ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • Animals  (1,937)
  • 1985-1989  (1,937)
  • 1960-1964
  • 1
    Publication Date: 1989-12-22
    Description: The murine acquired immunodeficiency syndrome is induced by a defective retrovirus. To study the role of virus replication in this disease, helper-free stocks of defective Duplan virus were produced. These stocks were highly pathogenic in absence of detectable replicating murine leukemia viruses (MuLVs) other than xenotropic MuLV. They induced expansion of the infected cell population (over 1000-fold), and this cell expansion was oligoclonal in origin and, most likely, arose through cell division. These results suggest that this defective virus is oncogenic, inducing a primary neoplasia associated with an acquired immunodeficiency syndrome as a paraneoplastic syndrome. These data emphasize the need to determine whether virus replication is necessary for the progression of other immunodeficiency diseases, including acquired immunodeficiency syndrome, and whether these diseases also represent paraneoplastic syndromes.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huang, M -- Simard, C -- Jolicoeur, P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1614-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Biology, Clinical Research Institute of Montreal, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Southern ; Cells, Cultured ; DNA, Viral/isolation & purification ; Defective Viruses/isolation & purification/*pathogenicity ; Helper Viruses/isolation & purification ; Immunologic Deficiency Syndromes/*microbiology ; Leukemia Virus, Murine/pathogenicity ; Lymph Nodes/microbiology ; Lymphocytes/microbiology ; Mice ; Mice, Inbred C57BL ; RNA-Directed DNA Polymerase/analysis ; Retroviridae/isolation & purification/*pathogenicity ; Retroviridae Infections/*microbiology ; Spleen/microbiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 2
    Publication Date: 1989-12-22
    Description: A human acute lymphoblastic leukemia (ALL) cell line that was transplanted into immune-deficient SCID mice proliferated in the hematopoietic tissues, invaded various organs, and led to the death of the mice. The distribution of leukemic cells in SCID mice was similar to the course of the disease in children. A-1 cells marked with a retrovirus vector showed clonal evolution after the transplant. SCID mice that were injected with bone marrow from three patients with non-T ALL had leukemic cells in their bone marrow and spleen. This in vivo model of human leukemia is an approach to understanding leukemic growth and progression and is a novel system for testing new treatment strategies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kamel-Reid, S -- Letarte, M -- Sirard, C -- Doedens, M -- Grunberger, T -- Fulop, G -- Freedman, M H -- Phillips, R A -- Dick, J E -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1597-600.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Hospital for Sick Children, Toronto, Ontario.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595371" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Brain/pathology ; Cell Line ; Clone Cells ; DNA, Neoplasm/isolation & purification ; Humans ; Immunologic Deficiency Syndromes/*pathology ; Kidney/pathology ; Liver/pathology ; Mice ; Mice, Mutant Strains ; Neoplasm Transplantation ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/*pathology ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 3
    Publication Date: 1989-12-22
    Description: CD16 is a low-affinity immunoglobulin G (IgG) Fc receptor that is expressed on natural killer (NK) cells, granulocytes, activated macrophages, and some T lymphocytes. Two similar genes, CD16-I and CD16-II, encode membrane glycoproteins that are anchored by phosphatidylinositol (PI)-glycan and transmembrane polypeptides, respectively. The primary structural requirements for PI-linkage were examined by constructing a series of hybrid cDNA molecules. Although both cDNA's have an identical COOH-terminal hydrophobic segment, CD16-I has Ser203 whereas CD16-II has Phe203. Conversion of Phe to Ser in CD16-II permits expression of a PI-glycan-anchored glycoprotein, whereas conversion of Ser to Phe in CD16-I prevents PI-glycan linkage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lanier, L L -- Cwirla, S -- Yu, G -- Testi, R -- Phillips, J H -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1611-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Becton Dickinson Monoclonal Center, Inc., Mountain View, CA 94043.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531919" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/*genetics ; Antigens, Differentiation/*genetics/metabolism ; Base Sequence ; Cell Line ; Cell Membrane/immunology ; Codon/genetics ; *Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Membrane Glycoproteins/*genetics ; Molecular Sequence Data ; *Phenylalanine ; Receptors, Fc/*genetics/metabolism ; Receptors, IgG ; *Serine ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 4
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1561.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595369" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies/genetics ; B-Lymphocytes/immunology ; DNA Nucleotidyltransferases/genetics/metabolism ; Genes ; *Genes, Immunoglobulin ; Humans ; Receptors, Antigen, T-Cell/*genetics ; T-Lymphocytes/immunology ; VDJ Recombinases
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 5
    Publication Date: 1989-12-22
    Description: The pituitary hormone thyrotropin, or thyroid-stimulating hormone (TSH), is the main physiological agent that regulates the thyroid gland. The thyrotropin receptor (TSHR) was cloned by selective amplification with the polymerase chain reaction of DNA segments presenting sequence similarity with genes for G protein-coupled receptors. Out of 11 new putative receptor clones obtained from genomic DNA, one had sequence characteristics different from all the others. Although this clone did not hybridize to thyroid transcripts, screening of a dog thyroid complementary DNA (cDNA) library at moderate stringency identified a cDNA encoding a 4.9-kilobase thyroid-specific transcript. The polypeptide encoded by this thyroid-specific transcript consisted of a 398-amino acid residue amino-terminal segment, constituting a putative extracellular domain, connected to a 346-residue carboxyl-terminal domain that contained seven putative transmembrane segments. Expression of the cDNA conferred TSH responsiveness to Xenopus oocytes and Y1 cells and a TSH binding phenotype to COS cells. The TSHR and the receptor for luteinizing hormone-choriogonadotropin constitute a subfamily of G protein-coupled receptors with distinct sequence characteristics.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parmentier, M -- Libert, F -- Maenhaut, C -- Lefort, A -- Gerard, C -- Perret, J -- Van Sande, J -- Dumont, J E -- Vassart, G -- R01-DK21732/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1620-2.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Institut de Recherche Interdisciplinaire, Faculte de Medecine, Universite Libre de Bruxelles, Belgium.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556796" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Blotting, Northern ; Cell Line ; *Cloning, Molecular ; Cyclic AMP ; Dogs ; Female ; *Genes ; Molecular Sequence Data ; Oocytes/drug effects/metabolism ; Organ Specificity ; Polymerase Chain Reaction/methods ; RNA, Messenger/genetics ; Receptors, Thyrotropin/*genetics ; Thyrotropin/pharmacology ; Transcription, Genetic ; Xenopus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 6
    Publication Date: 1989-12-22
    Description: T cell clones obtained from a human volunteer immunized with Plasmodium falciparum sporozoites specifically recognized the native circumsporozoite (CS) antigen expressed on P. falciparum sporozoites, as well as bacteria- and yeast-derived recombinant falciparum CS proteins. The response of these CD4+ CD8- cells was species-specific, since the clones did not proliferate or secrete gamma interferon when challenged with sporozoites or recombinant CS proteins of other human, simian, or rodent malarias. The epitope recognized by the sporozoite-specific human T cell clones mapped to the 5' repeat region of the CS protein and was contained in the NANPNVDPNANP sequence.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Nardin, E H -- Herrington, D A -- Davis, J -- Levine, M -- Stuber, D -- Takacs, B -- Caspers, P -- Barr, P -- Altszuler, R -- Clavijo, P -- AI25085/AI/NIAID NIH HHS/ -- AI62533/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1603-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medical and Molecular Parasitology, New York University, NY 10010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2480642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens, CD4/*immunology ; Antigens, Protozoan/*immunology ; Cells, Cultured ; Clone Cells ; Epitopes/*analysis ; Humans ; Interferon-gamma/biosynthesis ; Lymphocyte Activation ; Malaria/*immunology ; Molecular Sequence Data ; Plasmodium falciparum/*immunology ; *Protozoan Proteins ; Recombinant Proteins/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 7
