ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Chemical Engineering  (3,542)
  • Humans  (1,943)
  • 1985-1989  (5,485)
Collection
Years
Year
  • 1
    Publication Date: 1989-12-22
    Description: Certain inflammatory stimuli render cultured human vascular endothelial cells hyperadhesive for neutrophils. This state is transient and reversible, in part because activated endothelial cells secrete a leukocyte adhesion inhibitor (LAI). LAI was identified as endothelial interleukin-8 (IL-8), the predominant species of which is an extended amino-terminal IL-8 variant. At nanomolar concentrations, purified endothelial IL-8 and recombinant human IL-8 inhibit neutrophil adhesion to cytokine-activated endothelial monolayers and protect these monolayers from neutrophil-mediated damage. These findings suggest that endothelial-derived IL-8 may function to attenuate inflammatory events at the interface between vessel wall and blood.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gimbrone, M A Jr -- Obin, M S -- Brock, A F -- Luis, E A -- Hass, P E -- Hebert, C A -- Yip, Y K -- Leung, D W -- Lowe, D G -- Kohr, W J -- P01-HL-36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1601-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688092" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Biological Factors/pharmacology ; Cell Adhesion/drug effects ; Cells, Cultured ; Chemotactic Factors/*isolation & purification/pharmacology ; Culture Media/analysis ; Cytokines ; Endothelium, Vascular/cytology/drug effects/*physiology ; Humans ; Interleukin-1/*pharmacology ; Interleukin-8 ; Interleukins/*isolation & purification/pharmacology ; Molecular Sequence Data ; Neutrophils/cytology/drug effects/*physiology ; Recombinant Proteins/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    Publication Date: 1989-12-22
    Description: A human acute lymphoblastic leukemia (ALL) cell line that was transplanted into immune-deficient SCID mice proliferated in the hematopoietic tissues, invaded various organs, and led to the death of the mice. The distribution of leukemic cells in SCID mice was similar to the course of the disease in children. A-1 cells marked with a retrovirus vector showed clonal evolution after the transplant. SCID mice that were injected with bone marrow from three patients with non-T ALL had leukemic cells in their bone marrow and spleen. This in vivo model of human leukemia is an approach to understanding leukemic growth and progression and is a novel system for testing new treatment strategies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kamel-Reid, S -- Letarte, M -- Sirard, C -- Doedens, M -- Grunberger, T -- Fulop, G -- Freedman, M H -- Phillips, R A -- Dick, J E -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1597-600.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595371" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/pathology ; Cell Line ; Clone Cells ; DNA, Neoplasm/isolation & purification ; Humans ; Immunologic Deficiency Syndromes/*pathology ; Kidney/pathology ; Liver/pathology ; Mice ; Mice, Mutant Strains ; Neoplasm Transplantation ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/*pathology ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    Publication Date: 1989-12-22
    Description: CD16 is a low-affinity immunoglobulin G (IgG) Fc receptor that is expressed on natural killer (NK) cells, granulocytes, activated macrophages, and some T lymphocytes. Two similar genes, CD16-I and CD16-II, encode membrane glycoproteins that are anchored by phosphatidylinositol (PI)-glycan and transmembrane polypeptides, respectively. The primary structural requirements for PI-linkage were examined by constructing a series of hybrid cDNA molecules. Although both cDNA's have an identical COOH-terminal hydrophobic segment, CD16-I has Ser203 whereas CD16-II has Phe203. Conversion of Phe to Ser in CD16-II permits expression of a PI-glycan-anchored glycoprotein, whereas conversion of Ser to Phe in CD16-I prevents PI-glycan linkage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lanier, L L -- Cwirla, S -- Yu, G -- Testi, R -- Phillips, J H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Becton Dickinson Monoclonal Center, Inc., Mountain View, CA 94043.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531919" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/*genetics ; Antigens, Differentiation/*genetics/metabolism ; Base Sequence ; Cell Line ; Cell Membrane/immunology ; Codon/genetics ; *Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; *Phenylalanine ; Receptors, Fc/*genetics/metabolism ; Receptors, IgG ; *Serine ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1561.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595369" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies/genetics ; B-Lymphocytes/immunology ; DNA Nucleotidyltransferases/genetics/metabolism ; Genes ; *Genes, Immunoglobulin ; Humans ; Receptors, Antigen, T-Cell/*genetics ; T-Lymphocytes/immunology ; VDJ Recombinases
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Guyer, R L -- Koshland, D E Jr -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1543-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688087" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Induced ; Cystic Fibrosis/genetics ; DNA/*genetics ; DNA-Directed DNA Polymerase ; Female ; *Genetic Techniques ; Humans ; Microscopy, Electron, Scanning ; Mifepristone ; Nucleic Acid Amplification Techniques ; Pregnancy ; Research/*trends
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1559-60.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595368" target="_blank"〉PubMed〈/a〉
    Keywords: *ADP Ribose Transferases ; Acquired Immunodeficiency Syndrome/immunology/*therapy ; Antigens, CD4/immunology ; *Bacterial Toxins ; Drug Design ; Exotoxins/*therapeutic use ; Humans ; Immunoglobulin G ; Immunotoxins/*therapeutic use ; *Virulence Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1560.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556794" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*epidemiology/prevention & ; control/transmission ; Centers for Disease Control and Prevention (U.S.) ; Humans ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powell, D -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1555-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595367" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*prevention & control ; *Biotechnology ; Canada ; Drug Evaluation ; Humans ; Public Relations ; Viral Vaccines/adverse effects/therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    Publication Date: 1989-12-22
    Description: T cell clones obtained from a human volunteer immunized with Plasmodium falciparum sporozoites specifically recognized the native circumsporozoite (CS) antigen expressed on P. falciparum sporozoites, as well as bacteria- and yeast-derived recombinant falciparum CS proteins. The response of these CD4+ CD8- cells was species-specific, since the clones did not proliferate or secrete gamma interferon when challenged with sporozoites or recombinant CS proteins of other human, simian, or rodent malarias. The epitope recognized by the sporozoite-specific human T cell clones mapped to the 5' repeat region of the CS protein and was contained in the NANPNVDPNANP sequence.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nardin, E H -- Herrington, D A -- Davis, J -- Levine, M -- Stuber, D -- Takacs, B -- Caspers, P -- Barr, P -- Altszuler, R -- Clavijo, P -- AI25085/AI/NIAID NIH HHS/ -- AI62533/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1603-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical and Molecular Parasitology, New York University, NY 10010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, CD4/*immunology ; Antigens, Protozoan/*immunology ; Cells, Cultured ; Clone Cells ; Epitopes/*analysis ; Humans ; Interferon-gamma/biosynthesis ; Lymphocyte Activation ; Malaria/*immunology ; Molecular Sequence Data ; Plasmodium falciparum/*immunology ; *Protozoan Proteins ; Recombinant Proteins/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Norman, C -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1556-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688090" target="_blank"〉PubMed〈/a〉
    Keywords: DNA/blood/*genetics/isolation & purification ; *Forensic Medicine ; Genetic Techniques ; Humans ; Maine ; Nucleotide Mapping/methods
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    Publication Date: 1989-12-22
    Description: Granulocyte and natural killer (NK) cell Fc receptors for immunoglobulin G (CD16) differ in only a few amino acids, yet have phosphatidylinositol glycan (PIG) or polypeptide membrane anchors, respectively. Mutagenesis shows that anchoring is regulated by a serine residue near the PIG anchor attachment site in the extracellular domain. The NK cell isoform was not expressed on the surface of COS cells unless cotransfected with a subunit that was expressed in NK cells and that was identical to the gamma subunit of the high affinity IgE Fc receptor (Fc epsilon RI). However, the CD16 sequence and not expression of the gamma subunit is dominant in regulating PIG reanchoring.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hibbs, M L -- Selvaraj, P -- Carpen, O -- Springer, T A -- Kuster, H -- Jouvin, M H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531918" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/genetics ; Antigens, Differentiation/*genetics ; Cell Line ; Cell Membrane/immunology ; Flow Cytometry ; *Gene Expression Regulation ; Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Immunoglobulin G ; Killer Cells, Natural/immunology ; L Cells (Cell Line)/immunology ; Mice ; Mutation ; RNA, Messenger/genetics/isolation & purification ; Receptors, Fc/*genetics ; Receptors, IgG ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hiesel, R -- Wissinger, B -- Schuster, W -- Brennicke, A -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1632-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut fur Genbiologische Forschung, Berlin, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480644" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Base Sequence ; Cloning, Molecular ; DNA, Mitochondrial/genetics ; Electron Transport Complex IV/*genetics ; *Genes, Plant ; Humans ; Mitochondria/*enzymology ; Molecular Sequence Data ; Plants/enzymology/*genetics ; RNA/*genetics ; RNA Processing, Post-Transcriptional ; RNA, Messenger/genetics ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    Publication Date: 1989-12-22
