ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1997-01-31
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaiser, J -- New York, N.Y. -- Science. 1997 Jan 31;275(5300):610.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/9019815" target="_blank"〉PubMed〈/a〉
    Keywords: Alabama ; Cytomegalovirus Infections ; Humans ; Infant, Low Birth Weight ; Infant, Newborn ; National Institutes of Health (U.S.) ; Research Support as Topic ; Scientific Misconduct/*legislation & jurisprudence ; United States ; Universities/*legislation & jurisprudence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1986-11-07
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Norman, C -- New York, N.Y. -- Science. 1986 Nov 7;234(4777):661-2.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3775357" target="_blank"〉PubMed〈/a〉
    Keywords: *Acquired Immunodeficiency Syndrome ; Humans ; Research Support as Topic ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1983-09-16
    Description: A 1,25-dihydroxyvitamin D3 receptor macromolecule was detected in peripheral mononuclear leukocytes from normal humans. This macromolecule was found to be present in monocytes but absent from normal resting peripheral B and T lymphocytes. However, it was present in established lines of malignant B, T, and non-B, non-T human lymphocytes, as well as in T and B lymphocytes obtained from normal humans and activated in vitro.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Provvedini, D M -- Tsoukas, C D -- Deftos, L J -- Manolagas, S C -- New York, N.Y. -- Science. 1983 Sep 16;221(4616):1181-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6310748" target="_blank"〉PubMed〈/a〉
    Keywords: B-Lymphocytes/analysis ; Cell Line ; Humans ; Leukemia/analysis ; Leukocytes/*analysis ; Lymphocyte Activation ; Monocytes/analysis ; Receptors, Calcitriol ; Receptors, Steroid/*analysis ; T-Lymphocytes/analysis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1984-06-29
    Description: The hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], at picomolar concentrations, inhibited the growth-promoting lymphokine interleukin-2, which is produced by human T lymphocytes activated in vitro by the mitogen phytohemagglutinin. Other metabolites of vitamin D3 were less effective than 1,25(OH)2D3 in suppressing interleukin-2; their order of potency corresponded to their respective affinity for the 1,25(OH)2D3 receptor, suggesting that the effect on interleukin-2 was mediated by this specific receptor. The proliferation of mitogen-activated lymphocytes was also inhibited by 1,25(OH)2D3. This effect of the hormone became more pronounced at later stages of the culture. These findings demonstrate that 1,25(OH)2D3 is an immunoregulatory hormone.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tsoukas, C D -- Provvedini, D M -- Manolagas, S C -- AM29779/AM/NIADDK NIH HHS/ -- New York, N.Y. -- Science. 1984 Jun 29;224(4656):1438-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6427926" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcitriol/*pharmacology ; Cell Division/drug effects ; Cell Line ; Humans ; Immunity, Cellular/*drug effects ; Interleukin-2/antagonists & inhibitors ; Lymphocyte Activation/drug effects ; Lymphocytes/drug effects ; Mice ; Monocytes/drug effects ; Receptors, Immunologic/drug effects ; Receptors, Interleukin-2
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1995-03-24
    Description: When a person attempts to produce from memory a given spatial or temporal interval, there is inevitably some error associated with the estimate. The time course of this error was measured in a series of experiments where subjects repeatedly attempted to replicate given target intervals. Sequences of the errors in both spatial and temporal replications were found to fluctuate as 1/f noises. 1/f noise is encountered in a wide variety of physical systems and is theorized to be a characteristic signature of complexity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gilden, D L -- Thornton, T -- Mallon, M W -- New York, N.Y. -- Science. 1995 Mar 24;267(5205):1837-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Texas at Austin 78712.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/7892611" target="_blank"〉PubMed〈/a〉
    Keywords: Cognition/*physiology ; Fourier Analysis ; Humans ; Models, Psychological ; Reaction Time/physiology ; Space Perception/*physiology ; Time Perception/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 2004-04-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bohannon, John -- New York, N.Y. -- Science. 2004 Apr 16;304(5669):377-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/15087518" target="_blank"〉PubMed〈/a〉
    Keywords: African Continental Ancestry Group ; Animals ; *Archaeology/manpower ; *Biological Evolution ; Culture ; European Continental Ancestry Group ; Fossils ; *Hominidae ; Humans ; Politics ; Prejudice ; Race Relations ; South Africa
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 2004-04-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Crabb, Charlene -- New York, N.Y. -- Science. 2004 Apr 16;304(5669):376-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/15087517" target="_blank"〉PubMed〈/a〉
    Keywords: African Continental Ancestry Group ; *Biomedical Research ; European Continental Ancestry Group ; Financing, Government ; Humans ; Politics ; Prejudice ; Race Relations ; *Research ; Research Support as Topic ; *Science ; South Africa
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    facet.materialart.
    Unknown
    Nature Publishing Group (NPG)
    Publication Date: 2009-11-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Check Hayden, Erika -- England -- Nature. 2009 Nov 5;462(7269):21. doi: 10.1038/462021a.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/19890298" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptation, Physiological/genetics ; Animals ; *Biodiversity ; Databases, Genetic ; Genomics/*trends ; Humans ; International Cooperation ; Species Specificity ; Vertebrates/*genetics
    Print ISSN: 0028-0836
    Electronic ISSN: 1476-4687
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1998-03-21
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Adams, A -- New York, N.Y. -- Science. 1998 Feb 27;279(5355):1307-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/9508706" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Neoplasms/*radiotherapy ; Clinical Trials as Topic ; Gadolinium ; Humans ; Metalloporphyrins/chemical synthesis/pharmacokinetics/*therapeutic use ; Mice ; Neoplasms, Experimental/*radiotherapy ; *Radiation-Sensitizing Agents/chemical synthesis/pharmacokinetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...