    Publication Date: 1989-12-22
    Description: Granulocyte and natural killer (NK) cell Fc receptors for immunoglobulin G (CD16) differ in only a few amino acids, yet have phosphatidylinositol glycan (PIG) or polypeptide membrane anchors, respectively. Mutagenesis shows that anchoring is regulated by a serine residue near the PIG anchor attachment site in the extracellular domain. The NK cell isoform was not expressed on the surface of COS cells unless cotransfected with a subunit that was expressed in NK cells and that was identical to the gamma subunit of the high affinity IgE Fc receptor (Fc epsilon RI). However, the CD16 sequence and not expression of the gamma subunit is dominant in regulating PIG reanchoring.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hibbs, M L -- Selvaraj, P -- Carpen, O -- Springer, T A -- Kuster, H -- Jouvin, M H -- Kinet, J P -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1608-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Harvard Medical School, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531918" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD/genetics ; Antigens, Differentiation/*genetics ; Cell Line ; Cell Membrane/immunology ; Flow Cytometry ; *Gene Expression Regulation ; Genes, Immunoglobulin ; Granulocytes/immunology ; Humans ; Immunoglobulin G ; Killer Cells, Natural/immunology ; L Cells (Cell Line)/immunology ; Mice ; Mutation ; RNA, Messenger/genetics/isolation & purification ; Receptors, Fc/*genetics ; Receptors, IgG ; Transcription, Genetic ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 8
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schwarz, S -- Pohl, P -- Zhou, G Z -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1635-8.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2556797" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Binding, Competitive ; Brain/metabolism ; Kinetics ; Ligands ; Lymphocytes/metabolism ; Progesterone/blood/cerebrospinal fluid/metabolism ; Receptors, Opioid/*metabolism ; Receptors, sigma ; Steroids/*metabolism/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 9
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: Fos and Jun form a heterodimeric complex that associates with the nucleotide sequence motif known as the AP-1 binding site. Although this complex has been proposed to function as a transcriptional regulator in neurons, no specific target gene has yet been identified. Proenkephalin mRNA increased in the hippocampus during seizure just after an increase in c-fos and c-jun expression was detected. Fos-Jun complexes bound specifically to a regulatory sequence in the 5' control region of the proenkephalin gene. Furthermore, c-fos and c-jun stimulated transcription from this control region synergistically in transactivation assays. These data suggest that the proenkephalin gene may be a physiological target for Fos and Jun in the hippocampus and indicate that these proto-oncogene transcription factors may play a role in neuronal responses to stimulation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sonnenberg, J L -- Rauscher, F J 3rd -- Morgan, J I -- Curran, T -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1622-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Oncology, Molecular Biology, Roche Research Center, Nutley, NJ 07110.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512642" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Brain/*metabolism ; Cell Line ; DNA-Binding Proteins/*genetics/metabolism ; Enhancer Elements, Genetic ; Enkephalins/*genetics ; *Gene Expression Regulation ; *Genes ; Hippocampus/metabolism ; Mice ; Molecular Sequence Data ; Promoter Regions, Genetic ; Protein Precursors/*genetics ; Protein-Tyrosine Kinases/*genetics ; Proto-Oncogene Proteins/*genetics/metabolism ; Proto-Oncogene Proteins c-fos ; Proto-Oncogene Proteins c-jun ; *Proto-Oncogenes ; RNA, Messenger/genetics ; Teratoma ; Transcription Factors/*genetics/metabolism ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 10
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cannell, M B -- Berlin, J R -- Lederer, W J -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1640.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2627235" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Calcium/metabolism/*physiology ; Cell Membrane/physiology ; Electric Conductivity ; Heart/*physiology ; Membrane Potentials ; *Myocardial Contraction ; Sarcoplasmic Reticulum/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 11
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-22
    Description: Expression of high levels of the structural proteins of the human immunodeficiency virus type 1 (HIV-1) requires the presence of the protein encoded by the rev open reading frame (Rev) and its associated target sequence CAR (cis anti-repression sequence) which is present in the env region of viral RNA. Extensive mutagenesis demonstrated that CAR has a complex secondary structure consisting of a central stem and five stem/loops. Disruption of any of these structures severely impaired the Rev response, but many of the stem/loops contain material that was unnecessary for Rev regulation and must be retained in these structures to avoid disturbing adjacent structures critical for CAR function. Probably no more than two of the described structural components are involved in sequence-specific recognition by regulatory proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dayton, E T -- Powell, D M -- Dayton, A I -- New York, N.Y. -- Science. 1989 Dec 22;246(4937):1625-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Immunoregulation, National Institute of Allergy and Infectious Disease, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2688093" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cell Line ; Chromosome Deletion ; Gene Amplification ; Gene Products, rev/genetics/*metabolism ; *Genes, Viral ; HIV-1/*genetics ; Models, Structural ; Molecular Sequence Data ; Mutation ; Nucleic Acid Conformation ; Plasmids ; RNA, Viral/*genetics ; Software ; Trans-Activators/*metabolism ; Transfection ; Viral Envelope Proteins/genetics ; rev Gene Products, Human Immunodeficiency Virus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 12
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: Tumor suppressor genes are wild-type alleles of genes that play regulatory roles in cell proliferation, differentiation, and other cellular and systemic processes. It is their loss or inactivation that is oncogenic. The first evidence of tumor suppressor genes appeared in the early 1970s, but only within the past few years has a wealth of new information illuminated the central importance of these genes. Two or more different suppressor genes may be inactivated in the same tumors, and the same suppressors may be inactive in different tumor types (for example, lung, breast, and colon). The suppressor genes already identified are involved in cell cycle control, signal transduction, angiogenesis, and development, indicating that they contribute to a broad array of normal and tumor-related functions. It is proposed that tumor suppressor genes provide a vast untapped resource for anticancer therapy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sager, R -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1406-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Cancer Genetics, Dana-Farber Cancer Institute, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2574499" target="_blank"〉PubMed〈/a〉
    Keywords: Alleles ; Animals ; Cell Differentiation ; Cell Division ; Cell Transformation, Neoplastic/genetics ; Chromosome Aberrations ; Cloning, Molecular ; Eye Neoplasms/genetics ; Heterozygote ; Humans ; Hybrid Cells ; Kidney Neoplasms/genetics ; Mutation ; Neoplasms/*genetics ; Oncogene Proteins/genetics ; Phosphoproteins/genetics ; Polymorphism, Restriction Fragment Length ; Retinoblastoma/genetics ; Suppression, Genetic/*genetics ; Tumor Cells, Cultured ; Tumor Suppressor Protein p53 ; Wilms Tumor/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 13
    Publication Date: 1989-12-15