    Description: The purified human immunodeficiency virus type-l (HIV-l) Tat protein inhibited lymphocyte proliferation induced by tetanus toxoid or Candida antigens by 66 to 97% at nanomolar concentrations of Tat. In contrast, Tat did not cause a significant reduction of lymphocyte proliferation in response to mitogens such as phytohemagglutinin or pokeweed mitogen. Inhibition was blocked by oxidation of the cysteine-rich region of Tat or by incubation with an antibody to Tat before the assay. A synthetic Tat peptide (residues 1 to 58) also inhibited antigen-stimulated proliferation. Experiments with H9 and U937 cell lines showed that Tat can easily enter both lymphocytes and monocytes. The specific inhibition of antigen-induced lymphocyte proliferation by Tat mimics the effect seen with lymphocytes from HIV-infected individuals and suggests that Tat might directly contribute to the immunosuppression associated with HIV infection.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Viscidi, R P -- Mayur, K -- Lederman, H M -- Frankel, A D -- AI29135/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1606-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, Johns Hopkins University School of Medicine, Baltimore, MD 21205.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556795" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/immunology ; Cells, Cultured ; Concanavalin A ; DNA Replication/drug effects ; Gene Products, tat/immunology/*pharmacology ; HIV-1/genetics/*immunology ; HeLa Cells/metabolism ; Humans ; Immunosuppression ; Lymphocyte Activation/*drug effects ; Lymphocytes/drug effects/immunology ; Pokeweed Mitogens ; Promoter Regions, Genetic ; Recombinant Proteins/immunology/pharmacology ; Staphylococcal Protein A ; Trans-Activators/*pharmacology ; Transcriptional Activation ; tat Gene Products, Human Immunodeficiency Virus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Smith, R -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1547.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688088" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; Antiviral Agents/*therapeutic use ; Clinical Trials as Topic ; Humans ; Research Design
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cherfas, J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1554-5.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595366" target="_blank"〉PubMed〈/a〉
    Keywords: Beginning of Human Life ; *Embryo Research ; *Embryo, Mammalian ; Female ; *Fertilization in Vitro ; Genetic Diseases, Inborn ; *Government Regulation ; Great Britain ; Humans ; Life ; *Politics ; Pregnancy ; *Research
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    Publication Date: 1989-12-22
    Description: One action of cyclosporin A thought to be central to many of its immunosuppressive effects is its ability to inhibit the early events of T lymphocyte activation such as lymphokine gene transcription in response to signals initiated at the antigen receptor. Cyclosporin A was found to specifically inhibit the appearance of DNA binding activity of NF-AT, AP-3, and to a lesser extent NF-kappa B, nuclear proteins that appear to be important in the transcriptional activation of the genes for interleukin-2 and its receptor, as well as several other lymphokines. In addition, cyclosporin A abolished the ability of the NF-AT binding site to activate a linked promoter in transfected mitogen-stimulated T lymphocytes and in lymphocytes from transgenic mice. These results indicate that cyclosporin A either directly inhibits the function of nuclear proteins critical to T lymphocyte activation or inhibits the action of a more proximal member of the signal transmission cascade leading from the antigen receptor to the nucleus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Emmel, E A -- Verweij, C L -- Durand, D B -- Higgins, K M -- Lacy, E -- Crabtree, G R -- CA 39612/CA/NCI NIH HHS/ -- HL 33942/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1617-20.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Stanford University, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595372" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Cell Line ; Chromosome Deletion ; Cyclosporins/*pharmacology ; Enhancer Elements, Genetic ; Gene Expression Regulation/*drug effects ; Genes/drug effects ; Humans ; Interleukin-2/genetics ; Lymphocyte Activation/*drug effects ; Molecular Sequence Data ; Mutation ; Nuclear Proteins/*antagonists & inhibitors ; Oligonucleotide Probes ; Receptors, Interleukin-2/genetics ; Repetitive Sequences, Nucleic Acid ; T-Lymphocytes/drug effects/*immunology ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    Publication Date: 1989-12-22
    Description: Stable lymphoid cell lines expressing the human immunodeficiency virus type 1 (HIV-1) nef gene product, p27, were established. The presence of p27 in the lymphoid cells suppressed replication of some strains of both HIV-1 and HIV-2. This observation indicates that nef could be important in the establishment of HIV latency. In contrast, fast replicating and highly cytopathic HIV-1 isolates recovered from patients with advanced disease states were not affected by the negative effect of nef present in these lymphoid cell lines. This lack of response to nef appears to constitute another viral feature that correlates with disease progression. Thus, manipulating expression of the nef gene in vivo might influence pathogenesis in the host.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cheng-Mayer, C -- Iannello, P -- Shaw, K -- Luciw, P A -- Levy, J A -- R01 AI-24499/AI/NIAID NIH HHS/ -- R01 AI-25284/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1629-32.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531920" target="_blank"〉PubMed〈/a〉
    Keywords: Antigens, CD3 ; Antigens, CD4/analysis/genetics ; Antigens, Differentiation, T-Lymphocyte/analysis/genetics ; Cell Line/immunology ; Gene Expression ; Gene Products, nef/*physiology ; Genes, nef ; HIV/genetics/pathogenicity/*physiology ; Humans ; Receptors, Antigen, T-Cell/analysis/genetics ; Viral Regulatory and Accessory Proteins/*physiology ; *Virus Replication ; nef Gene Products, Human Immunodeficiency Virus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: In the report "X-ray diffraction to 302 giga-pascals: High-pressure crystal structure of cesium iodide" by H. K. Mao et al. (3 Nov., p. 649), reference 10, to a paper by R. Reichlin et al. [Phys. Rev. Lett. 56, 2858 (1986)], was incorrectly numbered (9) in the text (p. 649, column 3, line 1; p. 650, column 1, line 49).〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hershfield, M -- Finkelberg, Z -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1375.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595358" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/*deficiency/*therapeutic use ; Humans ; Immunologic Deficiency Syndromes/drug therapy/*etiology ; Nucleoside Deaminases/*deficiency/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1386-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595361" target="_blank"〉PubMed〈/a〉
    Keywords: Breast Neoplasms/genetics ; Chromosome Deletion ; Colonic Neoplasms/genetics ; Humans ; Lung Neoplasms/genetics ; *Mutation ; Neoplasms/*genetics ; *Oncogenes ; Suppression, Genetic/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hoffman, M -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1387.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556793" target="_blank"〉PubMed〈/a〉
    Keywords: Child, Preschool ; *Chromosomes, Human, Pair 11 ; *Cloning, Molecular ; Humans ; Kidney/embryology ; Kidney Neoplasms/*genetics ; Suppression, Genetic/*genetics ; Wilms Tumor/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1376-81.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595359" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/transmission ; *Behavior ; Brain/drug effects/physiopathology ; *Cocaine/pharmacology ; Disease Outbreaks ; Dopamine/physiology ; Drug and Narcotic Control ; Humans ; Legislation, Drug ; Reward ; *Substance-Related Disorders/drug therapy/epidemiology/physiopathology/prevention ; & control ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: Tumor suppressor genes are wild-type alleles of genes that play regulatory roles in cell proliferation, differentiation, and other cellular and systemic processes. It is their loss or inactivation that is oncogenic. The first evidence of tumor suppressor genes appeared in the early 1970s, but only within the past few years has a wealth of new information illuminated the central importance of these genes. Two or more different suppressor genes may be inactivated in the same tumors, and the same suppressors may be inactive in different tumor types (for example, lung, breast, and colon). The suppressor genes already identified are involved in cell cycle control, signal transduction, angiogenesis, and development, indicating that they contribute to a broad array of normal and tumor-related functions. It is proposed that tumor suppressor genes provide a vast untapped resource for anticancer therapy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sager, R -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1406-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Cancer Genetics, Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2574499" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; Cell Differentiation ; Cell Division ; Cell Transformation, Neoplastic/genetics ; Chromosome Aberrations ; Cloning, Molecular ; Eye Neoplasms/genetics ; Heterozygote ; Humans ; Hybrid Cells ; Kidney Neoplasms/genetics ; Mutation ; Neoplasms/*genetics ; Oncogene Proteins/genetics ; Phosphoproteins/genetics ; Polymorphism, Restriction Fragment Length ; Retinoblastoma/genetics ; Suppression, Genetic/*genetics ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53 ; Wilms Tumor/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    Publication Date: 1989-12-08
