ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    facet.materialart.
    Unknown
    (+)-Amphetamine binding to rat hypothalamus: relation to anorexic potency for phenylethylamines (1982)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1982-10-29
    Description: Saturable and stereospecific binding sites for (+)-[3H]amphetamine were demonstrated in membrane preparations from rat brain. The density of these binding sites varies among brain regions and is highest in the hypothalamus and brainstem. Specific (+)-[3H]amphetamine binding in hypothalamus is largely confined to synaptosomal membranes, rapidly reversible, and sensitive to both heat and proteolytic enzymes. Scatchard analysis of the equilibrium binding data revealed two distinct sites with apparent affinity constants of 93 and 300 nanomoles per liter, respectively. The effects of various psychotropic drugs as well as a number of putative neurotransmitters and related agonists and antagonists in displacing specific (+)-[3H]amphetamine binding demonstrate that these binding sites are not associated with any previously described neurotransmitter or drug receptors, but are specific for amphetamine and related phenylethylamine derivatives. Furthermore, the relative affinities of a series of phenylethylamine derivatives for (+)-[3H]amphetamine binding sites in hypothalamic membranes is highly correlated to their potencies as anorexic agents. These results suggest the presence of specific receptor sites in hypothalamus that mediate the anorexic activity of amphetamine and related drugs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Paul, S M -- Hulihan-Giblin, B -- Skolnick, P -- New York, N.Y. -- Science. 1982 Oct 29;218(4571):487-90.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/7123250" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Anorexia/physiopathology ; Appetite Depressants/*pharmacology ; Cell Membrane/metabolism ; Dextroamphetamine/*metabolism ; Hypothalamus/drug effects/*metabolism/physiology ; Male ; Phenethylamines/metabolism ; Rats ; Receptors, Drug/*metabolism ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    (-)Pentobarbital opens ion channels of long duration in cultured mouse spinal neurons (1980)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1980-07-25
    Description: Intracellular recordings from voltage-clamped mouse spinal neurons in tissue culture were used to study the membrane mechanisms underlying inhibitory responses to gamma-aminobutyric acid and the (-) isomer of pentobarbital. Fluctuation analysis suggested that both substances activated ion channels in the membranes. However, the channels activated by pentobarbital remained open five times longer than those activated by gamma-aminobutyric acid.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mathers, D A -- Barker, J L -- New York, N.Y. -- Science. 1980 Jul 25;209(4455):507-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6248961" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Membrane/drug effects/physiology ; Cells, Cultured ; Ion Channels/drug effects/*physiology ; Membrane Potentials/drug effects ; Mice ; Neurons/drug effects/*physiology ; Pentobarbital/*pharmacology ; Spinal Cord/*physiology ; gamma-Aminobutyric Acid/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    /U,B,K/ coordinates - A natural system for studying magnetospheric convection (1978)
    In:  Other Sources
    Details
    Publication Date: 2019-06-27
    Description: The formulation of the magnetospheric convection problem involves a coordinate system consisting of the electric potential, the magnetic field intensity, and the modified longitudinal invariant. The mapping is extended to include all particles and not just those mirroring in the magnetic equator. Equations of motion for the particle mirror points in this representation are presented. The analysis results in a natural division of the magnetosphere into accelerator and dynamo regions and use of the coordinate system permits trajectory-dependent effects to be distinguished from source- or sink-dependent effects. The representation is illustrated by application to the analysis of the nose structure protons observed by Smith and Hoffman (1974).
    Keywords: GEOPHYSICS
    Type: Journal of Geophysical Research; 83; Sept. 1
    Format: text
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    NASA TECHNICAL REPORTS
  • 4
    facet.materialart.
    Unknown
    1 alpha, 25-Dihydroxyvitamin D3 nuclear receptors in pituitary (1980)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1980-09-12
    Description: Specific binding of 1 alpha,25-dihydroxyvitamin D(3) was found in nuclear and cytosol fractions of the bovine pituitary. For nuclear binding. the dissociation constant was 0.1 namomole per liter, and maximum binding was 104 femtomoles per milligram of protein. In competition studies, 25-hydroxyvitamin D(3) was 300 times weaker than 1 alpha,25-dihydroxyvitamin D(3). The existence of high-affinity sites supports a physiologic role for 1 alpha,25-dihydroxyvitamin D(3) in the pituitary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gelbard, H A -- Stern, P H -- U'Prichard, D C -- New York, N.Y. -- Science. 1980 Sep 12;209(4462):1247-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6250221" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/metabolism ; Cattle ; Cell Nucleus/metabolism ; Cholecalciferol/*metabolism ; Cytosol/metabolism ; Dihydroxycholecalciferols/*metabolism ; Hydroxycholecalciferols/*metabolism ; Kinetics ; Pituitary Gland/*metabolism/ultrastructure ; Receptors, Drug/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    1 test and evaluation of ERTS-A data applications to a present status inventory of the post-1890 AD episode of accelerated erosion, and to monitoring future erosional changes, with specific reference to the Arizona regional ecological test site (1972)
    In:  CASI
    Details
    Publication Date: 2019-07-13
    Description: There are no author-identified significant results in this report.