    Description: A protein secreted by cultured rat heart cells can direct the choice of neurotransmitter phenotype made by cultured rat sympathetic neurons. Structural analysis and biological assays demonstrated that this protein is identical to a protein that regulates the growth and differentiation of embryonic stem cells and myeloid cells, and that stimulates bone remodeling and acute-phase protein synthesis in hepatocytes. This protein has been termed D factor, DIA, DIF, DRF, HSFIII, and LIF. Thus, this cytokine, like IL-6 and TGF beta, regulates growth and differentiation in the embryo and in the adult in many tissues, now including the nervous system.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yamamori, T -- Fukada, K -- Aebersold, R -- Korsching, S -- Fann, M J -- Patterson, P H -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1412-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Division, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2512641" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cell Differentiation ; Cells, Cultured ; Choline/*physiology ; Cloning, Molecular ; DNA/genetics ; *Growth Inhibitors/genetics/pharmacology/secretion ; Humans ; Immunosorbent Techniques ; *Interleukin-6 ; Leukemia Inhibitory Factor ; *Lymphokines ; Mice ; Molecular Sequence Data ; Myocardium/*metabolism ; Neurons/*cytology ; Rats ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 14
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-15
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cherfas, J -- New York, N.Y. -- Science. 1989 Dec 15;246(4936):1384.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2595360" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Behavior, Animal ; Great Britain ; Rabbits/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 15
    Publication Date: 1989-12-08
    Description: A novel bacteriophage lambda vector system was used to express in Escherichia coli a combinatorial library of Fab fragments of the mouse antibody repertoire. The system allows rapid and easy identification of monoclonal Fab fragments in a form suitable for genetic manipulation. It was possible to generate, in 2 weeks, large numbers of monoclonal Fab fragments against a transition state analog hapten. The methods described may supersede present-day hybridoma technology and facilitate the production of catalytic and other antibodies.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Huse, W D -- Sastry, L -- Iverson, S A -- Kang, A S -- Alting-Mees, M -- Burton, D R -- Benkovic, S J -- Lerner, R A -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1275-81.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Research Institute of Scripps Clinic, La Jolla, CA 92037.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531466" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antibodies, Monoclonal/*biosynthesis/genetics ; Antibody Specificity ; Antigen-Antibody Reactions ; Bacteriophage lambda/*genetics ; Base Sequence ; Cloning, Molecular/methods ; Escherichia coli/genetics ; Gene Amplification ; Gene Library ; *Genetic Vectors ; Hemocyanin/analogs & derivatives/immunology ; Immunoglobulin Fab Fragments/biosynthesis ; Immunoglobulin Fragments/*biosynthesis/genetics ; Mice ; Molecular Sequence Data ; Organophosphorus Compounds/immunology ; Recombinant Proteins/biosynthesis/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 16
    Publication Date: 1989-12-08
    Description: Vascular permeability factor (VPF) is a 40-kilodalton disulfide-linked dimeric glycoprotein that is active in increasing blood vessel permeability, endothelial cell growth, and angiogenesis. These properties suggest that the expression of VPF by tumor cells could contribute to the increased neovascularization and vessel permeability that are associated with tumor vasculature. The cDNA sequence of VPF from human U937 cells was shown to code for a 189-amino acid polypeptide that is similar in structure to the B chain of platelet-derived growth factor (PDGF-B) and other PDGF-B-related proteins. The overall identity with PDGF-B is 18%. However, all eight of the cysteines in PDGF-B were found to be conserved in human VPF, an indication that the folding of the two proteins is probably similar. Clusters of basic amino acids in the COOH-terminal halves of human VPF and PDGF-B are also prevalent. Thus, VPF appears to be related to the PDGF/v-sis family of proteins.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Keck, P J -- Hauser, S D -- Krivi, G -- Sanzo, K -- Warren, T -- Feder, J -- Connolly, D T -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1309-12.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Cell Culture and Biochemistry, Monsanto Company, St. Louis, MO 63167.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479987" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Capillary Permeability/physiology ; Cell Division/physiology ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; *Growth Substances ; Guinea Pigs ; Humans ; Lymphokines/*physiology ; Molecular Sequence Data ; Neovascularization, Pathologic/physiopathology ; Oncogene Proteins v-sis ; Platelet-Derived Growth Factor/physiology ; Retroviridae Proteins, Oncogenic/physiology ; Sequence Homology, Nucleic Acid ; Transforming Growth Factors ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 17
    Publication Date: 1989-12-08
    Description: Vascular endothelial growth factor (VEGF) was purified from media conditioned by bovine pituitary folliculostellate cells (FC). VEGF is a heparin-binding growth factor specific for vascular endothelial cells that is able to induce angiogenesis in vivo. Complementary DNA clones for bovine and human VEGF were isolated from cDNA libraries prepared from FC and HL60 leukemia cells, respectively. These cDNAs encode hydrophilic proteins with sequences related to those of the A and B chains of platelet-derived growth factor. DNA sequencing suggests the existence of several molecular species of VEGF. VEGFs are secreted proteins, in contrast to other endothelial cell mitogens such as acidic or basic fibroblast growth factors and platelet-derived endothelial cell growth factor. Human 293 cells transfected with an expression vector containing a bovine or human VEGF cDNA insert secrete an endothelial cell mitogen that behaves like native VEGF.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Leung, D W -- Cachianes, G -- Kuang, W J -- Goeddel, D V -- Ferrara, N -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1306-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Biology, Genetech, South San Francisco, CA 94080.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479986" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Northern ; Cattle ; Cell Division ; Cloning, Molecular ; Endothelium, Vascular/*cytology ; Gene Library ; Humans ; Lymphokines/genetics/*physiology/secretion ; Molecular Sequence Data ; Neovascularization, Pathologic/*physiopathology ; Sequence Homology, Nucleic Acid ; Vascular Endothelial Growth Factor A ; Vascular Endothelial Growth Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 18
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: The transfer of genetic information into mouse embryos to stably alter the genetic constitution of mice is affording new insights into and opportunities in a wide variety of biological problems. Higher eukaryotes are composed of many interacting cells and organs. The properties of individual cell systems are often discernible only by studying natural or induced disruptions in their functions. Transgenic mice represent a new form of perturbation analysis whereby the selective expression of novel or altered genes can be used to perturb complex systems in ways that are informative about their development, their functions, and their malfunctions. The utility of this strategy is illustrated by recent research into immunological self-tolerance, oncogenes and cancer, and development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hanahan, D -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1265-75.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686032" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Autoimmunity/genetics ; Cell Transformation, Neoplastic/genetics ; Growth/genetics ; Immune Tolerance/genetics ; Mice ; Mice, Transgenic/*genetics/immunology ; Oncogenes
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 19
    Publication Date: 1989-12-08
