ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    Electronic Resource
    Electronic Resource
    Gibberellin-regulated plant genes (1995)
    Oxford, UK : Blackwell Publishing Ltd
    Physiologia plantarum 95 (1995), S. 0 
    Details
    ISSN: 1399-3054
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Biology
    Notes: Gibberellins (GAs) are involved in the control of a number of key developmental processes in plants, including endosperm mobilisation stem elongation and flowering. In many of these systems, GA modulates the transcription of specific genes. The aim of this paper is to review current progress in identifying and characterising GA-regulated genes; both the control of gene expression and the function of the gene products are discussed. The most well-characterised system in which GA is active in controlling transcription is the aleurone layer of cereal grains, where it induces the synthesis of a range of hydrolytic enzymes, including a-amylase. Analysis of the promoters of a-Amy1 and a-Amy2 genes by transient expression in aleurone cells and protoplasts together with DNase 1 footprinting and gel-retardation assays, has identified a number of cis-acting elements important for high-level, GA-regulated expression. In particular a GA-response element (GARE) including the sequence TAACRRA has been characterised. Recent reports describe cDNA clones encoding trans-acting factors that bind to elements in the a-amylase promoters. Expression of the factor capable of binding to the TAACRRA element is itself induced by GA.In elongating tissues, GA has been shown to control the expression of a number of genes, including the tonoplast intrinsic protein, a water channel which may regulate water flux into the vacuole during cell expansion. In flower development, expression of flavonoid biosynthetic genes, such as chalcone synthase in Petunia corollas, is regulated by GA at the level of transcription.Analysis of GA-response mutants led to the suggestion that one consequence of GA action is to regulate its own biosynthesis. Genes encoding GA 20-oxidase and 3β-hydroxylase have recently been shown to be down-regulated by applied GA, providing a possible mechanism for feedback regulation of the GA biosynthetic pathway.There is evidence that cells perceive GA at the cell surface, implying the existence of a signal transduction system between plasma membrane and nucleus. This signal transduction system has barely begun to be elucidated but is likely to become a major focus of gibberellin research.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1111/j.1399-3054.1995.tb00843.x
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 2
    Electronic Resource
    Electronic Resource
    Gibberellin-regulated expression in oat aleurone cells of two kinases that show homology to MAP kinase and a ribosomal protein kinase (1995)
    Springer
    Plant molecular biology 27 (1995), S. 1043-1052 
    Details
    ISSN: 1573-5028
    Keywords: aleurone ; Avena sativa ; GA regulation ; MAP kinase ; PCR amplification ; protein kinases
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract cDNA fragments from ten different protein kinases expressed in Avena sativa aleurone cells were amplified from mRNA by RT-PCR with degenerate primers. These could be classified into five groups: Aspk1-3 showed homology to the Snf1-related protein kinases, Aspk4-5 to a wheat ABA up-regulated protein kinase, Aspk6-8 to the Ca-dependent, calmodulin-independent protein kinase family, Aspk9 encoded a MAP kinase and Aspk10 was closely related to a novel Arabidopsis ribosomal protein kinase. GA caused a rapid increase in transcripts hybridising to Aspk10, while inhibiting the dramatic accumulation of transcripts hybridising to Aspk9 that occurred in the absence of GA.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00037031
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 3
    Electronic Resource
    Electronic Resource
    Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes (1995)
    Springer
    Plant molecular biology 29 (1995), S. 691-702 
    Details
    ISSN: 1573-5028
    Keywords: aleurone ; Avena fatua ; DNA-binding proteins ; Zinc finger ; heterologous expression ; leucine zipper
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract The promoters of wheat, barley and wild oat α-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00041160
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 4
    Electronic Resource
    Electronic Resource
    Functional analysis of linker insertions and point mutations in the α-Amy2/54 GA-regulated promoter (1995)
    Springer
    Plant molecular biology 29 (1995), S. 749-758 
    Details
    ISSN: 1573-5028
    Keywords: aleurone ; Avena sativa ; α-Amy2 promoter ; cis elements ; functional analysis ; transient ; expression
