ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    facet.materialart.
    Unknown
    Marine mammals join the Navy (1988)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1988-12-16
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, D C -- New York, N.Y. -- Science. 1988 Dec 16;242(4885):1503-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3201237" target="_blank"〉PubMed〈/a〉
    Keywords: Animal Welfare ; Animals ; *Dolphins ; *Military Science ; *Pinnipedia ; *Seals, Earless ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    Trophic stimulation of cultured neurons from neonatal rat brain by epidermal growth factor (1987)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1987-10-02
    Description: Epidermal growth factor (EGF) is a potent polypeptide mitogen originally isolated from the adult male mouse submaxillary gland. It also acts as a gastrointestinal hormone. EGF-immunoreactive material has recently been identified within neuronal fibers and terminals in rodent brain. In the present study, EGF was found to enhance survival and process outgrowth of primary cultures of subneocortical telencephalic neurons of neonatal rat brain in a dose-dependent manner. This effect was observed with EGF concentrations as low as 100 picograms per milliliter (0.016 nanomolar) and was dependent on the continuous presence of EGF in the medium. Similar effects were observed with basic fibroblast growth factor, but several other growth-promoting substances, including other mitogens for glial elements, were without effect. Thus EGF, in addition to its mitogenic and hormonal activities, may act as a neurite elongation and maintenance factor for select neurons of the rodent central nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, R S -- Kornblum, H I -- Leslie, F M -- Bradshaw, R A -- NS19319/NS/NINDS NIH HHS/ -- NS19964/NS/NINDS NIH HHS/ -- T32-CA0905A/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1987 Oct 2;238(4823):72-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Chemistry, College of Medicine, University of California, Irvine 92717.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3498986" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Animals, Newborn ; Brain/*cytology ; Cell Survival/drug effects ; Cells, Cultured ; Epidermal Growth Factor/*physiology ; Growth Substances/pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    facet.materialart.
    Unknown
    A cell-cycle constraint on the regulation of gene expression by platelet-derived growth factor (1987)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1987-11-27
    Description: In density-arrested monolayer cultures of Balb/c 3T3 cells, platelet-derived growth factor (PDGF) stimulates expression of the c-myc and c-fos proto-oncogenes, as well as the functionally uncharacterized genes, JE, KC, and JB. These genes are not coordinately regulated. Under ordinary conditions, c-fos, JE, KC, and JB respond to PDGF only when the cells are in a state of G0 growth arrest at the time of PDGF addition. The c-myc gene is regulated in opposition to the other genes, responding best to PDGF in cycling cultures.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rollins, B J -- Morrison, E D -- Stiles, C D -- CA 20042-09/CA/NCI NIH HHS/ -- GM 31489-04/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1987 Nov 27;238(4831):1269-71.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Medicine, Dana-Farber Cancer Institute, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3685976" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Cycle/drug effects ; Cell Division/drug effects ; Cells, Cultured ; Gene Expression Regulation/*drug effects ; Interphase ; Mice ; Mice, Inbred BALB C ; Platelet-Derived Growth Factor/*pharmacology ; Proto-Oncogenes/*drug effects ; Transcription, Genetic/*drug effects
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    Imaging elemental distribution and ion transport in cultured cells with ion microscopy (1985)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1985-06-28
    Description: Both elemental distribution and ion transport in cultured cells have been imaged by ion microscopy. Morphological and chemical information was obtained with a spatial resolution of approximately 0.5 micron for sodium, potassium, calcium, and magnesium in freeze-fixed, cryofractured, and freeze-dried normal rat kidney cells and Chinese hamster ovary cells. Ion transport was successfully demonstrated by imaging Na+-K+ fluxes after the inhibition of Na+- and K+ -dependent adenosine triphosphatase with ouabain. This method allows measurements of elemental (isotopic) distribution to be related to cell morphology, thereby providing the means for studying ion distribution and ion transport under different physiological, pathological, and toxicological conditions in cell culture systems.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chandra, S -- Morrison, G H -- R01GM24314/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1985 Jun 28;228(4707):1543-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2990033" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcium/analysis ; Cell Line ; Cells, Cultured ; Cricetinae ; Elements/*analysis ; Female ; Freeze Fracturing ; Kidney/*ultrastructure ; Magnesium/analysis ; Microscopy/methods ; Ouabain/pharmacology ; Ovary/*ultrastructure ; Potassium/analysis ; Rats ; Sodium/analysis ; Sodium-Potassium-Exchanging ATPase/antagonists & inhibitors ; Tissue Distribution
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    Localization of amyloid beta protein messenger RNA in brains from patients with Alzheimer's disease (1987)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1987-07-03