    Description: The fragile X syndrome is the most common cause of familial mental retardation. Genetic counseling and gene isolation are hampered by a lack of DNA markers close to the disease locus. Two somatic cell hybrids that each contain a human X chromosome with a breakpoint close to the fragile X locus have been characterized. A new DNA marker (DXS296) lies between the chromosome breakpoints and is the closest marker to the fragile X locus yet reported. The Hunter syndrome gene, which causes iduronate sulfatase deficiency, is located at the X chromosome breakpoint that is distal to this new marker, thus localizing the Hunter gene distal to the fragile X locus.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Suthers, G K -- Callen, D F -- Hyland, V J -- Kozman, H M -- Baker, E -- Eyre, H -- Harper, P S -- Roberts, S H -- Hors-Cayla, M C -- Davies, K E -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1298-300.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Histopathology, Adelaide Children's Hospital, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573953" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chromosome Mapping ; Female ; Fragile X Syndrome/*genetics ; Genetic Counseling ; *Genetic Linkage ; *Genetic Markers ; Genomic Library ; Humans ; Hybrid Cells ; Likelihood Functions ; Mice ; Mucopolysaccharidosis II/genetics ; Mutation ; Nucleic Acid Hybridization ; Polymorphism, Restriction Fragment Length ; Sex Chromosome Aberrations/*genetics ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 20
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: Hematogenous metastasis requires the arrest and extravasation of blood-borne tumor cells, possibly involving direct adhesive interactions with vascular endothelium. Cytokine activation of cultured human endothelium increases adhesion of melanoma and carcinoma cell lines. An inducible 110-kD endothelial cell surface glycoprotein, designated INCAM-110, appears to mediate adhesion of melanoma cells. In addition, an inducible endothelial receptor for neutrophils, ELAM-1, supports the adhesion of a human colon carcinoma cell line. Thus, activation of vascular endothelium in vivo that results in increased expression of INCAM-110 and ELAM-1 may promote tumor cell adhesion and affect the incidence and distribution of metastases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Rice, G E -- Bevilacqua, M P -- HL 07727/HL/NHLBI NIH HHS/ -- P01 HL36028/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1303-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Brigham and Women's Hospital, Boston, MA 02115.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588007" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Cell Adhesion/physiology ; Cell Adhesion Molecules/analysis/*physiology ; Colonic Neoplasms/pathology ; Endothelium, Vascular/analysis/*cytology/physiology ; Humans ; Melanoma/*pathology ; Melanoma, Experimental/pathology ; Molecular Weight ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 21
    Publication Date: 1989-12-08
    Description: A vaccine against human immunodeficiency virus (HIV) would be highly effective in stopping the acquired immunodeficiency syndrome (AIDS) epidemic. A comprehensive evaluation of potential vaccine methodologies can be made by means of the simian model for AIDS, which takes advantage of the similarities in viral composition and disease potential between simian immunodeficiency virus (SIV) infection of rhesus macaques and HIV infection in humans. Immunization with a formalin-inactivated whole SIV vaccine potentiated with either alum and the Syntex adjuvant threonyl muramyl dipeptide (MDP) or MDP alone resulted in the protection of eight of nine rhesus monkeys challenged with ten animal-infectious doses of pathogenic virus. These results demonstrate that a whole virus vaccine is highly effective in inducing immune responses that can protect against lentivirus infection and AIDS-like disease.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Murphey-Corb, M -- Martin, L N -- Davison-Fairburn, B -- Montelaro, R C -- Miller, M -- West, M -- Ohkawa, S -- Baskin, G B -- Zhang, J Y -- Putney, S D -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1293-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Delta Regional Primate Research Center, Tulane University, Covington, LA 70434.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555923" target="_blank"〉PubMed〈/a〉
    Keywords: Acetylmuramyl-Alanyl-Isoglutamine/immunology ; Adjuvants, Immunologic/administration & dosage ; Alum Compounds/administration & dosage ; Animals ; Antibodies, Viral/biosynthesis ; Chromatography, High Pressure Liquid ; Disease Models, Animal ; Formaldehyde ; Immunization, Secondary ; Leukocyte Count ; Lymphocytes/immunology/microbiology ; Macaca mulatta ; Retroviridae Infections/*prevention & control ; Retroviridae Proteins/immunology ; Simian Immunodeficiency Virus/*immunology/isolation & purification ; Vaccines, Inactivated/administration & dosage/immunology ; Viral Vaccines/administration & dosage/*immunology ; Virion/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 22
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1250-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588004" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal/*biosynthesis/genetics ; Cloning, Molecular/methods ; Humans ; Recombinant Proteins/biosynthesis
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 23
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cherfas, J -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1242-3.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511631" target="_blank"〉PubMed〈/a〉
    Keywords: Administration, Cutaneous ; Animals ; Developing Countries ; Haplorhini ; Humans ; Mice ; Military Personnel ; Niclosamide/*administration & dosage ; Schistosomiasis/*prevention & control
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 24
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-08
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bolognesi, D P -- New York, N.Y. -- Science. 1989 Dec 8;246(4935):1233-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Surgery, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555922" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*prevention & control ; Animals ; HIV/*immunology ; Humans ; Infectious Anemia Virus, Equine/immunology ; Simian Immunodeficiency Virus/immunology ; *Viral Vaccines
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 25
    Publication Date: 1989-12-01
    Description: Activation of spontaneously dividing T cell hybridomas induces interleukin-2 (IL-2) production, a cell cycle block, and programmed cell death. T cell hybridomas that express the T cell antigen receptor (TCR) zeta homodimer (zeta 2), but not the TCR zeta eta heterodimer, were studied. The zeta eta- cells produced little or no inositol phosphates (IP) when stimulated with antigen. In most cases the hydrolysis of phosphoinositides was also impaired after stimulation with antibody to CD3, although one zeta eta- cell produced normal concentrations of IP. The zeta eta- cells slowed their growth and secreted IL-2 in response to both stimuli. However, the zeta eta- cells did not die after activation with antigen. Since activated thymocytes also undergo programmed cell death, these results may have important implications for the role of the zeta eta.TCR in negative selection.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mercep, M -- Weissman, A M -- Frank, S J -- Klausner, R D -- Ashwell, J D -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1162-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biological Response Modifiers Program, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2531464" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal/immunology ; Antigens/immunology ; Antigens, CD3 ; Antigens, Differentiation, T-Lymphocyte/immunology ; Cell Survival ; *Gene Expression ; Hybridomas/immunology ; Inositol Phosphates/metabolism ; Interleukin-2/secretion ; Lymphocyte Activation/*physiology ; Macromolecular Substances ; Mice ; Receptors, Antigen, T-Cell/*genetics/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 26
    Publication Date: 1989-12-01
    Description: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Morrison, N A -- Shine, J -- Fragonas, J C -- Verkest, V -- McMenemy, M L -- Eisman, J A -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1158-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2588000" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Calcitriol/*pharmacology ; Chloramphenicol O-Acetyltransferase/genetics ; DNA/*genetics ; Dexamethasone/pharmacology ; Gene Expression/*drug effects ; Glucocorticoids/*pharmacology ; Humans ; Molecular Sequence Data ; Osteocalcin/*genetics ; Promoter Regions, Genetic/*genetics ; Rats ; Restriction Mapping ; Sequence Homology, Nucleic Acid ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 27
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-12-01