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract Functional analysis of a gibberellin-regulated wheat α-amylase promoter, α-Amy2/54, has indicated that three regions were essential for expression. By studying the ability of mutant promoters, containing a randomly inserted 22 bp excision linker, to direct expression in oat aleurone protoplasts we have refined the positions and extents of these three cis elements and also demonstrated the presence of two additional elements. By converting the linker insertions to either single base point mutations or deletions using the class IIS restriction endonuclease Bsm I we have shown that nucleotides −119 and −109 within the GARE −121GTAACAGAGTCTGG−108 and nucleotide −152 within the proposed element −156GATTGACTTGACC−144 are essential for high level expression from this promoter.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00041165
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 5
    Electronic Resource
    Electronic Resource
    Cloning of two gibberellin-regulated cDNAs from Arabidopsis thaliana by subtractive hybridization: expression of the tonoplast water channel, γ-TIP, is increased by GA3 (1994)
    Springer
    Plant molecular biology 24 (1994), S. 603-615 
    Details
    ISSN: 1573-5028
    Keywords: Arabidopsis thaliana ; dwarf mutant ; gene expression ; gibberellin ; subtractive hybridization ; tonoplast intrinsic protein
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract The Arabidopsis ga1 mutant has very low levels of endogenous, active gibberellins and thus has an extreme dwarf phenotype; application of GA3 induces stem elongation and flower development. To test the hypothesis that GA action in this system involves changes in gene expression, we have cloned mRNAs whose abundance changes following GA application. A subtraction cloning scheme for the isolation of differentially regulated cDNAs was established, involving hybridization of single-stranded cDNA to biotinylated mRNA. cDNA populations enriched up to 150-fold in GA-regulated sequences were produced and cDNA libraries generated. Screening of these libraries has isolated two clones that identify mRNAs of ca. 1100 and 750 bases whose abundance is markedly increased 24 h after GA application. One of these clones encodes the vegetative form of the Arabidopsis tonoplast intrinsic protein (γ-TIP), a water channel protein, the expression of which has recently been shown to be correlated with regions of cell expansion. The second clone is expressed only in the inflorescence and encodes a proline- and glycine-rich protein that may be a cell wall component.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00023557
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 6
    Electronic Resource
    Electronic Resource
    Localization of the gene for cytochrome f in pea chloroplast DNA (1983)
    Springer
    Molecular genetics and genomics 189 (1983), S. 85-89 
    Details
    ISSN: 1617-4623
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary Pea chloroplast DNA and cloned restriction fragments of pea chloroplast DNA have been used as templates in a cell-free coupled transcription-translation system from E. coli and have been shown to direct the synthesis of a 39 kD polypeptide related to cytochrome f (37.3 kD). The product was shown to be similar to cytochrome f by immunoprecipitation with specific antibodies and by peptide mapping of the products of limited chymotrypsin digestion. The structural gene for this higher molecular weight form of cytochrome f has been located within a 3.3 kbp BglII fragment situated 18 kbp from the single 16S rRNA gene.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00326059
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 7
    Electronic Resource
    Electronic Resource
    A novel wheat α-amylase gene (α-Amy3) (1987)
    Springer
    Molecular genetics and genomics 209 (1987), S. 33-40 
    Details
    ISSN: 1617-4623
    Keywords: Wheat chromosome 5 ; Grain development ; Germination ; Intron evolution ; Upstream regulatory sequences