    Description: Vascular permeability factor (VPF) is a 40-kilodalton disulfide-linked dimeric glycoprotein that is active in increasing blood vessel permeability, endothelial cell growth, and angiogenesis. These properties suggest that the expression of VPF by tumor cells could contribute to the increased neovascularization and vessel permeability that are associated with tumor vasculature. The cDNA sequence of VPF from human U937 cells was shown to code for a 189-amino acid polypeptide that is similar in structure to the B chain of platelet-derived growth factor (PDGF-B) and other PDGF-B-related proteins. The overall identity with PDGF-B is 18%. However, all eight of the cysteines in PDGF-B were found to be conserved in human VPF, an indication that the folding of the two proteins is probably similar. Clusters of basic amino acids in the COOH-terminal halves of human VPF and PDGF-B are also prevalent. Thus, VPF appears to be related to the PDGF/v-sis family of proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Keck, P J -- Hauser, S D -- Krivi, G -- Sanzo, K -- Warren, T -- Feder, J -- Connolly, D T -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1309-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture and Biochemistry, Monsanto Company, St. Louis, MO 63167.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479987" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Capillary Permeability/physiology ; Cell Division/physiology ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; *Growth Substances ; Guinea Pigs ; Humans ; Lymphokines/*physiology ; Molecular Sequence Data ; Neovascularization, Pathologic/physiopathology ; Oncogene Proteins v-sis ; Platelet-Derived Growth Factor/physiology ; Retroviridae Proteins, Oncogenic/physiology ; Sequence Homology, Nucleic Acid ; Transforming Growth Factors ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    Publication Date: 1989-12-08
    Description: Vascular endothelial growth factor (VEGF) was purified from media conditioned by bovine pituitary folliculostellate cells (FC). VEGF is a heparin-binding growth factor specific for vascular endothelial cells that is able to induce angiogenesis in vivo. Complementary DNA clones for bovine and human VEGF were isolated from cDNA libraries prepared from FC and HL60 leukemia cells, respectively. These cDNAs encode hydrophilic proteins with sequences related to those of the A and B chains of platelet-derived growth factor. DNA sequencing suggests the existence of several molecular species of VEGF. VEGFs are secreted proteins, in contrast to other endothelial cell mitogens such as acidic or basic fibroblast growth factors and platelet-derived endothelial cell growth factor. Human 293 cells transfected with an expression vector containing a bovine or human VEGF cDNA insert secrete an endothelial cell mitogen that behaves like native VEGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Leung, D W -- Cachianes, G -- Kuang, W J -- Goeddel, D V -- Ferrara, N -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1306-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Genetech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479986" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cattle ; Cell Division ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; Gene Library ; Humans ; Lymphokines/genetics/*physiology/secretion ; Molecular Sequence Data ; Neovascularization, Pathologic/*physiopathology ; Sequence Homology, Nucleic Acid ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    Publication Date: 1989-12-08
    Description: The fragile X syndrome is the most common cause of familial mental retardation. Genetic counseling and gene isolation are hampered by a lack of DNA markers close to the disease locus. Two somatic cell hybrids that each contain a human X chromosome with a breakpoint close to the fragile X locus have been characterized. A new DNA marker (DXS296) lies between the chromosome breakpoints and is the closest marker to the fragile X locus yet reported. The Hunter syndrome gene, which causes iduronate sulfatase deficiency, is located at the X chromosome breakpoint that is distal to this new marker, thus localizing the Hunter gene distal to the fragile X locus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Suthers, G K -- Callen, D F -- Hyland, V J -- Kozman, H M -- Baker, E -- Eyre, H -- Harper, P S -- Roberts, S H -- Hors-Cayla, M C -- Davies, K E -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1298-300.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Histopathology, Adelaide Children's Hospital, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573953" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chromosome Mapping ; Female ; Fragile X Syndrome/*genetics ; Genetic Counseling ; *Genetic Linkage ; *Genetic Markers ; Genomic Library ; Humans ; Hybrid Cells ; Likelihood Functions ; Mice ; Mucopolysaccharidosis II/genetics ; Mutation ; Nucleic Acid Hybridization ; Polymorphism, Restriction Fragment Length ; Sex Chromosome Aberrations/*genetics ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1244.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511632" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; *Clinical Trials as Topic ; Didanosine/*therapeutic use ; Humans
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: Hematogenous metastasis requires the arrest and extravasation of blood-borne tumor cells, possibly involving direct adhesive interactions with vascular endothelium. Cytokine activation of cultured human endothelium increases adhesion of melanoma and carcinoma cell lines. An inducible 110-kD endothelial cell surface glycoprotein, designated INCAM-110, appears to mediate adhesion of melanoma cells. In addition, an inducible endothelial receptor for neutrophils, ELAM-1, supports the adhesion of a human colon carcinoma cell line. Thus, activation of vascular endothelium in vivo that results in increased expression of INCAM-110 and ELAM-1 may promote tumor cell adhesion and affect the incidence and distribution of metastases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rice, G E -- Bevilacqua, M P -- HL 07727/HL/NHLBI NIH HHS/ -- P01 HL36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1303-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588007" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Cell Adhesion/physiology ; Cell Adhesion Molecules/analysis/*physiology ; Colonic Neoplasms/pathology ; Endothelium, Vascular/analysis/*cytology/physiology ; Humans ; Melanoma/*pathology ; Melanoma, Experimental/pathology ; Molecular Weight ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1245-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479984" target="_blank"〉PubMed〈/a〉
    Keywords: Americas/epidemiology ; Disease Outbreaks/*history ; History, 15th Century ; History, 16th Century ; History, 17th Century ; Humans ; Indians, North American/*history ; Indians, South American/*history ; Population
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    Publication Date: 1989-12-08
    Description: The human retinoblastoma gene (RB1) encodes a protein (Rb) of 105 kilodaltons that can be phosphorylated. Analysis of Rb metabolism has shown that the protein has a half-life of more than 10 hours and is synthesized at all phases of the cell cycle. Newly synthesized Rb is not extensively phosphorylated (it is "underphosphorylated") in cells in the G0 and G1 phases but is phosphorylated at multiple sites at the G1/S boundary and in S phase. HL-60 cells that were induced to terminally differentiate by various chemicals lost their ability to phosphorylate newly synthesized Rb at multiple sites when cell growth was arrested. These findings suggest that underphosphorylated Rb may restrict cell proliferation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mihara, K -- Cao, X R -- Yen, A -- Chandler, S -- Driscoll, B -- Murphree, A L -- T'Ang, A -- Fung, Y K -- 5P30CA14089/CA/NCI NIH HHS/ -- CA 44754/CA/NCI NIH HHS/ -- EY 07846/EY/NEI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1300-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Hematology/Oncology and Ophthalmology, Childrens Hospital of Los Angeles, CA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588006" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Cycle/*genetics ; Cell Division/drug effects/genetics ; Eye Neoplasms/genetics ; *Gene Expression Regulation, Neoplastic ; Humans ; Interphase/genetics ; Neoplasm Proteins/genetics/*metabolism ; Phosphorylation ; Protein Processing, Post-Translational/drug effects/*genetics ; Retinoblastoma/*genetics ; Tretinoin/pharmacology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1250-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588004" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal/*biosynthesis/genetics ; Cloning, Molecular/methods ; Humans ; Recombinant Proteins/biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Siekevitz, P -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1236.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588001" target="_blank"〉PubMed〈/a〉
    Keywords: Drug Industry/*economics ; Human Genome Project/*economics ; Humans ; Japan ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Weinstein, N D -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1232-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cook College, Rutgers University, New Brunswick, New Jersey 08903.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686031" target="_blank"〉PubMed〈/a〉
    Keywords: *Attitude to Health ; Humans ; *Risk Factors ; *Self Concept
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Blower, S -- Hartel, D -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1236.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588002" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/epidemiology ; Epidemiologic Methods ; Humans ; New York City/epidemiology ; Substance Abuse, Intravenous/*epidemiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cherfas, J -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1242-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511631" target="_blank"〉PubMed〈/a〉
