ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    Publication Date: 1982-10-29
    Description: Saturable and stereospecific binding sites for (+)-[3H]amphetamine were demonstrated in membrane preparations from rat brain. The density of these binding sites varies among brain regions and is highest in the hypothalamus and brainstem. Specific (+)-[3H]amphetamine binding in hypothalamus is largely confined to synaptosomal membranes, rapidly reversible, and sensitive to both heat and proteolytic enzymes. Scatchard analysis of the equilibrium binding data revealed two distinct sites with apparent affinity constants of 93 and 300 nanomoles per liter, respectively. The effects of various psychotropic drugs as well as a number of putative neurotransmitters and related agonists and antagonists in displacing specific (+)-[3H]amphetamine binding demonstrate that these binding sites are not associated with any previously described neurotransmitter or drug receptors, but are specific for amphetamine and related phenylethylamine derivatives. Furthermore, the relative affinities of a series of phenylethylamine derivatives for (+)-[3H]amphetamine binding sites in hypothalamic membranes is highly correlated to their potencies as anorexic agents. These results suggest the presence of specific receptor sites in hypothalamus that mediate the anorexic activity of amphetamine and related drugs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Paul, S M -- Hulihan-Giblin, B -- Skolnick, P -- New York, N.Y. -- Science. 1982 Oct 29;218(4571):487-90.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/7123250" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Anorexia/physiopathology ; Appetite Depressants/*pharmacology ; Cell Membrane/metabolism ; Dextroamphetamine/*metabolism ; Hypothalamus/drug effects/*metabolism/physiology ; Male ; Phenethylamines/metabolism ; Rats ; Receptors, Drug/*metabolism ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1980-07-25
    Description: Intracellular recordings from voltage-clamped mouse spinal neurons in tissue culture were used to study the membrane mechanisms underlying inhibitory responses to gamma-aminobutyric acid and the (-) isomer of pentobarbital. Fluctuation analysis suggested that both substances activated ion channels in the membranes. However, the channels activated by pentobarbital remained open five times longer than those activated by gamma-aminobutyric acid.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mathers, D A -- Barker, J L -- New York, N.Y. -- Science. 1980 Jul 25;209(4455):507-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6248961" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Membrane/drug effects/physiology ; Cells, Cultured ; Ion Channels/drug effects/*physiology ; Membrane Potentials/drug effects ; Mice ; Neurons/drug effects/*physiology ; Pentobarbital/*pharmacology ; Spinal Cord/*physiology ; gamma-Aminobutyric Acid/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1980-09-12
    Description: Specific binding of 1 alpha,25-dihydroxyvitamin D(3) was found in nuclear and cytosol fractions of the bovine pituitary. For nuclear binding. the dissociation constant was 0.1 namomole per liter, and maximum binding was 104 femtomoles per milligram of protein. In competition studies, 25-hydroxyvitamin D(3) was 300 times weaker than 1 alpha,25-dihydroxyvitamin D(3). The existence of high-affinity sites supports a physiologic role for 1 alpha,25-dihydroxyvitamin D(3) in the pituitary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gelbard, H A -- Stern, P H -- U'Prichard, D C -- New York, N.Y. -- Science. 1980 Sep 12;209(4462):1247-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6250221" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/metabolism ; Cattle ; Cell Nucleus/metabolism ; Cholecalciferol/*metabolism ; Cytosol/metabolism ; Dihydroxycholecalciferols/*metabolism ; Hydroxycholecalciferols/*metabolism ; Kinetics ; Pituitary Gland/*metabolism/ultrastructure ; Receptors, Drug/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1984-06-29
    Description: The hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], at picomolar concentrations, inhibited the growth-promoting lymphokine interleukin-2, which is produced by human T lymphocytes activated in vitro by the mitogen phytohemagglutinin. Other metabolites of vitamin D3 were less effective than 1,25(OH)2D3 in suppressing interleukin-2; their order of potency corresponded to their respective affinity for the 1,25(OH)2D3 receptor, suggesting that the effect on interleukin-2 was mediated by this specific receptor. The proliferation of mitogen-activated lymphocytes was also inhibited by 1,25(OH)2D3. This effect of the hormone became more pronounced at later stages of the culture. These findings demonstrate that 1,25(OH)2D3 is an immunoregulatory hormone.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tsoukas, C D -- Provvedini, D M -- Manolagas, S C -- AM29779/AM/NIADDK NIH HHS/ -- New York, N.Y. -- Science. 1984 Jun 29;224(4656):1438-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6427926" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcitriol/*pharmacology ; Cell Division/drug effects ; Cell Line ; Humans ; Immunity, Cellular/*drug effects ; Interleukin-2/antagonists & inhibitors ; Lymphocyte Activation/drug effects ; Lymphocytes/drug effects ; Mice ; Monocytes/drug effects ; Receptors, Immunologic/drug effects ; Receptors, Interleukin-2
