ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Animals  (27,852)
  • Biochemistry and Biotechnology  (13,095)
  • 1
    facet.materialart.
    Unknown
    (+)-Amphetamine binding to rat hypothalamus: relation to anorexic potency for phenylethylamines (1982)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1982-10-29
    Description: Saturable and stereospecific binding sites for (+)-[3H]amphetamine were demonstrated in membrane preparations from rat brain. The density of these binding sites varies among brain regions and is highest in the hypothalamus and brainstem. Specific (+)-[3H]amphetamine binding in hypothalamus is largely confined to synaptosomal membranes, rapidly reversible, and sensitive to both heat and proteolytic enzymes. Scatchard analysis of the equilibrium binding data revealed two distinct sites with apparent affinity constants of 93 and 300 nanomoles per liter, respectively. The effects of various psychotropic drugs as well as a number of putative neurotransmitters and related agonists and antagonists in displacing specific (+)-[3H]amphetamine binding demonstrate that these binding sites are not associated with any previously described neurotransmitter or drug receptors, but are specific for amphetamine and related phenylethylamine derivatives. Furthermore, the relative affinities of a series of phenylethylamine derivatives for (+)-[3H]amphetamine binding sites in hypothalamic membranes is highly correlated to their potencies as anorexic agents. These results suggest the presence of specific receptor sites in hypothalamus that mediate the anorexic activity of amphetamine and related drugs.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Paul, S M -- Hulihan-Giblin, B -- Skolnick, P -- New York, N.Y. -- Science. 1982 Oct 29;218(4571):487-90.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/7123250" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Anorexia/physiopathology ; Appetite Depressants/*pharmacology ; Cell Membrane/metabolism ; Dextroamphetamine/*metabolism ; Hypothalamus/drug effects/*metabolism/physiology ; Male ; Phenethylamines/metabolism ; Rats ; Receptors, Drug/*metabolism ; Structure-Activity Relationship
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 2
    facet.materialart.
    Unknown
    (-)Pentobarbital opens ion channels of long duration in cultured mouse spinal neurons (1980)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1980-07-25
    Description: Intracellular recordings from voltage-clamped mouse spinal neurons in tissue culture were used to study the membrane mechanisms underlying inhibitory responses to gamma-aminobutyric acid and the (-) isomer of pentobarbital. Fluctuation analysis suggested that both substances activated ion channels in the membranes. However, the channels activated by pentobarbital remained open five times longer than those activated by gamma-aminobutyric acid.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mathers, D A -- Barker, J L -- New York, N.Y. -- Science. 1980 Jul 25;209(4455):507-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6248961" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Membrane/drug effects/physiology ; Cells, Cultured ; Ion Channels/drug effects/*physiology ; Membrane Potentials/drug effects ; Mice ; Neurons/drug effects/*physiology ; Pentobarbital/*pharmacology ; Spinal Cord/*physiology ; gamma-Aminobutyric Acid/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 3
    facet.materialart.