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Marx, J -- New York, N.Y. -- Science. 1989 Dec 1;246(4934):1120-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587999" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; DNA/*analysis ; Diet ; Elephants/*genetics ; Incisor/*analysis ; Nucleotide Mapping ; Restriction Mapping
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 28
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: Although most animals reproduce sexually, a number of all-female groups exist. Triploid hybrid salamanders appear to maintain themselves by using a male's sperm to activate their eggs, after which the sperm nucleus is eliminated (gynogenesis). The incidence of sperm nuclear incorporation in eggs of these salamanders depends on temperature. Triploid offspring derived gynogenetically are more frequent at lower temperature, whereas tetraploid offspring derived sexually are far more frequent at higher temperatures. Temperature-dependent variability in sperm nuclear incorporation helps explain the variability in reproductive modes reported for hybrid salamanders.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Bogart, J P -- Elinson, R P -- Licht, L E -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1032-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Zoology, College of Biological Science, University of Guelph, Ontario, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587986" target="_blank"〉PubMed〈/a〉
    Keywords: Ambystoma/genetics/*physiology ; Animals ; Crosses, Genetic ; Female ; Karyotyping ; Larva ; Male ; *Polyploidy ; Sperm-Ovum Interactions ; Spermatozoa/*physiology ; Temperature
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 29
    Publication Date: 1989-11-24
    Description: Ciliary neurotrophic factor (CNTF) is one of a small number of proteins with neurotrophic activities distinct from nerve growth factor (NGF). CNTF has now been purified and cloned and the primary structure of CNTF from rabbit sciatic nerve has been determined. Biologically active CNTF has been transiently expressed from a rabbit complementary DNA clone. CNTF is a neural effector without significant sequence homologies to any previously reported protein.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lin, L F -- Mismer, D -- Lile, J D -- Armes, L G -- Butler, E T 3rd -- Vannice, J L -- Collins, F -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1023-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Protein Chemistry Group, Synergen, Inc., Boulder, CO 80301.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587985" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cell Line ; Ciliary Neurotrophic Factor ; Cloning, Molecular ; DNA/genetics ; Molecular Sequence Data ; Nerve Growth Factors/*genetics ; Nerve Tissue Proteins/biosynthesis/*genetics/isolation & purification ; Rabbits ; Recombinant Proteins/biosynthesis ; Sciatic Nerve/metabolism ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 30
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉MacDonald, H R -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):982.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Ludwig Institute for Cancer Research, Lausanne Branch, Epalinzes, Switzerland.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686027" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Immune Tolerance ; Mice ; Mice, Transgenic ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 31
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: The mature T cell receptor (TCR) repertoire is the result of selection events during T cell development. Previous assessment of TCR beta-chain selection with serologic and molecular probes demonstrated both positive and negative selection. Although this work suggested a critical role for the thymus, no direct assessment has been made of the requirement for a thymus in TCR V beta selection. A comparison of TCR V beta expression in four different congenic pairs of normal and nu/nu (athymic) mice indicated that the normal V beta deletions associated with tolerance to self minor lymphocyte stimulating (Mlsc) antigens or to self major histocompatibility complex (MHC)-encoded E alpha E beta products did not occur in most athymic mice. Thus, the thymus has a critical role in mediating self tolerance by negative selection.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hodes, R J -- Sharrow, S O -- Solomon, A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1041-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Experimental Immunology Branch, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2587987" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, Differentiation, T-Lymphocyte/genetics ; Chromosome Deletion ; Gene Expression ; Macromolecular Substances ; Major Histocompatibility Complex ; Mice ; Mice, Inbred BALB C/immunology ; Mice, Inbred Strains/immunology ; Mice, Nude/*immunology ; Receptors, Antigen, T-Cell/*genetics ; Reference Values ; Species Specificity ; T-Lymphocytes/immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 32
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: Parasitic protozoans and helminths pose considerable medical as well as scientific challenges. Investigations of the complex and very different life cycles of these organisms, their adaptation to the obligate parasitic mode of life, and their ability to face the hostile host environment have resulted in many exciting discoveries. Invasion of host erythrocytes by plasmodial sporozoites and intact skin by schistosomal cercariae are outlined as examples of the elaborate mechanisms of parasitism. Isolation and characterization of single protective antigens or subunit vaccines from these two organisms are examined as models for vaccine development. Finally, developments in exploring gene regulation in protozoans and free and parasitic nematodes are briefly outlined.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mahmoud, A A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1015-22.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Medicine, Case Western Reserve University School of Medicine, Cleveland, OH 44106.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686024" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Eukaryota/genetics/pathogenicity/*physiology ; Gene Expression Regulation ; Helminthiasis/*immunology ; Helminths/genetics/pathogenicity/*physiology ; Humans ; Molecular Sequence Data ; Protozoan Infections/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 33
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hampton, R Y -- Morand, O H -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1050.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555921" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Enzyme Activation ; Homeostasis ; Phosphotransferases/*metabolism ; Protein Kinase C/*metabolism ; *Transferases (Other Substituted Phosphate Groups)
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 34
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: T cells become tolerant of self antigens during their development in the thymus. Clonal deletion of thymocytes bearing self-reactive T cell receptors is a major mechanism for generating tolerance and occurs readily for antigens expressed by bone marrow-derived cells. Tolerance to antigens expressed on the radioresistant thymic stromal elements is demonstrated here to occur via a nondeletional mechanism. For minor lymphocyte stimulatory (Mls-1a) and major histocompatibility complex (MHC) antigens, this alternate form of tolerance induction results in clonal anergy.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ramsdell, F -- Lantz, T -- Fowlkes, B J -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1038-41.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Molecular Immunology, National Institute of Allergy and Infectious Disease, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511629" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antibodies, Monoclonal ; Antigens, CD4/analysis ; Antigens, CD8 ; Antigens, Differentiation, T-Lymphocyte ; Chimera ; Chromosome Deletion ; *Immune Tolerance ; Lymph Nodes/immunology ; Lymphocyte Activation ; Major Histocompatibility Complex ; Mice ; Mice, Inbred Strains ; Receptors, Antigen, T-Cell/immunology ; T-Lymphocytes/*immunology ; Thymus Gland/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 35
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Roth, E Jr -- Kaul, D K -- Nagel, R L -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1051.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686026" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Adhesion ; Erythrocytes/cytology/*parasitology ; Humans ; Malaria/*blood ; Plasmodium falciparum/pathogenicity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 36