    Keywords: Administration, Cutaneous ; Animals ; Developing Countries ; Haplorhini ; Humans ; Mice ; Military Personnel ; Niclosamide/*administration & dosage ; Schistosomiasis/*prevention & control
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bolognesi, D P -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1233-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Surgery, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555922" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*prevention & control ; Animals ; HIV/*immunology ; Humans ; Infectious Anemia Virus, Equine/immunology ; Simian Immunodeficiency Virus/immunology ; *Viral Vaccines
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    Publication Date: 1989-12-01
    Description: Human immunodeficiency virus (HIV) isolates with reduced sensitivity to zidovudine (3'-azido-3'-deoxythymidine, AZT) from individuals with acquired immunodeficiency syndrome (AIDS) or AIDS-related complex were studied to determine the genetic basis of their resistance. Most were sequential isolates obtained at the initiation of and during therapy. Comparative nucleotide sequence analysis of the reverse transcriptase (RT) coding region from five pairs of sensitive and resistant isolates identified three predicted amino acid substitutions common to all the resistant strains (Asp67----Asn, Lys70----Arg, Thr215----Phe or Tyr) plus a fourth in three isolates (Lys219----Gln). Partially resistant isolates had combinations of these four changes. An infectious molecular clone constructed with these four mutations in RT yielded highly resistant HIV after transfection of T cells. The reproducible nature of these mutations should make it possible to develop rapid assays to predict zidovudine resistance by performing polymerase chain reaction amplification of nucleic acid from peripheral blood lymphocytes, thereby circumventing current lengthy HIV isolation and sensitivity testing.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Larder, B A -- Kemp, S D -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1155-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Sciences Department, Wellcome Research Laboratories, Beckenham, Kent, United Kingdom.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479983" target="_blank"〉PubMed〈/a〉
    Keywords: AIDS-Related Complex/drug therapy/microbiology ; Acquired Immunodeficiency Syndrome/drug therapy/*microbiology ; Amino Acid Sequence ; Cloning, Molecular ; Drug Resistance/genetics ; Genes, Viral ; HIV-1/drug effects/*enzymology/genetics ; Humans ; Molecular Sequence Data ; *Mutation ; RNA-Directed DNA Polymerase/*genetics ; Zidovudine/pharmacology/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    Publication Date: 1989-12-01
    Description: Diphtheria toxin (DTx) provokes extensive internucleosomal degradation of DNA before cell lysis. The possibility that DNA cleavage stems from direct chromosomal attack by intracellular toxin molecules was tested by in vitro assays for a DTx-associated nuclease activity. DTx incubated with DNA in solution or in a DNA-gel assay showed Ca2+- and Mg2+-stimulated nuclease activity. This activity proved susceptible to inhibition by specific antitoxin and migrated with fragment A of the toxin. Assays in which supercoiled double-stranded DNA was used revealed rapid endonucleolytic attack. Discovery of a DTx-associated nuclease activity lends support to the model that DTx-induced cell lysis is not a simple consequence of protein synthesis inhibition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chang, M P -- Baldwin, R L -- Bruce, C -- Wisnieski, B J -- 2 T32 HL07386/HL/NHLBI NIH HHS/ -- CA-09056/CA/NCI NIH HHS/ -- GM22240/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1165-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology, University of California, Los Angeles 90024.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531465" target="_blank"〉PubMed〈/a〉
    Keywords: Bacteriophage lambda/genetics ; Calcium/pharmacology ; Cell Line ; DNA/*metabolism ; DNA, Superhelical/metabolism ; DNA, Viral/metabolism ; Deoxyribonucleases/antagonists & inhibitors/*metabolism ; Diphtheria Toxin/*metabolism ; Electrophoresis, Polyacrylamide Gel ; Humans ; Magnesium/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koshland, D E Jr -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):981.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587989" target="_blank"〉PubMed〈/a〉
    Keywords: Abortion, Legal ; Female ; Humans ; National Institutes of Health (U.S.)/*organization & administration ; Politics ; Pregnancy ; United States ; United States Dept. of Health and Human Services
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: Parasitic protozoans and helminths pose considerable medical as well as scientific challenges. Investigations of the complex and very different life cycles of these organisms, their adaptation to the obligate parasitic mode of life, and their ability to face the hostile host environment have resulted in many exciting discoveries. Invasion of host erythrocytes by plasmodial sporozoites and intact skin by schistosomal cercariae are outlined as examples of the elaborate mechanisms of parasitism. Isolation and characterization of single protective antigens or subunit vaccines from these two organisms are examined as models for vaccine development. Finally, developments in exploring gene regulation in protozoans and free and parasitic nematodes are briefly outlined.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mahmoud, A A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1015-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Case Western Reserve University School of Medicine, Cleveland, OH 44106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686024" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Eukaryota/genetics/pathogenicity/*physiology ; Gene Expression Regulation ; Helminthiasis/*immunology ; Helminths/genetics/pathogenicity/*physiology ; Humans ; Molecular Sequence Data ; Protozoan Infections/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roth, E Jr -- Kaul, D K -- Nagel, R L -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1051.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686026" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Adhesion ; Erythrocytes/cytology/*parasitology ; Humans ; Malaria/*blood ; Plasmodium falciparum/pathogenicity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    Publication Date: 1989-11-24
    Description: Drug development is needed to improve chemotherapy of patients with locally advanced or metastatic colon carcinoma, who otherwise have an unfavorable prognosis. DNA topoisomerase I, a nuclear enzyme important for solving topological problems arising during DNA replication and for other cellular functions, has been identified as a principal target of a plant alkaloid 20(S)-camptothecin. Significantly increased concentrations of this enzyme, compared to that in normal colonic mucosa, were found in advanced stages of human colon adenocarcinoma and in xenografts of colon cancer carried by immunodeficient mice. Several synthetic analogs of camptothecin, selected by tests with the purified enzyme and tissue-culture screens, were evaluated in the xenograft model. Unlike other anticancer drugs tested, 20(RS)-9-amino-camptothecin (9-AC) induced disease-free remissions. The overall drug toxicity was low and allowed for repeated courses of treatment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Giovanella, B C -- Stehlin, J S -- Wall, M E -- Wani, M C -- Nicholas, A W -- Liu, L F -- Silber, R -- Potmesil, M -- CA-11655/CA/NCI NIH HHS/ -- CA-16087/CA/NCI NIH HHS/ -- CA-349636/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1046-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Stehlin Foundation for Cancer Research, St. Joseph Hospital, Houston, TX 77002.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555920" target="_blank"〉PubMed〈/a〉
    Keywords: Adenocarcinoma/analysis/*drug therapy/enzymology ; Animals ; Antineoplastic Agents/*therapeutic use ; Biomarkers, Tumor/analysis ; Camptothecin/*analogs & derivatives/*therapeutic use/toxicity ; Colonic Neoplasms/analysis/*drug therapy/enzymology ; DNA Topoisomerases, Type I/analysis ; DNA, Neoplasm/analysis ; Drug Design ; Humans ; Intestinal Mucosa/enzymology ; Mice ; Mice, Inbred Strains ; Neoplasm Transplantation ; *Topoisomerase I Inhibitors ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hagiwara, G -- Krouse, M -- Muller, U -- Wine, J -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1049-50.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479979" target="_blank"〉PubMed〈/a〉
    Keywords: Chloride Channels ; Chlorides ; Cystic Fibrosis/*physiopathology ; Humans ; Ion Channels/*physiology ; Lymphocytes/*physiology ; Membrane Potentials ; Membrane Proteins/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parham, P -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1050-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686025" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Asparagine ; Humans ; Rabbits ; Sequence Homology, Nucleic Acid ; Serum Amyloid A Protein/*genetics ; Tryptophan ; Tyrosine ; beta 2-Microglobulin/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):878-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814507" target="_blank"〉PubMed〈/a〉
    Keywords: Alcoholism/*prevention & control/rehabilitation ; Humans ; International Cooperation ; Ussr ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):882.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814511" target="_blank"〉PubMed〈/a〉
    Keywords: Humans ; Personnel Staffing and Scheduling ; United States ; *United States Dept. of Health and Human Services ; *United States Food and Drug Administration