    Keywords: GEOPHYSICS
    Type: E72-10104 , NASA-CR-128153
    Format: application/pdf
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    NASA TECHNICAL REPORTS
  • 6
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D3: a novel immunoregulatory hormone (1984)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1984-06-29
    Description: The hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], at picomolar concentrations, inhibited the growth-promoting lymphokine interleukin-2, which is produced by human T lymphocytes activated in vitro by the mitogen phytohemagglutinin. Other metabolites of vitamin D3 were less effective than 1,25(OH)2D3 in suppressing interleukin-2; their order of potency corresponded to their respective affinity for the 1,25(OH)2D3 receptor, suggesting that the effect on interleukin-2 was mediated by this specific receptor. The proliferation of mitogen-activated lymphocytes was also inhibited by 1,25(OH)2D3. This effect of the hormone became more pronounced at later stages of the culture. These findings demonstrate that 1,25(OH)2D3 is an immunoregulatory hormone.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tsoukas, C D -- Provvedini, D M -- Manolagas, S C -- AM29779/AM/NIADDK NIH HHS/ -- New York, N.Y. -- Science. 1984 Jun 29;224(4656):1438-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6427926" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcitriol/*pharmacology ; Cell Division/drug effects ; Cell Line ; Humans ; Immunity, Cellular/*drug effects ; Interleukin-2/antagonists & inhibitors ; Lymphocyte Activation/drug effects ; Lymphocytes/drug effects ; Mice ; Monocytes/drug effects ; Receptors, Immunologic/drug effects ; Receptors, Interleukin-2
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 8
    facet.materialart.
    Unknown
    1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine destroys dopamine neurons in explants of rat embryo mesencephalon (1984)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1984-08-03
    Description: Explants of embryonic rat mesencephalon were grown in organotypic culture. Addition of 10 microM 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to the culture medium for 4 to 7 days resulted in loss of dopamine cell bodies and fiber outgrowths, as observed by fluorescence histochemistry. At the same time, the cultures showed decreased uptake of tritium-labeled dopamine. However, no signs of generalized toxicity were evident when the explant cultures were viewed by light and phase-contrast microscopy. These results show that MPTP exerts a relatively selective destructive action in dopamine neurons in vitro, similar to the action observed in humans and monkeys in vivo. Pargyline (10 microM), a monoamine oxidase inhibitor, protected the dopamine neurons in the explants. Organotypic cultures provide an experimental model for the study of the properties of MPTP in vitro.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mytilineou, C -- Cohen, G -- NS-11631/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1984 Aug 3;225(4661):529-31.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6610939" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine ; Animals ; Dopamine/*metabolism ; Embryo, Mammalian ; Histocytochemistry ; Mesencephalon/*drug effects/physiology ; Neurons/*drug effects/physiology ; Organ Culture Techniques ; Pyridines/*toxicity ; Rats ; Tritium
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 9
    facet.materialart.
    Unknown
    10 years after apartheid. New South Africa puts emphasis on reclaiming humanity's past (2004)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 2004-04-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bohannon, John -- New York, N.Y. -- Science. 2004 Apr 16;304(5669):377-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/15087518" target="_blank"〉PubMed〈/a〉
    Keywords: African Continental Ancestry Group ; Animals ; *Archaeology/manpower ; *Biological Evolution ; Culture ; European Continental Ancestry Group ; Fossils ; *Hominidae ; Humans ; Politics ; Prejudice ; Race Relations ; South Africa
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    facet.materialart.
    Unknown
    10,000 genomes to come (2009)
    Nature Publishing Group (NPG)
    Details
    Publication Date: 2009-11-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Check Hayden, Erika -- England -- Nature. 2009 Nov 5;462(7269):21. doi: 10.1038/462021a.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/19890298" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptation, Physiological/genetics ; Animals ; *Biodiversity ; Databases, Genetic ; Genomics/*trends ; Humans ; International Cooperation ; Species Specificity ; Vertebrates/*genetics
    Print ISSN: 0028-0836
    Electronic ISSN: 1476-4687
    Topics: Biology , Chemistry and Pharmacology , Medicine , Natural Sciences in General , Physics
    Published by Nature Publishing Group (NPG)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...