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: During T cell differentiation, self tolerance is established in part by the deletion of self-reactive T cells within the thymus (negative selection). The presence of T cell receptor (TCR)-alpha beta + T cells in older athymic (nu/nu) mice indicates that some T cells can also mature without thymic influence. Therefore, to determine whether the thymus is required for negative selection, TCR V beta expression was compared in athymic nu/nu mice and their congenic normal littermates. T cells expressing V beta 3 proteins are specific for minor lymphocyte stimulatory (Mlsc) determinants and are deleted intrathymically due to self tolerance in Mlsc+ mouse strains. Here it is shown that V beta 3+ T cells are deleted in Mlsc+ BALB/c nu/+ mice, but not in their BALB/c nu/nu littermates. Thus, the thymus is required for clonal deletion during T cell development.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Fry, A M -- Jones, L A -- Kruisbeek, A M -- Matis, L A -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1044-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2511630" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Antigens, CD4/genetics ; Antigens, CD8 ; Antigens, Differentiation, T-Lymphocyte/genetics ; Flow Cytometry ; Gene Expression ; Macromolecular Substances ; Mice ; Mice, Inbred BALB C ; Mice, Inbred Strains ; Mice, Nude ; Receptors, Antigen, T-Cell/genetics ; T-Lymphocytes/*immunology ; Thymus Gland/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 37
    Publication Date: 1989-11-24
    Description: Drug development is needed to improve chemotherapy of patients with locally advanced or metastatic colon carcinoma, who otherwise have an unfavorable prognosis. DNA topoisomerase I, a nuclear enzyme important for solving topological problems arising during DNA replication and for other cellular functions, has been identified as a principal target of a plant alkaloid 20(S)-camptothecin. Significantly increased concentrations of this enzyme, compared to that in normal colonic mucosa, were found in advanced stages of human colon adenocarcinoma and in xenografts of colon cancer carried by immunodeficient mice. Several synthetic analogs of camptothecin, selected by tests with the purified enzyme and tissue-culture screens, were evaluated in the xenograft model. Unlike other anticancer drugs tested, 20(RS)-9-amino-camptothecin (9-AC) induced disease-free remissions. The overall drug toxicity was low and allowed for repeated courses of treatment.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Giovanella, B C -- Stehlin, J S -- Wall, M E -- Wani, M C -- Nicholas, A W -- Liu, L F -- Silber, R -- Potmesil, M -- CA-11655/CA/NCI NIH HHS/ -- CA-16087/CA/NCI NIH HHS/ -- CA-349636/CA/NCI NIH HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1046-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Stehlin Foundation for Cancer Research, St. Joseph Hospital, Houston, TX 77002.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2555920" target="_blank"〉PubMed〈/a〉
    Keywords: Adenocarcinoma/analysis/*drug therapy/enzymology ; Animals ; Antineoplastic Agents/*therapeutic use ; Biomarkers, Tumor/analysis ; Camptothecin/*analogs & derivatives/*therapeutic use/toxicity ; Colonic Neoplasms/analysis/*drug therapy/enzymology ; DNA Topoisomerases, Type I/analysis ; DNA, Neoplasm/analysis ; Drug Design ; Humans ; Intestinal Mucosa/enzymology ; Mice ; Mice, Inbred Strains ; Neoplasm Transplantation ; *Topoisomerase I Inhibitors ; Transplantation, Heterologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 38
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-24
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parham, P -- New York, N.Y. -- Science. 1989 Nov 24;246(4933):1050-1.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2686025" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Asparagine ; Humans ; Rabbits ; Sequence Homology, Nucleic Acid ; Serum Amyloid A Protein/*genetics ; Tryptophan ; Tyrosine ; beta 2-Microglobulin/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 39
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: Rana esculenta tropomyosin assembles in vivo into a coiled-coil alpha helix from two different subunits, alpha and beta, which are present in about equal concentrations. Although the native composition is alpha beta, a mixture of equal amounts of alpha alpha and beta beta is produced by refolding dissociated alpha and beta at low temperature in vitro. Refolding kinetics showed that alpha alpha formed first and was relatively stable with regard to chain exchange below approximately 20 degrees C. Equilibration of the homodimer mixture at 30 degrees and 34 degrees C for long times, however, resulted in the formation of the native alpha beta molecule by chain exchange. Biosynthesis of alpha beta from separate alpha and beta genes is, therefore, favored thermodynamically over the formation of homodimers, and biological factors need not be invoked to explain the preferred native alpha beta composition.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Lehrer, S S -- Qian, Y D -- Hvidt, S -- HL22461/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):926-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Muscle Research, Boston Biomedical Research Institute, MA 02114.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814515" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Kinetics ; Macromolecular Substances ; Muscle, Smooth/metabolism ; Muscles/metabolism ; Myocardium/metabolism ; Protein Conformation ; Protein Denaturation ; Protein Processing, Post-Translational ; Rana esculenta ; Thermodynamics ; Tropomyosin/genetics/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 40
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sun, M -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):876-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814506" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cattle ; Female ; *Food Labeling ; *Growth Hormone ; *Milk ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 41
    Publication Date: 1989-11-17
    Description: The zona pellucida surrounding mouse oocytes is an extracellular matrix composed of three sulfated glycoproteins, ZP1, ZP2, and ZP3. It has been demonstrated that a monoclonal antibody to ZP3 injected into female mice inhibits fertilization by binding to the zona pellucida and blocking sperm penetration. A complementary DNA encoding ZP3 was randomly cleaved and 200- to 1000-base pair fragments were cloned into the expression vector lambda gt11. This epitope library was screened with the aforementioned contraceptive antibody, and the positive clones were used to map the seven-amino acid epitope recognized by the antibody. Female mice were immunized with a synthetic peptide containing this B cell epitope coupled to a carrier protein to provide helper T cell epitopes. The resultant circulating antibodies to ZP3 bound to the zona pellucida of immunized animals and produced long-lasting contraception. The lack of ovarian histopathology or cellular cytotoxicity among the immunized animals may be because of the absence of zona pellucida T cell epitopes in this vaccine.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Millar, S E -- Chamow, S M -- Baur, A W -- Oliver, C -- Robey, F -- Dean, J -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):935-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479101" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Antigens/immunology ; Base Sequence ; Cloning, Molecular ; *Contraception ; *Contraception, Immunologic ; DNA/genetics ; *Egg Proteins ; Epitopes/analysis ; Female ; Glycoproteins/genetics/*immunology ; Male ; *Membrane Glycoproteins ; Mice ; Molecular Sequence Data ; Ovum/*physiology ; Protein Conformation ; RNA, Messenger/genetics ; *Receptors, Cell Surface ; *Vaccination ; Zona Pellucida/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 42
    Publication Date: 1989-11-17