    Unknown
    1 alpha, 25-Dihydroxyvitamin D3 nuclear receptors in pituitary (1980)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1980-09-12
    Description: Specific binding of 1 alpha,25-dihydroxyvitamin D(3) was found in nuclear and cytosol fractions of the bovine pituitary. For nuclear binding. the dissociation constant was 0.1 namomole per liter, and maximum binding was 104 femtomoles per milligram of protein. In competition studies, 25-hydroxyvitamin D(3) was 300 times weaker than 1 alpha,25-dihydroxyvitamin D(3). The existence of high-affinity sites supports a physiologic role for 1 alpha,25-dihydroxyvitamin D(3) in the pituitary.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gelbard, H A -- Stern, P H -- U'Prichard, D C -- New York, N.Y. -- Science. 1980 Sep 12;209(4462):1247-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6250221" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/metabolism ; Cattle ; Cell Nucleus/metabolism ; Cholecalciferol/*metabolism ; Cytosol/metabolism ; Dihydroxycholecalciferols/*metabolism ; Hydroxycholecalciferols/*metabolism ; Kinetics ; Pituitary Gland/*metabolism/ultrastructure ; Receptors, Drug/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 4
    Electronic Resource
    Electronic Resource
    1,2-Dioxetanes: Novel chemiluminescent enzyme substrates. Applications to immunoassays (1989)
    New York : Wiley-Blackwell
    Journal of Bioluminescence and Chemiluminescence 4 (1989), S. 99-111 
    Details
    ISSN: 0884-3996
    Keywords: Chemiluminescent substrates ; enzymes ; immunoassays ; sensitive detection ; enhancement ; 1,2-dioxetane ; Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Chemistry and Pharmacology
    Notes: We have synthesized and studied two 1,2-dioxetane-based chemiluminescent enzyme substrates: 3-(2′-spiroadamantane)-4-methoxy-4-(3″-phosphoryloxy)phenyl-1,2-dioxetane (AMPPD), and, 3-(2′-spiroadamantane)-4-methoxy-4- (3″-β-D′-galactopyrano-yloxy)phenyl-1,2-dioxetane (AMPGD), which can be activated to chemiluminescence at 470 nm by alkaline phosphatase and βD-galactosidase, respectively. In addition, we observed that certain macromolecules enhance the luminescence of AMPPD. For example, the addition of 0.1% bovine serum albumin amplifies the luminescent signal and improves the detection limit for alkaline phosphatase by approximately one order of magnitude under certain conditions. This effect is due to the presence of a hydrophobic microenvironment provided by the enhancer which ‘stabilizes’ the dephosphorylated AMPPD emitter.Alkaline phosphatase catalysed chemiluminescence from AMPPD is constant for a prolonged period of time. Using AMPPD we were able to detect 0.01 attomole quantities of alkaline phosphatase immobilized on membrane supports and imaged on photographic film and, in solution, measured in a luminometer.AMPPD and AMPGD offer alternatives to colorimetric and fluorescent subsrates for alkaline phosphatase and β-D-galactosidase labels used in enzyme immunoassays. The simplicity and sensitivity of this chemiluminescent readout allowed the development of rapid clinical assays (e.g. β-hCG, LH, TSH and others).
    Additional Material: 15 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bio.1170040116
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 5
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 6
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D3: a novel immunoregulatory hormone (1984)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1984-06-29
    Description: The hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], at picomolar concentrations, inhibited the growth-promoting lymphokine interleukin-2, which is produced by human T lymphocytes activated in vitro by the mitogen phytohemagglutinin. Other metabolites of vitamin D3 were less effective than 1,25(OH)2D3 in suppressing interleukin-2; their order of potency corresponded to their respective affinity for the 1,25(OH)2D3 receptor, suggesting that the effect on interleukin-2 was mediated by this specific receptor. The proliferation of mitogen-activated lymphocytes was also inhibited by 1,25(OH)2D3. This effect of the hormone became more pronounced at later stages of the culture. These findings demonstrate that 1,25(OH)2D3 is an immunoregulatory hormone.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tsoukas, C D -- Provvedini, D M -- Manolagas, S C -- AM29779/AM/NIADDK NIH HHS/ -- New York, N.Y. -- Science. 1984 Jun 29;224(4656):1438-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6427926" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcitriol/*pharmacology ; Cell Division/drug effects ; Cell Line ; Humans ; Immunity, Cellular/*drug effects ; Interleukin-2/antagonists & inhibitors ; Lymphocyte Activation/drug effects ; Lymphocytes/drug effects ; Mice ; Monocytes/drug effects ; Receptors, Immunologic/drug effects ; Receptors, Interleukin-2
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 7
    Electronic Resource
    Electronic Resource
    1,4-α-Glucan phosphorylase from Klebsiella pneumoniae covalently coupled on porous glass (1977)
    New York, NY [u.a.] : Wiley-Blackwell
    Biotechnology and Bioengineering 19 (1977), S. 1387-1403 
    Details
    ISSN: 0006-3592
    Keywords: Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Process Engineering, Biotechnology, Nutrition Technology
    Notes: A simplified procedure for the preparation of 1,4-α-glucan phosphorylase from Klebsiella pneumoniae is described. An 80-fold purification is achieved in two steps with an overall yield of about 50%. The specific activity of the homogeneous enzyme protein is 17.7 units/mg. Compared with glycogen phosphorylase from rabbit muscle the enzyme from K. pneumoniae shows a markedly higher stability against deforming and chaotropic agents. The 1,4-α-glucan phosphorylase was covalently bound to porous glass particles by three different methods. Coupling with glutaraldehyde gave the highest specific activity, i.e., 5.6 units/mg of bound protein or 133 units/g of glass with maltodextrin as substrate. This corresponds to about 30% of the specific activity of the soluble enzyme. With substrates of higher molecular weight, such as glycogen or amylopectin, lower relative activity was observed. The immobilized enzyme preparations showed pH activity profiles which were slightly displaced to higher values and exhibited an increased temperature stability.