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    Publication Date: 1984-08-03
    Description: Explants of embryonic rat mesencephalon were grown in organotypic culture. Addition of 10 microM 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to the culture medium for 4 to 7 days resulted in loss of dopamine cell bodies and fiber outgrowths, as observed by fluorescence histochemistry. At the same time, the cultures showed decreased uptake of tritium-labeled dopamine. However, no signs of generalized toxicity were evident when the explant cultures were viewed by light and phase-contrast microscopy. These results show that MPTP exerts a relatively selective destructive action in dopamine neurons in vitro, similar to the action observed in humans and monkeys in vivo. Pargyline (10 microM), a monoamine oxidase inhibitor, protected the dopamine neurons in the explants. Organotypic cultures provide an experimental model for the study of the properties of MPTP in vitro.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mytilineou, C -- Cohen, G -- NS-11631/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1984 Aug 3;225(4661):529-31.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6610939" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine ; Animals ; Dopamine/*metabolism ; Embryo, Mammalian ; Histocytochemistry ; Mesencephalon/*drug effects/physiology ; Neurons/*drug effects/physiology ; Organ Culture Techniques ; Pyridines/*toxicity ; Rats ; Tritium
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 2004-04-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bohannon, John -- New York, N.Y. -- Science. 2004 Apr 16;304(5669):377-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/15087518" target="_blank"〉PubMed〈/a〉
    Keywords: African Continental Ancestry Group ; Animals ; *Archaeology/manpower ; *Biological Evolution ; Culture ; European Continental Ancestry Group ; Fossils ; *Hominidae ; Humans ; Politics ; Prejudice ; Race Relations ; South Africa
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    facet.materialart.
    Unknown
    Nature Publishing Group (NPG)
    Publication Date: 2009-11-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Check Hayden, Erika -- England -- Nature. 2009 Nov 5;462(7269):21. doi: 10.1038/462021a.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/19890298" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptation, Physiological/genetics ; Animals ; *Biodiversity ; Databases, Genetic ; Genomics/*trends ; Humans ; International Cooperation ; Species Specificity ; Vertebrates/*genetics
    Print ISSN: 0028-0836
    Electronic ISSN: 1476-4687
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1998-03-21
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Adams, A -- New York, N.Y. -- Science. 1998 Feb 27;279(5355):1307-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/9508706" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain Neoplasms/*radiotherapy ; Clinical Trials as Topic ; Gadolinium ; Humans ; Metalloporphyrins/chemical synthesis/pharmacokinetics/*therapeutic use ; Mice ; Neoplasms, Experimental/*radiotherapy ; *Radiation-Sensitizing Agents/chemical synthesis/pharmacokinetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    Publication Date: 2006-11-04
    Description: This week marks a century since the first description of Alzheimer's disease (AD). Despite approval of several drugs for AD, the disease continues to rob millions of their memories and their lives. Fortunately, many new therapies directly targeting the mechanisms underlying AD are now in the pipeline. Among the investigative AD therapies in clinical trials are several strategies to block pathogenic amyloid-beta peptides and to rescue vulnerable neurons from degeneration. Complementary but less mature strategies aim to prevent the copathogenic effects of apolipoprotein E and the microtubule-associated protein tau. New insights into selective neuronal vulnerability and the link between aging and AD may provide additional entry points for therapeutic interventions. The predicted increase in AD cases over the next few decades makes the development of better treatments a matter of utmost importance and urgency.〈br /〉〈br /〉〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3544944/" target="_blank"〉〈img src="https://static.pubmed.gov/portal/portal3rc.fcgi/4089621/img/3977009" border="0"〉〈/a〉   〈a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3544944/" target="_blank"〉This paper as free author manuscript - peer-reviewed and accepted for publication〈/a〉〈br /〉〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberson, Erik D -- Mucke, Lennart -- AG011385/AG/NIA NIH HHS/ -- AG022074/AG/NIA NIH HHS/ -- K08 NS054811/NS/NINDS NIH HHS/ -- K08 NS054811-01/NS/NINDS NIH HHS/ -- NS054811/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 2006 Nov 3;314(5800):781-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Gladstone Institute of Neurological Disease and Department of Neurology, University of California, San Francisco, CA 94158, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/17082448" target="_blank"〉PubMed〈/a〉
    Keywords: Alzheimer Disease/pathology/physiopathology/*therapy ; Amyloid beta-Peptides/immunology/metabolism ; Animals ; Clinical Trials as Topic ; Enzyme Inhibitors/therapeutic use ; Humans ; Immunization, Passive ; Nootropic Agents/therapeutic use ; Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...