ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Animals  (27,852)
  • Analytical Chemistry and Spectroscopy  (25,033)
  • ASTROPHYSICS  (16,581)
  • 11
    Electronic Resource
    Electronic Resource
    1,2-Dibromoethane as a positive chemical ionization reagent: Application to geometrical isomersRRL(H) Communication No. 2143 (1988)
    Chichester : Wiley-Blackwell
    Biological Mass Spectrometry 23 (1988), S. 620-621 
    Details
    ISSN: 0030-493X
    Keywords: Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Additional Material: 1 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/oms.1210230813
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 12
    Electronic Resource
    Electronic Resource
    1,2-oxazine chemistry. V - vicinal, allylic and homoallylic coupling constants in the 3,6-dihydro-1,2-oxazine ring (1974)
    Chichester : Wiley-Blackwell
    Organic Magnetic Resonance 6 (1974), S. 599-600 
    Details
    ISSN: 0030-4921
    Keywords: Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The 1H NMR spectra of thirteen dihydro-1,2-oxazine derivatives are reported. Spin decoupling allows analysis of the spectra, features of which include homoallylic couplings of +2 to +2·5 Hz, allylic couplings of -1·5 to -1·7 Hz and vicinal couplings across sp2 to sp3 carbon-carbon bonds of +2·9 to +3·7 Hz.
    Additional Material: 2 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/mrc.1270061110
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 13
    Electronic Resource
    Electronic Resource
    1,2-Versus 1,4-reduction of α,β-unsaturated carbonyl compounds in the gas phase (1993)
    Chichester : Wiley-Blackwell
    Biological Mass Spectrometry 28 (1993), S. 1658-1664 
    Details
    ISSN: 0030-493X
    Keywords: Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: The regioselectivity involved in the gas-phase hydride reduction of α,β-unsaturated carbonyl compounds by pentacoordinate silicon hydride ions is investigated. The kinetics and product distributions of the reactions of acrolein, methyl vinyl ketone and cyclohex-2-enone with monoalkoxysiliconate ions of the general composition RSiH3(OR′)- were examined with the flowing afterglow-triple quadrupole technique. All three substrates react by hydride transfer and by formation of a siliconate adduct in which hydride reduction of the organic reactant has occurred. The structures of these adducts and the hydride transfer products were identified by various tandem mass spectrometric protocols, including analysis of competitive collision-induced dissociation (CID) reactions and comparisons of CID spectra obtained from reference ions with known structures. 1,4-Reduction forming an enolate ion product is found to be the dominant or exclusive process with all three substrates, i.e. acrolein (70 ± 5%), methyl vinyl ketone (72 ± 5%) and cyclohex-2-enone (100%). Comparisons are made between these gas-phase results and the regioselectivity reported for analogous condensed-phase reactions. The observed behavior is discussed in terms of the reaction thermochemistry.
    Additional Material: 1 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/oms.1210281243
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 14
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene (1989)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 15
    facet.materialart.
    Unknown
    1,25-dihydroxyvitamin D3: a novel immunoregulatory hormone (1984)
    American Association for the Advancement of Science (AAAS)
    Details
    Publication Date: 1984-06-29
    Description: The hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], at picomolar concentrations, inhibited the growth-promoting lymphokine interleukin-2, which is produced by human T lymphocytes activated in vitro by the mitogen phytohemagglutinin. Other metabolites of vitamin D3 were less effective than 1,25(OH)2D3 in suppressing interleukin-2; their order of potency corresponded to their respective affinity for the 1,25(OH)2D3 receptor, suggesting that the effect on interleukin-2 was mediated by this specific receptor. The proliferation of mitogen-activated lymphocytes was also inhibited by 1,25(OH)2D3. This effect of the hormone became more pronounced at later stages of the culture. These findings demonstrate that 1,25(OH)2D3 is an immunoregulatory hormone.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tsoukas, C D -- Provvedini, D M -- Manolagas, S C -- AM29779/AM/NIADDK NIH HHS/ -- New York, N.Y. -- Science. 1984 Jun 29;224(4656):1438-40.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/6427926" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcitriol/*pharmacology ; Cell Division/drug effects ; Cell Line ; Humans ; Immunity, Cellular/*drug effects ; Interleukin-2/antagonists & inhibitors ; Lymphocyte Activation/drug effects ; Lymphocytes/drug effects ; Mice ; Monocytes/drug effects ; Receptors, Immunologic/drug effects ; Receptors, Interleukin-2
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Published by American Association for the Advancement of Science (AAAS)
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    PAPER CURRENT
  • 16
    Electronic Resource
    Electronic Resource
    1,3-dinitroso-, 1-nitroso-3-nitro-, and 1,3-dinitro-1,3-diazacycloalkanes. A multinuclear NMR studySee Ref. 1. (1988)
    Chichester : Wiley-Blackwell
    Organic Magnetic Resonance 26 (1988), S. 95-103 
    Details
    ISSN: 0749-1581
    Keywords: 1,3-Dinitroso-1,3-diazacycloalkanes ; 1-Nitroso-3-nitro-1,3-diazacycloalkanes ; 1,3-Dinitro-1,3-diazacycloalkanes ; Multinuclea gHNMR ; Rotamer populations ; Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: A series of five-, six-, and seven-membered 1,3-dinitroso-, 1-nitroso-3-nitro-, and 1,3-dinitro-1,3-diazacycloalkanes were investigated by 1H, 13C, and 15N NMR spectroscopy. Hindered rotation of the nitrosamine group leads to the existence of rotational isomers. The relative populations of rotamer forms are determined by steric and electrostatic interactions between nitroso groups and the remainder of the molecule, and by the size of the ring.