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pavlakis, S G -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):874.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814504" target="_blank"〉PubMed〈/a〉
    Keywords: Epilepsy/*therapy ; Humans ; Magnetics ; Periodicals as Topic/standards ; Publishing
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: The goals of providing coverage for everyone in the United States and controlling the growth in national health expenditures require difficult decisions about what medical services to provide. Currently accepted practices vary enormously in the amount of health they produce for a given expenditure. Studies of the health effects of several major interventions in relation to their costs--Pap smears, mammography, coronary care units, bypass surgery, and cholesterol reduction--indicate the kinds of choices to be made.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Russell, L B -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):892-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Health Care Policy, and Aging Research, Rutgers University, New Brunswick, NJ 08903.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510299" target="_blank"〉PubMed〈/a〉
    Keywords: Cost-Benefit Analysis ; Costs and Cost Analysis ; Humans ; *National Health Insurance, United States/economics ; *Resource Allocation ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parrish, J A -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):874.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814505" target="_blank"〉PubMed〈/a〉
    Keywords: Hospitals ; Humans ; Japan ; Massachusetts ; *Research ; *Skin ; Universities
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: Lipoprotein(a) [Lp(a)] is a macromolecular complex found in human plasma that combines structural elements from the lipoprotein and blood clotting systems and that is associated with premature coronary heart disease and stroke. It is assembled from low-density lipoprotein (LDL) and a large hydrophilic glycoprotein called apolipoprotein(a) [apo(a)], which is homologous to the protease zymogen plasminogen. Plasma Lp(a) concentrations vary 1000-fold between individuals and represent a continuous quantitative genetic trait with a skewed distribution in Caucasian populations. Variation in the hypervariable apo(a) gene on chromosome 6q2.6-q2.7 and interaction of apo(a) alleles with defective LDL-receptor genes explain a large fraction of the variability of plasma Lp(a) concentrations. Though of high theoretical and practical interest, many aspects of the metabolism, function, evolution, and regulation of plasma concentrations of Lp(a) are presently unknown, controversial, or mysterious.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Utermann, G -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):904-10.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute for Medical Biology and Genetics, University of Innsbruck, Austria.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2530631" target="_blank"〉PubMed〈/a〉
    Keywords: Arteriosclerosis/etiology ; Genes ; Genetic Linkage ; Humans ; Hypercholesterolemia/blood ; Lipoprotein(a) ; *Lipoproteins/genetics/metabolism ; Plasminogen/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cherfas, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):882.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683087" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; Clinical Trials as Topic ; Humans ; Internationality ; National Institutes of Health (U.S.) ; *Risk Assessment ; *Therapeutic Human Experimentation ; United States ; Zidovudine/adverse effects/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Crease, R P -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):883-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479100" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; England ; Gramicidin/*history ; History, 20th Century ; Humans ; Microbiology/history ; Penicillins/*history ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉New York, N.Y. -- Science. 1989 Nov 17;246(4932):873-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814503" target="_blank"〉PubMed〈/a〉
    Keywords: Biomedical Research ; Genetics, Medical ; *Human Genome Project/economics ; Humans ; Resource Allocation ; Risk Assessment ; Social Control, Formal ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barinaga, M -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):886-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814512" target="_blank"〉PubMed〈/a〉
    Keywords: Bipolar Disorder/epidemiology/*genetics ; *Chromosomes, Human, Pair 11 ; Ethnic Groups ; *Genes ; Humans ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):880.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814508" target="_blank"〉PubMed〈/a〉
    Keywords: Humans ; National Institutes of Health (U.S.)/*organization & administration ; Personnel Selection ; Politics ; United States ; United States Dept. of Health and Human Services
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: This article reviews some of the significant contributions of fetal research and fetal tissue research over the past 20 years. The benefits of fetal research include the development of vaccines, advances in prenatal diagnosis, detection of malformations, assessment of safe and effective medications, and the development of in utero surgical therapies. Fetal tissue research benefits vaccine development, assessment of risk factors and toxicity levels in drug production, development of cell lines, and provides a source of fetal cells for ongoing transplantation trials. Together, fetal research and fetal tissue research offer tremendous potential for the treatment of the fetus, neonate, and adult.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hansen, J T -- Sladek, J R Jr -- P01-NS24032/NS/NINDS NIH HHS/ -- P01-NS25778/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):775-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurobiology and Anatomy, University of Rochester School of Medicine and Dentistry, NY 14642.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683082" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Line ; Congenital Abnormalities/diagnosis ; Female ; *Fetal Diseases ; *Fetal Research ; *Fetus/cytology/surgery ; Genetic Diseases, Inborn ; Humans ; Nontherapeutic Human Experimentation ; Pregnancy ; Prenatal Diagnosis ; *Research ; *Risk Assessment ; Therapeutic Human Experimentation ; Vaccines
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: A method was developed for selectively isolating genes from localized regions of the human genome that are contained in interspecific hybrid cells. Complementary human DNA was prepared from a human-rodent somatic cell hybrid that contained less than 1% human DNA, by using consensus 5' intron splice sequences as primers. These primers would select immature, unspliced messenger RNA (still retaining species-specific repeat sequences) as templates. Screening a derived complementary DNA library for human repeat sequences resulted in the isolation of human clones at the anticipated frequency with characteristics expected of exons of transcribed human genes--single copy sequences that hybridized to discrete bands on Northern (RNA) blots.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Liu, P -- Legerski, R -- Siciliano, M J -- GM19436/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):813-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Genetics, University of Texas, M.D. Anderson Cancer Center, Houston 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479099" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Blotting, Southern ; Chromosome Mapping ; Chromosomes, Human, Pair 19 ; Cloning, Molecular ; Cricetinae ; DNA/biosynthesis/genetics/*isolation & purification ; Humans ; *Hybrid Cells ; Introns ; Nucleic Acid Hybridization ; RNA/genetics ; Repetitive Sequences, Nucleic Acid ; Restriction Mapping ; Templates, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hamburg, B A -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):738.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814491" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Child ; Child, Preschool ; Humans ; Infant ; *Mental Disorders ; *Research ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):752.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814496" target="_blank"〉PubMed〈/a〉
    Keywords: *Aborted Fetus ; *Abortion, Induced ; Federal Government ; *Fetal Research ; *Fetus ; Government Regulation ; Humans ; *Research Support as Topic ; Transplantation/*legislation & jurisprudence ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    Publication Date: 1989-11-10
    Description: Genomic sequencing permits studies of in vivo DNA methylation and protein-DNA interactions, but its use has been limited because of the complexity of the mammalian genome. A newly developed genomic sequencing procedure in which a ligation mediated polymerase chain reaction (PCR) is used generates high quality, reproducible sequence ladders starting with only 1 microgram of uncloned mammalian DNA per reaction. Different sequence ladders can be created simultaneously by inclusion of multiple primers and visualized separately by rehybridization. Relatively little radioactivity is needed for hybridization and exposure times are short. Methylation patterns in genomic DNA are readily detectable; for example, 17 CpG dinucleotides in the 5' region of human X-linked PGK-1 (phosphoglycerate kinase 1) were found to be methylated on an inactive human X chromosome, but unmethylated on an active X chromosome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pfeifer, G P -- Steigerwald, S D -- Mueller, P R -- Wold, B -- Riggs, A D -- AG08196/AG/NIA NIH HHS/ -- GM355262BW/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):810-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Biology Section, Beckman Research Institute of the City of Hope, Duarte, CA 91010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814502" target="_blank"〉PubMed〈/a〉