    Description: The BAS1 and BAS2 proteins are both required for activation of GCN4-independent (basal) HIS4 transcription in yeast. BAS1 has an NH2-terminal region similar to those of the myb proto-oncogene family. BAS1 and BAS2, which contains a homeo box, bound to adjacent sites on the HIS4 promoter. The joint requirement of BAS1 and BAS2 for activation is probably not due to cooperative binding or the transcriptional control of one of the genes by the other. Although BAS1 and BAS2 were both required for activation of HIS4 transcription, BAS1 was not required for BAS2-dependent expression of the secreted acid phosphatases. The transcriptional activators of HIS4 have DNA binding domains that are conserved in evolution (BAS1 = Myb, BAS2 = homeo box, GCN4 = Jun). Their interactions, therefore, may be relevant to the control of gene expression in more complex systems.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Tice-Baldwin, K -- Fink, G R -- Arndt, K T -- GM35010/GM/NIGMS NIH HHS/ -- GM39892/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):931-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Cold Spring Harbor Laboratory, NY 11724.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683089" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Fungal Proteins/*genetics ; *Gene Expression Regulation ; *Genes, Fungal ; Molecular Sequence Data ; Proto-Oncogene Proteins/*genetics ; Proto-Oncogene Proteins c-myb ; Saccharomyces cerevisiae/*genetics ; *Saccharomyces cerevisiae Proteins ; Sequence Homology, Nucleic Acid ; *Trans-Activators ; *Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 43
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-17
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Crease, R P -- New York, N.Y. -- Science. 1989 Nov 17;246(4932):883-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479100" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; England ; Gramicidin/*history ; History, 20th Century ; Humans ; Microbiology/history ; Penicillins/*history ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 44
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: A method was developed for selectively isolating genes from localized regions of the human genome that are contained in interspecific hybrid cells. Complementary human DNA was prepared from a human-rodent somatic cell hybrid that contained less than 1% human DNA, by using consensus 5' intron splice sequences as primers. These primers would select immature, unspliced messenger RNA (still retaining species-specific repeat sequences) as templates. Screening a derived complementary DNA library for human repeat sequences resulted in the isolation of human clones at the anticipated frequency with characteristics expected of exons of transcribed human genes--single copy sequences that hybridized to discrete bands on Northern (RNA) blots.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Liu, P -- Legerski, R -- Siciliano, M J -- GM19436/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):813-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular Genetics, University of Texas, M.D. Anderson Cancer Center, Houston 77030.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2479099" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Blotting, Northern ; Blotting, Southern ; Chromosome Mapping ; Chromosomes, Human, Pair 19 ; Cloning, Molecular ; Cricetinae ; DNA/biosynthesis/genetics/*isolation & purification ; Humans ; *Hybrid Cells ; Introns ; Nucleic Acid Hybridization ; RNA/genetics ; Repetitive Sequences, Nucleic Acid ; Restriction Mapping ; Templates, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 45
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Holden, C -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):754-6.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814497" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Entomology/*trends ; Insect Vectors/*physiology ; Insects/classification/*physiology ; Research Support as Topic ; United States
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 46
    Publication Date: 1989-11-10
    Description: A substitution mutation has been introduced into the c-abl locus of murine embryonic stem cells by homologous recombination between exogenously added DNA and the endogenous gene, and these cells have been used to generate chimeric mice. It is shown that the c-abl mutation was transmitted to progeny by several male chimeras. This work demonstrates the feasibility of germ-line transmission of a mutation introduced into a nonselectable autosomal gene by homologous recombination.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Schwartzberg, P L -- Goff, S P -- Robertson, E J -- P01 CA 23767/CA/NCI NIH HHS/ -- R01 HD 25208/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):799-803.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Molecular Biophysics, Columbia University, College of Physicians & Surgeons, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554496" target="_blank"〉PubMed〈/a〉
    Keywords: Abelson murine leukemia virus/*genetics ; Animals ; Blotting, Southern ; Cell Line ; Chimera ; Cloning, Molecular ; *DNA, Recombinant ; Female ; Leukemia Virus, Murine/*genetics ; Male ; Mice ; Mice, Inbred C57BL ; *Mutation ; Oncogenes/*physiology ; Retroviridae Proteins, Oncogenic/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 47
    Publication Date: 1989-11-10
    Description: Genomic sequencing permits studies of in vivo DNA methylation and protein-DNA interactions, but its use has been limited because of the complexity of the mammalian genome. A newly developed genomic sequencing procedure in which a ligation mediated polymerase chain reaction (PCR) is used generates high quality, reproducible sequence ladders starting with only 1 microgram of uncloned mammalian DNA per reaction. Different sequence ladders can be created simultaneously by inclusion of multiple primers and visualized separately by rehybridization. Relatively little radioactivity is needed for hybridization and exposure times are short. Methylation patterns in genomic DNA are readily detectable; for example, 17 CpG dinucleotides in the 5' region of human X-linked PGK-1 (phosphoglycerate kinase 1) were found to be methylated on an inactive human X chromosome, but unmethylated on an active X chromosome.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pfeifer, G P -- Steigerwald, S D -- Mueller, P R -- Wold, B -- Riggs, A D -- AG08196/AG/NIA NIH HHS/ -- GM355262BW/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):810-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Molecular Biology Section, Beckman Research Institute of the City of Hope, Duarte, CA 91010.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814502" target="_blank"〉PubMed〈/a〉
    Keywords: 5-Methylcytosine ; Animals ; Autoradiography ; Base Sequence ; Cytosine ; DNA/*genetics/metabolism ; Exons ; HeLa Cells ; Humans ; Methylation ; Molecular Sequence Data ; *Nucleic Acid Amplification Techniques ; *Nucleic Acid Hybridization ; Phosphoglycerate Kinase/genetics ; Polymerase Chain Reaction/*methods ; Promoter Regions, Genetic ; X Chromosome
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 48
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: Voltage clamp recordings and noise analysis from pyramidal cells in hippocampal slices indicate that N-methyl-D-aspartate (NMDA) receptors are tonically active. On the basis of the known concentration of glutamate in the extracellular fluid, this tonic action is likely caused by the ambient glutamate level. NMDA receptors are voltage-sensitive, thus background activation of these receptors imparts a regenerative electrical property to pyramidal cells, which facilitates the coupling between dendritic excitatory synaptic input and somatic action potential discharge in these neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sah, P -- Hestrin, S -- Nicoll, R A -- MH-0037/MH/NIMH NIH HHS/ -- MH-38256/MH/NIMH NIH HHS/ -- N5-24205/PHS HHS/ -- etc. -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):815-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573153" target="_blank"〉PubMed〈/a〉
    Keywords: 2-Amino-5-phosphonovalerate/pharmacology ; Action Potentials ; Algorithms ; Animals ; Aspartic Acid/antagonists & inhibitors/metabolism ; Extracellular Space/metabolism ; Glutamates/*metabolism ; Glutamic Acid ; Hippocampus/*physiology ; Least-Squares Analysis ; Magnesium/pharmacology ; Microelectrodes ; N-Methylaspartate ; Neurons/*physiology ; Rats ; Receptors, N-Methyl-D-Aspartate ; Receptors, Neurotransmitter/*physiology ; Synapses/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 49
