ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    Electronic Resource
    Electronic Resource
    Springer
    Journal of biological physics 22 (1996), S. 227-243 
    ISSN: 1573-0689
    Keywords: Anisotropy ; DNA bending ; DNA curvature ; Elasticity ; Finite element methods ; Sequence dependent stiffness
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Physics
    Notes: Abstract Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)n, (tctctaaaaaatatataaaaa)n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)n, (atctaatctaacacaacaca)n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.
    Type of Medium: Electronic Resource
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...