or surgery, and bone disease as having one of the following: osteoporosis, osteopenia or lytic bone disease. Patients were categorized as either having sufficient (〉 30 ng/ml), insufficient (20 to 〈 30 ng/ml) or deficient (

Description: Introduction: The levels of serum monoclonal immunoglobulins (M-Igs) are used to monitor multiple myeloma (MM) patients. However, these assessments do not discriminate between normal polyclonal immunoglobulins (uninvolved) and M-Igs since they cannot determine the type of light chain associated with each immunoglobulin class (i.e. IgGκ, IgGλ, IgAκ, IgAλ, IgMκ, and IgMλ). The HevyLite® +(HLC) assays are able to accomplish this but the usefulness of these results for MM patients needs to be further established. We evaluated the levels of involved and uninvolved HLC levels, their ratios and differences and their relationship to outcomes among MM patients. Materials and Methods: Serum samples (n=189) from MM patients were analyzed using the HLC assays. Manufacturer’s HLC normal reference ranges were used. HLC results were correlated with clinical status as determined at the time of sampling and divided into groups according to clinical status (complete response (CR), ≥ partial response (PR) , 〈 partial response, and progressive disease (PD)). Normality was assessed using the D’Agostino-Pearson omnibus normality test. Statistical comparisons were made using t-student’s or Mann-Whitney tests as appropriate as well as Fisher’s test. Progression-free survival (PFS) was calculated using Kaplan--Meier analysis for specific regimens received during the time the samples were taken. All tests were double-tailed and p-values lower than 0.05 were considered to be statistically significant. Results: All MM serum samples analyzed had IgG (62%) or IgA (38%) isotypes. Results from the involved HLC/uninvolved HLC ratios and their differences demonstrated that samples from patients with PD had significantly both higher ratios and differences (P

Description: Introduction:B-cell maturation antigen (BCMA) is a tumor necrosis factor receptor family member that is expressed on normal and malignant B-cells, including those from patients (pts) with multiple myeloma (MM). Our group has recently shown that this protein is present in the serum of MM pts, and preliminary findings from our group suggested that its levels may correlate with their clinical status and overall survival (OS; Sanchez et al. Brit J Haematol 2012). We now have analyzed the relationship between serum BCMA levels and monoclonal (M)-protein levels as well as the relationship of BCMA to response status, progression-free survival (PFS) and OS in a large cohort of MM pts including those with nonsecretory disease (NSD). Methods:Two hundred fifty-two MM pts were evaluated. Enzyme-linked immunosorbent assay (ELISA) was used to determine serum BCMA levels (R&D Systems). The Kruskal-Wallis Test was used to assess the correlation between serum BCMA levels and clinical status, and Dunn’s posttest was used to assess differences between clinical status groups. Kaplan-Meier analysis and multivariate Cox regression models were also used. Kaplan-Meier survival of MM pts was determined from the time of initial serum BCMA measurement to death or the date of last follow-up. PFS of MM pts was evaluated from the time of initial serum BCMA measurement to date of first disease progression. Cox-proportional hazards regression was utilized to determine the predictive influence of serum BCMA and various other factors including age, creatinine, hemoglobin, ISS stage, and bone disease on OS and PFS. P-values less than .05 were considered statistically significant. Changes in serum BCMA levels were correlated with serum M-protein levels for 44 consecutive MM pts during their course of disease. Similarly, BCMA was correlated with bone marrow and PET scan findings for NSD pts. Results: Serum BCMA levels correlated with the patient’s clinical status at the time of its determination (p PR had significantly lower serum BCMA levels (median, 11.69 ng/mL) than those with stable and progressive disease (median, 64.17 ng/mL; p

Description: Autologous stem cell transplantation has become an important therapy in multiple myeloma (MM). To develop adequate autograft purging methods, it is necessary to determine whether antigens expressed on early hematopoietic progenitors exist on malignant cells. The Ig heavy chain produced by the MM cells shows evidence of prior somatic mutation without intraclonal diversity. As a result, this sequence can be used as a specific marker to detect all members of the malignant clone. The Ig heavy chain sequence expressed by the MM cells was obtained in five patients with advanced disease. Patient specific oligonucleotide primers were designed based on the complementarity determining regions (CDR) of each MM Ig sequence and used to amplify DNA by polymerase chain reaction for the detection of malignant cells. A highly purified collection of CD34+ cells was obtained after passage of the initial bone marrow cells through an immunoadsorption column and fluorescence- activated cell sorting. Despite an assay sensitivity of 1 tumor cell in 2,500 to 44,000 normal cells, none of the CD34+ samples showed product with the myeloma-specific CDR primers. Therefore, positive selection for cells bearing this antigen should yield a tumor-free autograft capable of providing hematopoietic recovery after myeloablative chemotherapy.

Description: The peripheral benzodiazepine receptor (mPBR) appears to be a potential target to induce apoptosis in tumor cells. The expression of this receptor has been linked to a poor prognosis in cancer patients. PK11195 may represent a new, well-tolerated potent chemosensitizing agent that affects multiple resistance mechanisms within malignant cells. We have evaluated whether PK11195 inhibits multiple myeloma (MM) cell growth in vitro; and, furthermore, whether this drug can chemosensitize a melphalan resistant human MM tumor, LAGλ-1 (Campbell et al, International Journal of Oncology 2006), to arsenic trioxide (ATO) and melphalan using an in vivo SCID-hu model. The MM cell lines RPMI8226 and U266 were treated with varying concentrations of PK11195 (1 – 100 mM). After incubating with PK11195 for 24 hours, cell growth was measured by MTT assay. Those cells treated with PK11195 showed decreased proliferation at concentrations as low as 1 mM compared to the untreated cells. Next, we investigated the chemosensitizing effects of PK11195 using an in vivo model of human MM. To accomplish this, each immunodeficient (SCID) mouse was implanted with a 2.0 – 4.0 mm3 LAGλ-1 tumor fragment into the left superficial gluteal muscle. The tumors were allowed to grow for 14 days at which time human IgG levels were detectable in the mouse serum or when tumors became palpable (21 days) and mice were blindly assigned into treatment groups. PK11195 (10, 50 and 100 mg/kg) was administered via oral gavage once weekly when combined with melphalan and once daily five times per week when combined with ATO. Melphalan (3 mg/kg) was administered once weekly via intraperitoneal (i.p.) injection. ATO (1.25 mg/kg) was administered once daily five times per week via i.p. injection. Mice receiving the combination of PK11195 and melphalan (3 mg/kg) showed marked inhibition of tumor growth (PK11195 10 mg/kg, P = 0.03; PK11195 50 mg/kg, P = 0.02; PK11195 200 mg/kg, P 〈 0.01) compared to mice receiving no therapy. Animals treated with melphalan, as a single agent, did show minimal tumor growth inhibition and reduced paraprotein levels whereas mice treated with single agent PK11195 showed tumor growth similar to the control mice. Mice receiving the combination of PK11195 and low dose ATO (1.25 mg/kg) also showed inhibition of tumor growth (PK11195 200 mg/kg, P 〈 0.01) whereas treatment with either single agent PK11195 or ATO demonstrated growth similar to the control groups. Treatment with the highest dose of PK11195 (200 mg/kg) was not associated with any observed toxicity suggesting that high doses can be safely administered and are well tolerated. In this study, we showed PK11195 inhibits MM cell growth in vitro at very low concentrations and can chemosensitize drug resistant tumor cells in vivo at doses that have no observable toxicity. We are further evaluating PK11195 as a single agent and in combination therapy both in vitro and in vivo..