    Additional Material: 5 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bit.260190911
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 8
    Electronic Resource
    Electronic Resource
    1-dehydrogenation of steroids by Septomyxa affinis (1962)
    New York, NY [u.a.] : Wiley-Blackwell
    Biotechnology and Bioengineering 4 (1962), S. 57-63 
    Details
    ISSN: 0006-3592
    Keywords: Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Process Engineering, Biotechnology, Nutrition Technology
    Notes: 1-Dehydrogenation of steroids by Septomyxa affinis is brought about by an inducible enzyme. Only soluble substrate steroid is attacked. Individual steroids are dehydrogenated at different relative rates. The pH-activity curve is shallow.
    Additional Material: 2 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bit.260040108
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 9
    facet.materialart.
    Unknown
    1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine destroys dopamine neurons in explants of rat embryo mesencephalon (1984)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1984-08-03
    Description: Explants of embryonic rat mesencephalon were grown in organotypic culture. Addition of 10 microM 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to the culture medium for 4 to 7 days resulted in loss of dopamine cell bodies and fiber outgrowths, as observed by fluorescence histochemistry. At the same time, the cultures showed decreased uptake of tritium-labeled dopamine. However, no signs of generalized toxicity were evident when the explant cultures were viewed by light and phase-contrast microscopy. These results show that MPTP exerts a relatively selective destructive action in dopamine neurons in vitro, similar to the action observed in humans and monkeys in vivo. Pargyline (10 microM), a monoamine oxidase inhibitor, protected the dopamine neurons in the explants. Organotypic cultures provide an experimental model for the study of the properties of MPTP in vitro.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mytilineou, C -- Cohen, G -- NS-11631/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1984 Aug 3;225(4661):529-31.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6610939" target="_blank"〉PubMed〈/a〉
    Keywords: 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine ; Animals ; Dopamine/*metabolism ; Embryo, Mammalian ; Histocytochemistry ; Mesencephalon/*drug effects/physiology ; Neurons/*drug effects/physiology ; Organ Culture Techniques ; Pyridines/*toxicity ; Rats ; Tritium
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 10
    Electronic Resource
    Electronic Resource
    1-Monoglyceride production from lipase-catalyzed esterification of glycerol and fatty acid in reverse micelles (1991)
    New York, NY [u.a.] : Wiley-Blackwell
    Biotechnology and Bioengineering 38 (1991), S. 507-517 
    Details
    ISSN: 0006-3592
    Keywords: lipases ; reverse micelles ; dynamic light scattering ; glycerol-fatty acid esterification ; Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Process Engineering, Biotechnology, Nutrition Technology
    Notes: Glycerol-fatty acid esterification has been conducted with lipase from R. delemar in water/AOT/isooctane reverse micellar media, with the major product being 1-monoglyceride, a useful food-emulsifier. 1,3-diglyceride was also synthesized, but to a much lesser extent. For a given set of initial conditions, the reaction productivity, measured in terms of the initial product formation rate, V0, and the final or equilibrium concentration of product, is optimal for a particular concentration of each surfactant, fatty acid, glycerol, and water. Many of these optimal values correlate well with a “critical” region on the phase diagram. Also, results indicate lipase-catalyzed esterification stops due to the achievement of kinetic equilibrium expect for a few cases where enzyme deactivation is severe. Dynamic light scattering was employed to examine the influence of water, glycerol, and fatty acid on micellar and interfacial structure. Results from this technique indicate enzyme kinetic are linked to interfacial phenomena and the presence of substrates at the interfacial region.
    Additional Material: 10 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bit.260380509
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...