ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Humans  (26,754)
  • Biochemistry and Biotechnology  (13,095)
  • 1
    facet.materialart.
    Unknown
    $1.6 million fraud award overturned (1997)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1997-01-31
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kaiser, J -- New York, N.Y. -- Science. 1997 Jan 31;275(5300):610.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/9019815" target="_blank"〉PubMed〈/a〉
    Keywords: Alabama ; Cytomegalovirus Infections ; Humans ; Infant, Low Birth Weight ; Infant, Newborn ; National Institutes of Health (U.S.) ; Research Support as Topic ; Scientific Misconduct/*legislation & jurisprudence ; United States ; Universities/*legislation & jurisprudence
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    $2-billion program urged for AIDS (1986)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1986-11-07
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Norman, C -- New York, N.Y. -- Science. 1986 Nov 7;234(4777):661-2.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/3775357" target="_blank"〉PubMed〈/a〉
    Keywords: *Acquired Immunodeficiency Syndrome ; Humans ; Research Support as Topic ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    Electronic Resource
    Electronic Resource
    1,2-Dioxetanes: Novel chemiluminescent enzyme substrates. Applications to immunoassays (1989)
    New York : Wiley-Blackwell
    Journal of Bioluminescence and Chemiluminescence 4 (1989), S. 99-111 
    Details
    ISSN: 0884-3996
    Keywords: Chemiluminescent substrates ; enzymes ; immunoassays ; sensitive detection ; enhancement ; 1,2-dioxetane ; Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Chemistry and Pharmacology
    Notes: We have synthesized and studied two 1,2-dioxetane-based chemiluminescent enzyme substrates: 3-(2′-spiroadamantane)-4-methoxy-4-(3″-phosphoryloxy)phenyl-1,2-dioxetane (AMPPD), and, 3-(2′-spiroadamantane)-4-methoxy-4- (3″-β-D′-galactopyrano-yloxy)phenyl-1,2-dioxetane (AMPGD), which can be activated to chemiluminescence at 470 nm by alkaline phosphatase and βD-galactosidase, respectively. In addition, we observed that certain macromolecules enhance the luminescence of AMPPD. For example, the addition of 0.1% bovine serum albumin amplifies the luminescent signal and improves the detection limit for alkaline phosphatase by approximately one order of magnitude under certain conditions. This effect is due to the presence of a hydrophobic microenvironment provided by the enhancer which ‘stabilizes’ the dephosphorylated AMPPD emitter.Alkaline phosphatase catalysed chemiluminescence from AMPPD is constant for a prolonged period of time. Using AMPPD we were able to detect 0.01 attomole quantities of alkaline phosphatase immobilized on membrane supports and imaged on photographic film and, in solution, measured in a luminometer.AMPPD and AMPGD offer alternatives to colorimetric and fluorescent subsrates for alkaline phosphatase and β-D-galactosidase labels used in enzyme immunoassays. The simplicity and sensitivity of this chemiluminescent readout allowed the development of rapid clinical assays (e.g. β-hCG, LH, TSH and others).
    Additional Material: 15 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bio.1170040116
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 4
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 5
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D3 receptors in human leukocytes (1983)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1983-09-16
    Description: A 1,25-dihydroxyvitamin D3 receptor macromolecule was detected in peripheral mononuclear leukocytes from normal humans. This macromolecule was found to be present in monocytes but absent from normal resting peripheral B and T lymphocytes. However, it was present in established lines of malignant B, T, and non-B, non-T human lymphocytes, as well as in T and B lymphocytes obtained from normal humans and activated in vitro.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Provvedini, D M -- Tsoukas, C D -- Deftos, L J -- Manolagas, S C -- New York, N.Y. -- Science. 1983 Sep 16;221(4616):1181-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6310748" target="_blank"〉PubMed〈/a〉
    Keywords: B-Lymphocytes/analysis ; Cell Line ; Humans ; Leukemia/analysis ; Leukocytes/*analysis ; Lymphocyte Activation ; Monocytes/analysis ; Receptors, Calcitriol ; Receptors, Steroid/*analysis ; T-Lymphocytes/analysis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D3: a novel immunoregulatory hormone (1984)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1984-06-29
    Description: The hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], at picomolar concentrations, inhibited the growth-promoting lymphokine interleukin-2, which is produced by human T lymphocytes activated in vitro by the mitogen phytohemagglutinin. Other metabolites of vitamin D3 were less effective than 1,25(OH)2D3 in suppressing interleukin-2; their order of potency corresponded to their respective affinity for the 1,25(OH)2D3 receptor, suggesting that the effect on interleukin-2 was mediated by this specific receptor. The proliferation of mitogen-activated lymphocytes was also inhibited by 1,25(OH)2D3. This effect of the hormone became more pronounced at later stages of the culture. These findings demonstrate that 1,25(OH)2D3 is an immunoregulatory hormone.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tsoukas, C D -- Provvedini, D M -- Manolagas, S C -- AM29779/AM/NIADDK NIH HHS/ -- New York, N.Y. -- Science. 1984 Jun 29;224(4656):1438-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6427926" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcitriol/*pharmacology ; Cell Division/drug effects ; Cell Line ; Humans ; Immunity, Cellular/*drug effects ; Interleukin-2/antagonists & inhibitors ; Lymphocyte Activation/drug effects ; Lymphocytes/drug effects ; Mice ; Monocytes/drug effects ; Receptors, Immunologic/drug effects ; Receptors, Interleukin-2