    Keywords: 5-Methylcytosine ; Animals ; Autoradiography ; Base Sequence ; Cytosine ; DNA/*genetics/metabolism ; Exons ; HeLa Cells ; Humans ; Methylation ; Molecular Sequence Data ; *Nucleic Acid Amplification Techniques ; *Nucleic Acid Hybridization ; Phosphoglycerate Kinase/genetics ; Polymerase Chain Reaction/*methods ; Promoter Regions, Genetic ; X Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wellcome Trust/United Kingdom -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):821-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683085" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Aged ; Base Sequence ; DNA, Viral/*analysis/genetics ; Gene Products, env/genetics ; Gene Products, gag/genetics ; Gene Products, pol/genetics ; HTLV-I Infections/*complications ; Human T-lymphotropic virus 1/genetics/*isolation & purification ; Humans ; Middle Aged ; Molecular Sequence Data ; Multiple Sclerosis/complications/*microbiology ; Polymerase Chain Reaction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):751.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814495" target="_blank"〉PubMed〈/a〉
    Keywords: Adenosine Deaminase/*deficiency ; *Genetic Therapy ; Humans ; Nucleoside Deaminases
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):748.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683081" target="_blank"〉PubMed〈/a〉
    Keywords: Genetic Therapy/history ; History, 20th Century ; Humans ; Molecular Biology/history ; National Institutes of Health (U.S.) ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):747-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2633774" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/therapy ; Animals ; Antigens, CD4/administration & dosage ; *Biocompatible Materials ; Drug Implants ; Genetic Therapy/*methods ; Humans ; *Organoids ; *Prostheses and Implants
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):750-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814494" target="_blank"〉PubMed〈/a〉
    Keywords: Aerosols ; Emphysema/*prevention & control ; *Genetic Therapy ; Humans ; alpha 1-Antitrypsin/*therapeutic use ; alpha 1-Antitrypsin Deficiency
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):749.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814493" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Dogs ; Endothelium/*cytology ; Genetic Therapy/*methods ; Humans ; Swine ; Swine, Miniature
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):746.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814492" target="_blank"〉PubMed〈/a〉
    Keywords: Endothelium/*cytology ; Genetic Therapy/*methods ; *Genetic Vectors ; Humans ; Lymphocytes/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: An important control point in gene expression is at the level of messenger RNA (mRNA) stability. The mRNAs of certain regulatory cellular proteins such as oncogenes, cytokines, lymphokines, and transcriptional activators are extremely labile. These messages share a common AUUUA pentamer in their 3' untranslated region, which confers cytoplasmic instability. A cytosolic protein was identified that binds specifically to RNA molecules containing four reiterations of the AUUUA structural element. This protein consists of three subunits and binds rapidly to AUUUA-containing RNA. Such protein-RNA complexes are resistant to the actions of denaturing and reducing agents, demonstrating very stable binding. The time course, stability, and specificity of the protein-AUUUA interaction suggests the possibility that the formation of this complex may target susceptible mRNA for rapid cytoplasmic degradation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Malter, J S -- CA01427-01/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):664-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Tulane University School of Medicine, New Orleans, LA 70112.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814487" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Binding, Competitive ; Carrier Proteins/isolation & purification/*metabolism ; Cell Line ; Humans ; Kinetics ; Macromolecular Substances ; Molecular Weight ; *Nucleocytoplasmic Transport Proteins ; RNA, Messenger/*metabolism ; *RNA-Binding Proteins ; Ribonuclease, Pancreatic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Waldrop, M M -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):572-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814483" target="_blank"〉PubMed〈/a〉
    Keywords: *Computers ; *Game Theory ; *Games, Experimental ; Humans ; *Thinking
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rall, D P -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):564.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2619823" target="_blank"〉PubMed〈/a〉
    Keywords: *Accidents ; Alaska ; *Environmental Pollution ; *Fuel Oils ; Humans ; *Petroleum
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roberts, L -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):576, 578.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814484" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Costs and Cost Analysis ; DNA/*genetics ; Human Genome Project/*economics ; Humans ; *Information Systems ; *Internationality ; Japan ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roe, K E -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):563.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814480" target="_blank"〉PubMed〈/a〉
    Keywords: Accidents ; Humans ; *Information Systems ; Nuclear Reactors ; Pennsylvania ; Risk Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    Publication Date: 1989-11-03
    Description: Transcription of the yeast CYC1 promoter fused to a sequence lacking guanosine residues provided a rapid, sensitive assay of initiation by RNA polymerase II in yeast extracts. Initiation was enhanced by yeast and mammalian activator proteins. The adenoviral major late promoter fused to the G-minus sequence was transcribed in yeast extracts with an efficiency comparable to that observed in HeLa extracts, showing that promoters as well as transcription factors are functionally interchangeable across species. Initiation occurred at different sites, approximately 30 and 63 to 69 base pairs downstream of the TATA element of the adenoviral promoter in HeLa and yeast extracts, respectively, distances characteristic of initiation in the two systems in vivo. A component of the transcription system and not the promoter sequence determines the distance to the initiation site.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lue, N F -- Flanagan, P M -- Sugimoto, K -- Kornberg, R D -- GM36659/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):661-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Biology, Beckman Laboratories, Fairchild Center, Stanford School of Medicine, CA 94305.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510298" target="_blank"〉PubMed〈/a〉
    Keywords: Adenoviruses, Human/*genetics ; Base Sequence ; GTP-Binding Proteins/genetics ; *Genes, Fungal ; HeLa Cells/metabolism ; Humans ; Molecular Sequence Data ; Oligonucleotide Probes ; *Promoter Regions, Genetic ; RNA Polymerase II/*metabolism ; Saccharomyces cerevisiae/enzymology/*genetics ; Templates, Genetic ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: Cells prepare for S phase during the G1 phase of the cell cycle. Cell biological methods have provided knowledge of cycle kinetics and of substages of G1 that are determined by extracellular signals. Through the use of biochemical and molecular biological techniques to study effects of growth factors, oncogenes, and inhibitors, intracellular events during G1 that lead to DNA synthesis are rapidly being discovered. Many cells in vivo are in a quiescent state (G0), with unduplicated DNA. Cells can be activated to reenter the cycle during G1. Similarly, cells in culture can be shifted between G0 and G1. These switches in and out of G1 are the main determinants of post-embryonic cell proliferation rate and are defectively controlled in cancer cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pardee, A B -- 24571/PHS HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):603-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683075" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Cycle ; *Cell Division ; Cell Membrane/physiology ; Cell Nucleus/physiology ; Gene Expression ; Humans ; *Interphase ; Models, Biological ; Neoplasms/pathology ; Signal Transduction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Stow, S H -- Ashwood, T L -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):563.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814479" target="_blank"〉PubMed〈/a〉
    Keywords: Adolescent ; Humans ; *Schools ; Science/*education ; Students ; Teaching/methods
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    Publication Date: 1989-11-03
    Description: A complementary DNA (cDNA) for ubiquitin carboxyl-terminal hydrolase isozyme L3 was cloned from human B cells. The cDNA encodes a protein of 230 amino acids with a molecular mass of 26.182 daltons. The human protein is very similar to the bovine homolog, with only three amino acids differing in over 100 residues compared. The amino acid sequence deduced from the cDNA was 54% identical to that of the neuron-specific protein PGP 9.5. Purification of bovine PGP 9.5 confirmed that it is also a ubiquitin carboxyl-terminal hydrolase. These results suggest that a family of such related proteins exists and that their expression is tissue-specific.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wilkinson, K D -- Lee, K M -- Deshpande, S -- Duerksen-Hughes, P -- Boss, J M -- Pohl, J -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):670-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Emory University School of Medicine, Atlanta, GA 30322.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2530630" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; B-Lymphocytes/enzymology ; Base Sequence ; Cattle ; DNA/genetics ; Humans ; Isoenzymes/genetics ; Molecular Sequence Data ; Neuropeptides/*genetics/isolation & purification ; Sequence Homology, Nucleic Acid ; Thiolester Hydrolases/*genetics/isolation & purification ; Ubiquitin Thiolesterase