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary A genomic clone of a wheat α-amylase gene (λAmy3/33) was identified, on the basis of hybridisation properties, as different from α-Amy1 and α-Amy2 genes which had been characterised previously. The nucleotide sequence revealed that this gene has the normal sequence motifs of an active gene and an open reading frame interrupted by two introns. The protein sequence encoded by this open reading frame is recognisably similar to that of α-amylase from the α-Amy1 and α-Amy2 genes and there is high sequence homology in all three proteins at the putative active sites and Ca++ binding region. In addition, the introns are at positions equivalent to the position of introns in the α-Amy1 and α-Amy2 genes. However, the sequence was less similar to α-Amy1 and α-Amy2 than these are to each other. Southern blot analysis showed that the λAmy3/33 DNA is one of a small multigene family carried on a different chromosome (group 5) from either the α-Amy1 or α-Amy2 genes. A further difference from the α-Amy1 and α-Amy2 genes was the pattern of expression. λAmy3/33 was expressed only in immature grains and, unlike the α-Amy1 and α-Amy2 genes, not at all in germinating aleurones. These data suggested therefore that this gene represents a third type of α-amylase gene, not described before, which shares a common evolutionary ancestor with the α-Amy1 and α-Amy2 genes.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00329833
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 8
    Electronic Resource
    Electronic Resource
    Sequence heterogeneity and differential expression of the α-Amy2 gene family in wheat (1988)
    Springer
    Molecular genetics and genomics 214 (1988), S. 232-240 
    Details
    ISSN: 1617-4623
    Keywords: α-Amylase ; Chromosome location ; Promoter sequence comparisons ; Sequence heterogeneity ; Tissuespecific expression
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary The α-Amy2 genes of wheat are a multigene family which is expressed in the aleurone cells of germinating grain under control of the plant hormone gibberellin. A subset of the genes are also expressed in developing grain. Comparison of five genomic clones containing α-Amy2 genes, using DNA sequence analysis and Southern hybridisation, showed that the extent of similarity between genes differed. Two of the most heterogeneous genes compared were located to the same group 7 chromosome while the most similar genes α-Amy2/54 and α-Amy2/8 were located to different ones; hence sequence variation could not be correlated to the ancestry of the α-Amy2 genes during the separate existence of the constituent genomes of hexaploid wheat. Expression of the cloned genes was measured using an S1 nuclease protection assay and this identified α-Amy2/54 and α-Amy2/8 as part of the subset of α-Amy2 genes expressed in both the developing grain and in aleurone cells. Comparison of the 5′ upstream regions of all five genes showed high similarity, with the exception of one gene, up to-280 nucleotides from the transcriptional start, while similarity between α-Amy2/54 and α-Amy2/8 extended a further 90 bp upstream of this point. It is suggested that regulatory elements responsible for tissue specificity and gibberellin regulation may be located within these regions of similarity.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00337716
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 9
    Electronic Resource
    Electronic Resource
    Localisation of genes for four ATP synthase subunits in pea chloroplast DNA (1984)
    Springer
    Molecular genetics and genomics 194 (1984), S. 402-409 
    Details
    ISSN: 1617-4623
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary The genes for four subunits of the chloroplast ATP synthase, alpha, beta and epsilon of CF1 and subunit III of CF0, have been located in pea chloroplast DNA using hybridisation of fragments of genes for homologous wheat ATP synthase subunits and cell-free coupled transcription-translation of pea chloroplast DNA or cloned restriction fragments. The genes are arranged in two clusters, which are 50 kbp apart. The gene for the beta subunit is located close to that for the epsilon subunit and the gene for the alpha subunit is approximately 2 kbp away from that for the CF0 subunit III gene. The genes for the alpha subunit and the CF0 subunit III are transcribed in the same direction. The beta subunit gene is close to the gene for the large subunit of ribulose 1,5-bisphosphate (RuBP) carboxylase but the two genes are transcribed divergently. The arrangement of the genes in two clusters is similar to that found in other plant species, although pea chloroplast DNA has no large inverted repeat sequence and has undergone extensive rearrangements relative to chloroplast DNAs which contain the large inverted repeat sequences.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF00425551
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 10
    facet.materialart.
    Unknown
    A sixth subunit of ATP synthase, an F0 component, is encoded in the pea chloroplast genome (1986)
    EMBO Press
    Details
    Publication Date: 1986-02-01
    Print ISSN: 0261-4189
    Electronic ISSN: 1460-2075
    Topics: Biology , Medicine
    Published by EMBO Press on behalf of European Molecular Biology Organization.
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...