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    Electronic Resource
    Electronic Resource
    1,4-α-Glucan phosphorylase from Klebsiella pneumoniae covalently coupled on porous glass (1977)
    New York, NY [u.a.] : Wiley-Blackwell
    Biotechnology and Bioengineering 19 (1977), S. 1387-1403 
    Details
    ISSN: 0006-3592
    Keywords: Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Process Engineering, Biotechnology, Nutrition Technology
    Notes: A simplified procedure for the preparation of 1,4-α-glucan phosphorylase from Klebsiella pneumoniae is described. An 80-fold purification is achieved in two steps with an overall yield of about 50%. The specific activity of the homogeneous enzyme protein is 17.7 units/mg. Compared with glycogen phosphorylase from rabbit muscle the enzyme from K. pneumoniae shows a markedly higher stability against deforming and chaotropic agents. The 1,4-α-glucan phosphorylase was covalently bound to porous glass particles by three different methods. Coupling with glutaraldehyde gave the highest specific activity, i.e., 5.6 units/mg of bound protein or 133 units/g of glass with maltodextrin as substrate. This corresponds to about 30% of the specific activity of the soluble enzyme. With substrates of higher molecular weight, such as glycogen or amylopectin, lower relative activity was observed. The immobilized enzyme preparations showed pH activity profiles which were slightly displaced to higher values and exhibited an increased temperature stability.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bit.260190911
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 8
    Electronic Resource
    Electronic Resource
    1-dehydrogenation of steroids by Septomyxa affinis (1962)
    New York, NY [u.a.] : Wiley-Blackwell
    Biotechnology and Bioengineering 4 (1962), S. 57-63 
    Details
    ISSN: 0006-3592
    Keywords: Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Process Engineering, Biotechnology, Nutrition Technology
    Notes: 1-Dehydrogenation of steroids by Septomyxa affinis is brought about by an inducible enzyme. Only soluble substrate steroid is attacked. Individual steroids are dehydrogenated at different relative rates. The pH-activity curve is shallow.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bit.260040108
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 9
    Electronic Resource
    Electronic Resource
    1-Monoglyceride production from lipase-catalyzed esterification of glycerol and fatty acid in reverse micelles (1991)
    New York, NY [u.a.] : Wiley-Blackwell
    Biotechnology and Bioengineering 38 (1991), S. 507-517 
    Details
    ISSN: 0006-3592
    Keywords: lipases ; reverse micelles ; dynamic light scattering ; glycerol-fatty acid esterification ; Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Process Engineering, Biotechnology, Nutrition Technology
    Notes: Glycerol-fatty acid esterification has been conducted with lipase from R. delemar in water/AOT/isooctane reverse micellar media, with the major product being 1-monoglyceride, a useful food-emulsifier. 1,3-diglyceride was also synthesized, but to a much lesser extent. For a given set of initial conditions, the reaction productivity, measured in terms of the initial product formation rate, V0, and the final or equilibrium concentration of product, is optimal for a particular concentration of each surfactant, fatty acid, glycerol, and water. Many of these optimal values correlate well with a “critical” region on the phase diagram. Also, results indicate lipase-catalyzed esterification stops due to the achievement of kinetic equilibrium expect for a few cases where enzyme deactivation is severe. Dynamic light scattering was employed to examine the influence of water, glycerol, and fatty acid on micellar and interfacial structure. Results from this technique indicate enzyme kinetic are linked to interfacial phenomena and the presence of substrates at the interfacial region.
    Additional Material: 10 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bit.260380509
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 10
    facet.materialart.
    Unknown
    1/f noise in human cognition (1995)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1995-03-24
    Description: When a person attempts to produce from memory a given spatial or temporal interval, there is inevitably some error associated with the estimate. The time course of this error was measured in a series of experiments where subjects repeatedly attempted to replicate given target intervals. Sequences of the errors in both spatial and temporal replications were found to fluctuate as 1/f noises. 1/f noise is encountered in a wide variety of physical systems and is theorized to be a characteristic signature of complexity.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gilden, D L -- Thornton, T -- Mallon, M W -- New York, N.Y. -- Science. 1995 Mar 24;267(5205):1837-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Psychology, University of Texas at Austin 78712.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/7892611" target="_blank"〉PubMed〈/a〉
    Keywords: Cognition/*physiology ; Fourier Analysis ; Humans ; Models, Psychological ; Reaction Time/physiology ; Space Perception/*physiology ; Time Perception/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...