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barinaga, M -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):448-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814475" target="_blank"〉PubMed〈/a〉
    Keywords: Breast Neoplasms/*therapy ; Female ; Humans ; *Psychotherapy, Group ; Survival Analysis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    Publication Date: 1989-10-27
    Description: Host cell factors act together with regulatory genes of the human immunodeficiency virus (HIV) to control virus production. Human-Chinese hamster ovary hybrid cell clones were used to probe for human chromosomes involved in regulating HIV gene expression. DNA transfection experiments showed that 4 of 18 clones had high levels of HIV gene expression measured by both extracellular virus production and transactivation of the HIV long terminal repeat in the presence of the trans-activator (tat) gene. Karyotype analyses revealed a 94% concordance (17/18) between human chromosome 12 and HIV gene expression. Other chromosomes had an 11 to 72% concordance with virus production.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hart, C E -- Ou, C Y -- Galphin, J C -- Moore, J -- Bacheler, L T -- Wasmuth, J J -- Petteway, S R Jr -- Schochetman, G -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):488-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Centers for Disease Control, Atlanta, GA 30333.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683071" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chloramphenicol O-Acetyltransferase/genetics ; *Chromosomes, Human, Pair 12 ; Cricetinae ; Cricetulus ; Gene Expression Regulation, Viral/*genetics ; Genes, tat ; HIV-1/*genetics ; Humans ; Hybrid Cells ; Repetitive Sequences, Nucleic Acid ; Transcriptional Activation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Two human cell lines (termed rho 0), which had been completely depleted of mitochondrial DNA (mtDNA) by long-term exposure to ethidium bromide, were found to be dependent on uridine and pyruvate for growth because of the absence of a functional respiratory chain. Loss of either of these two metabolic requirements was used as a selectable marker for the repopulation of rho 0 cells with exogenous mitochondria by complementation. Transformants obtained with various mitochondrial donors exhibited a respiratory phenotype that was in most cases distinct from that of the rho 0 parent or the donor, indicating that the genotypes of the mitochondrial and nuclear genomes as well as their specific interactions play a role in the respiratory competence of a cell.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉King, M P -- Attardi, G -- GM11726/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):500-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814477" target="_blank"〉PubMed〈/a〉
    Keywords: Cell Fusion ; Cell Line ; *DNA, Mitochondrial ; Humans ; Mitochondria/*physiology ; Oxygen Consumption/physiology ; *Transformation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    Publication Date: 1989-10-27
    Description: Allele loss is a hallmark of chromosome regions harboring recessive oncogenes. Lung cancer frequently demonstrates loss of heterozygosity on 17p. Recent evidence suggests that the p53 gene located on 17p13 has many features of such an antioncogene. The p53 gene was frequently mutated or inactivated in all types of human lung cancer. The genetic abnormalities of p53 include gross changes such as homozygous deletions and abnormally sized messenger RNAs along with a variety of point or small mutations, which map to the p53 open reading frame and change amino acid sequence in a region highly conserved between mouse and man. In addition, very low or absent expression of p53 messenger RNA in lung cancer cell lines compared to normal lung was seen. These findings, coupled with the previous demonstration of 17p allele loss in lung cancer, strongly implicate p53 as an anti-oncogene whose disruption is involved in the pathogenesis of human lung cancer.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, T -- Nau, M M -- Chiba, I -- Birrer, M J -- Rosenberg, R K -- Vinocour, M -- Levitt, M -- Pass, H -- Gazdar, A F -- Minna, J D -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):491-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉National Cancer Institute-Navy Medical Oncology Branch, Bethesda, MD 20814.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554494" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; Carcinoid Tumor/genetics ; Carcinoma, Non-Small-Cell Lung/genetics ; Carcinoma, Small Cell/genetics ; Chromosomes, Human, Pair 17 ; DNA, Neoplasm/genetics ; Gene Amplification ; Humans ; Lung Neoplasms/*genetics ; Mutation ; Oncogene Proteins/*genetics ; Phosphoproteins/*genetics ; RNA, Messenger/genetics ; RNA, Neoplasm/genetics ; Ribonucleases ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 82
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Shapiro, S -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):431-2.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814471" target="_blank"〉PubMed〈/a〉
    Keywords: Coronary Disease/etiology ; Humans ; Lung Neoplasms/*etiology ; Smoking/adverse effects ; Stress, Psychological/*complications
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 83
    Publication Date: 1989-10-27
    Description: According to the place principles of the classical hearing theory, the physical entity frequency is encoded in the auditory periphery as place information (tonotopic representation), which is decoded in more central parts of the auditory system to form the subjective entity pitch. However, this relation is true only for pure-tone signals (spectral pitch); it can be quite different in the case of complex auditory stimuli (virtual pitch), thus requiring a multistage process for pitch formation. Neuromagnetic measurements showed that the tonotopic organization of the primary auditory cortex reflects the pitch rather than the frequency of the stimulus; that is, the pitch formation process must take place in subcortical regions.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pantev, C -- Hoke, M -- Lutkenhoner, B -- Lehnertz, K -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):486-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institute of Experimental Audiology, University of Munster, Federal Republic of Germany.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814476" target="_blank"〉PubMed〈/a〉
    Keywords: Acoustic Stimulation ; Acoustics ; Audiometry/methods ; Auditory Cortex/*physiology ; Brain Mapping ; Humans ; Magnetics ; Pitch Perception/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 84
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Expression of the c-myc oncogene is deregulated in a variety of malignancies. Rearrangement and mutation of the c-myc locus is a characteristic feature of human Burkitt's lymphoma. Whether deregulation is solely a result of mutation of c-myc or whether it is influenced by the transformed B cell context has not been determined. A translocated and mutated allele of c-myc was stably transfected into fibroblasts. The rearranged allele was expressed indistinguishably from a normal c-myc gene: it had serum-regulated expression, was transcribed with normal promoter preference, and was strongly attenuated. Thus mutations by themselves are insufficient to deregulate c-myc transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richman, A -- Hayday, A -- 40364/PHS HHS/ -- GM 07499/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):494-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Burkitt Lymphoma/genetics ; Cell Line ; Fibroblasts/metabolism ; Gene Expression Regulation, Neoplastic ; Humans ; Mutation ; Oncogenes/*genetics ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-myc ; *Transfection ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 85
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Foster, K R -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):431.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814470" target="_blank"〉PubMed〈/a〉
    Keywords: Electricity/*adverse effects ; Humans ; *Magnetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 86
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Frisch, R E -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):432.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814472" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Animals ; Body Weight/*physiology ; Cricetinae ; Female ; Fertility/*physiology ; Humans ; Mesocricetus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 87
    Publication Date: 1989-10-27
    Description: The prohormone-processing endoprotease (KEX2 gene product) of the yeast Saccharomyces cerevisiae is a membrane-bound, 135,000-dalton glycoprotein, which contains both asparagine-linked and serine- and threonine-linked oligosaccharide and resides in a secretory compartment. Analysis of mutant kex2 genes truncated at their 3' end indicates that carboxyl terminal domains of the enzyme are required for its proper localization within the cell. A human gene product, "furin," shares 50% identity with the catalytic domain of Kex2 protease and is, therefore, a candidate for a human prohormone-processing enzyme.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fuller, R S -- Brake, A J -- Thorner, J -- GM21841/GM/NIGMS NIH HHS/ -- RR01685/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):482-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, University of California, Berkeley 94720.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683070" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Humans ; Molecular Sequence Data ; Mutation ; *Proprotein Convertases ; Saccharomyces cerevisiae/enzymology ; *Saccharomyces cerevisiae Proteins ; Sequence Homology, Nucleic Acid ; Serine Endopeptidases/*genetics/metabolism ; Subcellular Fractions/enzymology ; *Subtilisins
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 88
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-20