    Description: The distribution of cells containing messenger RNA that encodes amyloid beta protein was determined in hippocampi and in various cortical regions from cynomolgus monkeys, normal humans, and patients with Alzheimer's disease by in situ hybridization. Both 35S-labeled RNA antisense and sense probes to amyloid beta protein messenger RNA were used to ensure specific hybridization. Messenger RNA for amyloid beta protein was expressed in a subset of neurons in the prefrontal cortex from monkeys, normal humans, and patients with Alzheimer's disease. This messenger RNA was also present in the neurons of all the hippocampal fields from monkeys, normal humans and, although to a lesser extent in cornu ammonis 1, patients with Alzheimer's disease. The distribution of amyloid beta protein messenger RNA was similar to that of the neurofibrillary tangles of Alzheimer's disease in some regions, but the messenger RNA was also expressed in other neurons that are not usually involved in the pathology of Alzheimer's disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bahmanyar, S -- Higgins, G A -- Goldgaber, D -- Lewis, D A -- Morrison, J H -- Wilson, M C -- Shankar, S K -- Gajdusek, D C -- AG05131/AG/NIA NIH HHS/ -- MH00519/MH/NIMH NIH HHS/ -- NS23038/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1987 Jul 3;237(4810):77-80.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3299701" target="_blank"〉PubMed〈/a〉
    Keywords: Alzheimer Disease/*genetics ; Amyloid/*genetics ; Amyloid beta-Peptides ; Animals ; Brain/*physiopathology ; Cerebral Cortex/physiology ; Gene Expression Regulation ; Hippocampus/physiology ; Humans ; Macaca fascicularis ; Nucleic Acid Hybridization ; RNA, Messenger/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    T-lymphocyte priming and protection against Friend leukemia by vaccinia-retrovirus env gene recombinant (1986)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1986-11-07
    Description: The current prevalence of the acquired immune deficiency syndrome in humans has provoked renewed interest in methods of protective immunization against retrovirus-induced diseases. In this study, a vaccinia-retrovirus recombinant vector was constructed to study mechanisms of immune protection against Friend virus leukemia in mice. The envelope (env) gene from Friend murine leukemia virus (F-MuLV) was inserted into the genome of a vaccinia virus expression vector. Infected cells synthesized gp85, the glycosylated primary product of the env gene. Processing to gp70 and p15E, and cell surface localization, were similar to that occurring in cells infected with F-MuLV. Mice inoculated with live recombinant vaccinia virus had an envelope-specific T-cell proliferative response and, after challenge with Friend virus complex, developed neutralizing antibody and cytotoxic T cells (CTL) and were protected against leukemia. In contrast, unimmunized and control groups developed a delayed neutralizing antibody response, but no detectable CTL, and succumbed to leukemia. Genes of the major histocompatibility complex influenced protection induced by the vaccinia recombinant but not that induced by attenuated N-tropic Friend virus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Earl, P L -- Moss, B -- Morrison, R P -- Wehrly, K -- Nishio, J -- Chesebro, B -- New York, N.Y. -- Science. 1986 Nov 7;234(4777):728-31.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3490689" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Viral/immunology ; Antigens/*immunology ; DNA, Recombinant ; Female ; Friend murine leukemia virus/genetics/immunology ; *Genes, Viral ; Leukemia, Erythroblastic, Acute/prevention & control ; Leukemia, Experimental/*prevention & control ; Lymphocyte Activation ; Male ; Mice ; Mice, Inbred Strains ; Sex Factors ; Spleen/microbiology ; T-Lymphocytes/*immunology ; T-Lymphocytes, Cytotoxic/immunology ; Vaccines, Synthetic/*immunology ; Vaccinia virus/genetics/immunology ; Viral Envelope Proteins/genetics/*immunology ; Viral Vaccines/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    Transfectomas provide novel chimeric antibodies (1985)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1985-09-20
    Description: Methods have been developed to transfect immunoglobulin genes into lymphoid cells. The transfected genes are faithfully expressed, and assembly can occur both between the transfected and endogenous chains and between two transfected chains. Gene transfection can be used to reconstitute immunoglobulin molecules and to produce novel immunoglobulin molecules. These novel molecules can represent unique combinations of heavy and light chains; alternatively, by means of recombinant DNA technology, genes can be assembled in vitro, transfected, and expressed. The end products of such manipulations include chimeric molecules with variable regions joined to different isotypic constant regions; this is possible both within and between species. It is also possible to synthesize altered immunoglobulin molecules, as well as molecules having immunoglobulin sequences fused with nonimmunoglobulin sequences (for example, enzyme sequences).〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, S L -- CA 13696/CA/NCI NIH HHS/ -- CA 16858/CA/NCI NIH HHS/ -- CA 22736/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1985 Sep 20;229(4719):1202-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3929380" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chimera ; DNA, Recombinant ; Gene Expression Regulation ; Genes, Bacterial ; Humans ; Hybridomas/*metabolism ; Immunoglobulin Constant Regions/biosynthesis/genetics ; Immunoglobulin Heavy Chains/biosynthesis/genetics ; Immunoglobulin Light Chains/biosynthesis/genetics ; Immunoglobulin Variable Region/biosynthesis/genetics ; Immunoglobulins/biosynthesis/*genetics/physiology ; Lymphocytes/immunology ; Mice ; Structure-Activity Relationship ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...