    Additional Material: 3 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/mrc.1260260202
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 17
    Electronic Resource
    Electronic Resource
    1,3-Dioxolanylium- und 1,3-Dioxanylium-Derivate via Protonenkatalysierte SNi-Reaktionen in der GasphaseHerrn Professor Dr. Hans-Werner Wanzlick zum 60. Geburtstag gewidmet. (1978)
    Chichester : Wiley-Blackwell
    Biological Mass Spectrometry 13 (1978), S. 618-628 
    Details
    ISSN: 0030-493X
    Keywords: Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Description / Table of Contents: By means of chemical ionization 1,3-dioxolanylium as well as 1,3-dioxanylium ions are formed in proton catalysed SNi assisted heterolysis in the gas phase. The effects of both constitution and configuration are discussed and compared with the results of analogous reactions in the condensed phase. It is shown that the unimolecular decompositions of [MH]+ ions containing two vicinal substituents, e.g. Br or OAc, are not governed by the proton affinity of the departing neutrals HBr or HOAc, respectively. The findings partially contradict the results on HX loss (X: substituent) from protonated monosubstituted compounds.
    Notes: 1,3-Dioxolanylium- und 1,3-Dioxanylium-Ionen sind in der Gasphase durch protonenkatalysierte, SNi-assistierte Heterolysen unter den Bedingungen der Chemischen Ionisation zugänglich. Konstitutionelle und konfigurative Effekte werden diskutiert und mit den Ergebnissen der Heterolyse in kondensierter Phase verglichen. Es wird ferner gezeigt, daß die unimolekulare Eliminierung von HX (X = Br, OAc) aus vicinal disubstituierten [MH]+-Ionen nicht durch die Protonenaffinität der eliminierten Neutralteile bestimmt wird, so wie es bei monofunktionellen Verbindungen der Fall ist.
    Additional Material: 10 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/oms.1210131103
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 18
    Electronic Resource
    Electronic Resource
    1,3-Dipolar character of 6-membered aromatic rings. XXIVFor Part XXIII, see Ref. 1. - mass spectrometry of 1-aryl-3-oxidopyridinium (1976)
    Chichester : Wiley-Blackwell
    Biological Mass Spectrometry 11 (1976), S. 814-820 
    Details
    ISSN: 0030-493X
    Keywords: Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Notes: Evaporation of 1-aryl-3-oxidopyridiniums is sometimes accompanied by rearrangement to 3-aryloxypyridine, but not to valence bond tautomers of the starting products. The fragmentation patterns are elucidated by metastable peaks and precise mass measurements and discussed.
    Additional Material: 1 Tab.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/oms.1210110804
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 19
    Electronic Resource
    Electronic Resource
    1,4 elimination of C6H6 in the mass spectral fragmentation of 1-phenyltetralin (1971)
    Chichester : Wiley-Blackwell
    Biological Mass Spectrometry 5 (1971), S. 99-101 
    Details
    ISSN: 0030-493X
    Keywords: Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/oms.1210050114
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 20
    Electronic Resource
    Electronic Resource
    1,4-elimination of arenes in mass spectra (1971)
    Chichester : Wiley-Blackwell
    Biological Mass Spectrometry 5 (1971), S. 1227-1228 
    Details
    ISSN: 0030-493X
    Keywords: Chemistry ; Analytical Chemistry and Spectroscopy
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Chemistry and Pharmacology
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/oms.1210051012
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...