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koppenol, W H -- Bounds, P L -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):311.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biodynamics Institute and Departments of Chemistry and Biochemistry, Louisiana State University, Baton Rouge, LA 70803, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799389" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dose-Response Relationship, Radiation ; Humans ; *Radiation, Ionizing
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 89
    Publication Date: 1989-10-20
    Description: The gene (E2A) that codes for proteins with the properties of immunoglobulin enhancer binding factors E12/E47 was mapped to chromosome region 19p13.2-p13.3, a site associated with nonrandom translocations in acute lymphoblastic leukemias. The majority of t(1;19)(q23;p13)-carrying leukemias and cell lines studied contained rearrangements of E2A as determined by DNA blot analyses. The rearrangements altered the E2A transcriptional unit, resulting in the synthesis of a transcript larger than the normal-sized E2A mRNAs in one of the cell lines with this translocation. These observations indicate that the gene for a transcription factor is located at the breakpoint of a consistently recurring chromosomal translocation in many acute leukemias and suggest a direct role for alteration of such factors in the pathogenesis of some malignancies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mellentin, J D -- Murre, C -- Donlon, T A -- McCaw, P S -- Smith, S D -- Carroll, A J -- McDonald, M E -- Baltimore, D -- Cleary, M L -- CA30969/CA/NCI NIH HHS/ -- CA42106/CA/NCI NIH HHS/ -- CA42971/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):379-82.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Stanford University School of Medicine, CA 94025.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799390" target="_blank"〉PubMed〈/a〉
    Keywords: Child ; Chromosome Mapping ; *Chromosomes, Human, Pair 1 ; *Chromosomes, Human, Pair 19 ; DNA-Binding Proteins/*genetics ; Humans ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/*genetics ; Transcription Factors/*genetics ; Translocation, Genetic/*physiology ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 90
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koshland, D E Jr -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):189.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799380" target="_blank"〉PubMed〈/a〉
    Keywords: *Human Genome Project ; Humans ; Resource Allocation ; *Risk Assessment
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 91
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: Lectins on cell surfaces mediate cell-cell interactions by combining with complementary carbohydrates on apposing cells. They play a key role in the control of various normal and pathological processes in living organisms.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sharon, N -- Lis, H -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):227-34.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Weizmann Institute of Science, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2552581" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bacterial Physiological Phenomena ; Cell Communication/*physiology ; Cell Differentiation ; Entamoeba histolytica/physiology ; Fabaceae/physiology ; Humans ; Lectins/*physiology ; Myxomycetes/physiology ; Orthomyxoviridae/physiology ; Plant Lectins ; Plants, Medicinal
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 92
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McElfresh, K C -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):192.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799381" target="_blank"〉PubMed〈/a〉
    Keywords: Forensic Medicine/*methods ; Humans ; Nucleotide Mapping/*standards ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 93
    Publication Date: 1989-10-13
    Description: Interleukin-1 (IL-1) is a major regulator of inflammation and immunity. IL-1 induces T lymphocyte growth by acting as a second signal (together with antigen) in enhancing the production of interleukin-2 (IL-2). An IL-1-responsive element in the promoter region of the human IL-2 gene was similar to the binding site for the transcription factor AP-1. IL-1 enhanced expression of c-jun messenger RNA, whereas the antigenic signal enhanced messenger RNA expression of c-fos. Thus, the two components of the AP-1 factor are independently regulated and the AP-1 factor may serve as a nuclear mediator for the many actions of IL-1 on cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Muegge, K -- Williams, T M -- Kant, J -- Karin, M -- Chiu, R -- Schmidt, A -- Siebenlist, U -- Young, H A -- Durum, S K -- 5-T32-CA-09140/CA/NCI NIH HHS/ -- AI-R01-23879/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):249-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, Program Resources Inc., Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799385" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chloramphenicol O-Acetyltransferase/genetics ; Gene Expression Regulation ; Humans ; Interleukin-1/*physiology ; Interleukin-2/*genetics ; Mice ; Promoter Regions, Genetic/genetics ; Proto-Oncogene Proteins c-jun/*genetics ; Tetradecanoylphorbol Acetate/pharmacology ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 94
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parker, S T -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799382" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Hominidae/*psychology ; Humans ; *Sexual Behavior
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 95
    Publication Date: 1989-10-13
    Description: Cellular metabolism is affected by many factors in a cell's environment. Given a sufficiently sensitive method for measuring cellular metabolic rates, it should be possible to detect a wide variety of chemical and physical stimuli. A biosensor has been constructed in which living cells are confined to a flow chamber in which a potentiometric sensor continually measures the rate of production of acidic metabolites. Exploratory studies demonstrate several applications of the device in basic science and technology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parce, J W -- Owicki, J C -- Kercso, K M -- Sigal, G B -- Wada, H G -- Muir, V C -- Bousse, L J -- Ross, K L -- Sikic, B I -- McConnell, H M -- R01-CA-4217/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):243-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Devices Corporation, Menlo Park, CA 94025.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799384" target="_blank"〉PubMed〈/a〉
    Keywords: *Biosensing Techniques ; Carbonyl Cyanide m-Chlorophenyl Hydrazone/pharmacology ; Cells/*metabolism ; Cells, Cultured/drug effects/metabolism ; Epidermal Growth Factor/pharmacology ; Flow Cytometry ; Humans ; Oxygen Consumption ; Silicon
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 96
    Publication Date: 1989-10-13
    Description: Fumigant applicators who, 6 weeks to 3 months earlier, were exposed to phosphine, a common grain fumigant, or to phosphine and other pesticides had significantly increased stable chromosome rearrangements, primarily translocations in G-banded lymphocytes. Less stable aberrations including chromatid deletions and gaps were significantly increased only during the application season, but not at this later time point. During fumigant application, measured exposure to phosphine exceeds accepted national standards. Because phosphine is also used as a dopant in the microchip industry and is generated in waste treatment, the possibility of more widespread exposure and long-term health sequelae must be considered.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Garry, V F -- Griffith, J -- Danzl, T J -- Nelson, R L -- Whorton, E B -- Krueger, L A -- Cervenka, J -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):251-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Laboratory Medicine and Pathology, University of Minnesota, Minneapolis 55414.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799386" target="_blank"〉PubMed〈/a〉
    Keywords: *Chromosome Aberrations ; Chromosome Banding ; Environmental Exposure ; Humans ; Lymphocytes/drug effects/ultrastructure ; Male ; Pesticides/*poisoning ; Phosphines/*poisoning
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 97
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Reddy, E P -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):10-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781296" target="_blank"〉PubMed〈/a〉
    Keywords: Base Sequence ; DNA, Single-Stranded/genetics ; Gene Amplification ; Human T-lymphotropic virus 1/*genetics ; Humans ; Multiple Sclerosis/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 98
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Palca, J -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):19-21.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506644" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*drug therapy ; Antiviral Agents/therapeutic use ; Clinical Trials as Topic/methods/*trends ; Didanosine ; Dideoxynucleosides/therapeutic use ; Ethical Review ; Humans ; Patient Selection ; Research Subjects ; Risk Assessment ; Therapeutic Human Experimentation ; United States ; United States Dept. of Health and Human Services
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 99
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):27.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781300" target="_blank"〉PubMed〈/a〉
    Keywords: *Abortion, Legal ; *Ethics ; *Ethics, Institutional ; Female ; Humans ; *National Institutes of Health (U.S.) ; Politics ; Pregnancy ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 100
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):21-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781298" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/complications/*drug therapy ; Child ; Dementia/*drug therapy/etiology ; Humans ; National Institutes of Health (U.S.) ; United States ; Zidovudine/*therapeutic use
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...