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: In vivo protein-DNA interactions at the developmentally regulated enhancer of the mouse muscle creatine kinase (MCK) gene were examined by a newly developed polymerase chain reaction (PCR) footprinting procedure. This ligation mediated, single-sided PCR technique permits the exponential amplification of an entire sequence ladder. Several footprints were detected in terminally differentiated muscle cells where the MCK gene is actively transcribed. None were observed in myogenic cells prior to differentiation or in nonmuscle cells. Two footprints appear to correspond to sites that can bind the myogenic regulator MyoD1 in vitro, whereas two others represent muscle specific use of apparently general factors. Because MyoD1 is synthesized by undifferentiated myoblasts, these data imply that additional regulatory mechanisms must restrict the interaction between this protein and its target site prior to differentiation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Mueller, P R -- Wold, B -- GM35526/GM/NIGMS NIH HHS/ -- RR07003/RR/NCRR NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):780-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814500" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Binding Sites ; Cell Line ; Creatine Kinase/*genetics ; DNA/*analysis/metabolism ; DNA-Binding Proteins/genetics/metabolism ; *Enhancer Elements, Genetic ; *Gene Amplification ; Gene Expression ; Genes, Regulator ; Mice ; Molecular Sequence Data ; Muscles/*enzymology ; *Polymerase Chain Reaction ; Protein Binding ; Protein Processing, Post-Translational ; Templates, Genetic ; Transcription Factor AP-2 ; Transcription Factors/genetics/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 50
    Publication Date: 1989-11-10
    Description: A sea urchin (Strongylocentrotus purpuratus) messenger RNA encoding a protein (SpEGF2) related to epidermal growth factor (EGF) was identified. The full-length complementary DNA sequence predicts a protein with an unusually simple structure, including four tandem EGF-like repeats and a hydrophobic leader, but lacking a potential transmembrane domain. Sequence similarities suggest that the peptides are homologous to two peptides from a different sea urchin species, which cause a classic developmental defect, exogastrulation, when added to the seawater outside of embryos. The SpEGF2 messenger RNA begins to accumulate at blastula stage, and in pluteus larvae it is distributed in discrete regions of ectoderm that are not congruent with known histological borders. One region corresponds to that expressing the homeodomain-containing protein, SpHbox1. The structure of the SpEGF2 protein and the pattern of accumulation of its messenger RNA suggest that it may have important functions as a secreted factor during development of sea urchin embryos.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yang, Q -- Angerer, L M -- Angerer, R C -- GM25553/GM/NIGMS NIH HHS/ -- HD602/HD/NICHD NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):806-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, University of Rochester, NY 14627.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814501" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Codon/genetics ; DNA/*genetics ; Epidermal Growth Factor/*genetics/physiology ; Molecular Sequence Data ; Nucleic Acid Hybridization ; RNA, Messenger/*biosynthesis ; Repetitive Sequences, Nucleic Acid ; Sea Urchins/embryology/*genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 51
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):747-9.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2633774" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/therapy ; Animals ; Antigens, CD4/administration & dosage ; *Biocompatible Materials ; Drug Implants ; Genetic Therapy/*methods ; Humans ; *Organoids ; *Prostheses and Implants
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 52
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Culliton, B J -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):749.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814493" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Dogs ; Endothelium/*cytology ; Genetic Therapy/*methods ; Humans ; Swine ; Swine, Miniature
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 53
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-10
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barinaga, M -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):756-7.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814498" target="_blank"〉PubMed〈/a〉
    Keywords: *Animal Welfare ; Animals ; *Animals, Laboratory ; Research/*standards
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 54
    Publication Date: 1989-11-10
    Description: Thymotaxin, an 11-kilodalton protein chemotactic for rat bone marrow hematopoietic precursors, was purified from media conditioned by a rat thymic epithelial cell line. The NH2-terminal sequence of thymotaxin was identical to that of rat beta 2-microglobulin (beta 2m). Antibodies to beta 2m removed thymotaxin activity from the fraction containing the 11-kilodalton protein. Chemotactic activity was observed with rat plasma beta 2m, human beta 2m, and mouse recombinant beta 2m, further supporting the identity of thymotaxin with beta 2m. The directional migration, as opposed to random movement, of the cells was also confirmed. The only rat bone marrow cells that migrated toward beta 2m were Thy1+ immature lymphoid cells devoid of T cell, B cell, and myeloid cell differentiation markers.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dargemont, C -- Dunon, D -- Deugnier, M A -- Denoyelle, M -- Girault, J M -- Lederer, F -- Le, K H -- Godeau, F -- Thiery, J P -- Imhof, B A -- New York, N.Y. -- Science. 1989 Nov 10;246(4931):803-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratoire de Physiopathologie du Developpement CNRS, Paris, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683083" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bone Marrow Cells ; Cell Line ; Cell Movement/drug effects ; Chemotactic Factors/*pharmacology ; *Chemotaxis ; Chromatography, Gel ; Chromatography, High Pressure Liquid ; Electrophoresis, Polyacrylamide Gel ; Granulocytes/drug effects ; Hematopoietic Stem Cells/drug effects ; Rats ; beta 2-Microglobulin/*pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 55
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: In each cell cycle the complex structure of the chromosome must be replicated accurately. In the last few years there have been major advances in understanding eukaryotic chromosome replication. Patterns of replication origins have been mapped accurately in yeast chromosomes. Cellular replication proteins have been identified by fractionating cell extracts that replicate viral DNA templates in vitro. Cell-free systems that initiate eukaryotic DNA replication in vitro have demonstrated the importance of complex nuclear architecture in the control of DNA replication. Although the events of S phase were relatively neglected for many years, knowledge of DNA replication is now advancing rapidly in step with other phases of the cell cycle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Laskey, R A -- Fairman, M P -- Blow, J J -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):609-14.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Zoology, University of Cambridge, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683076" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Nucleus/physiology/ultrastructure ; Chromatin/physiology ; Chromosomes/physiology ; *DNA Replication ; *Interphase ; Models, Biological ; Transcription, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 56
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: Several evolutionarily conserved proteins constitute a universal mitotic trigger that is precisely controlled during the orderly cell divisions of embryogenesis. As development progresses, the mechanisms controlling this trigger change. Early divisions are executed by maternally synthesized gene products, and in Xenopus they are timed by the accumulation and periodic degradation of cyclin, a trigger component. Later, the zygotic genome assumes control, and in Drosophila, zygotic transcription is required for production of another trigger protein, the product of string. After this transition to zygotic control, pulses of string transcription define the timing of highly patterned embryonic cell divisions and cyclin accumulation is not rate limiting.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉O'Farrell, P H -- Edgar, B A -- Lakich, D -- Lehner, C F -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):635-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry and Biophysics, School of Medicine, University of California, San Francisco 94143.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683080" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Division ; Drosophila/embryology/*growth & development ; Embryo, Nonmammalian/*physiology ; Gene Expression ; Mitosis ; Xenopus/*growth & development
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 57
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: The ability to clone large fragments of DNA in yeast artificial chromosomes (YAC's) has created the possibility of obtaining global physical maps of complex genomes. For this application to be feasible, most sequences in complex genomes must be able to be cloned in YAC's, and most clones must be genetically stable and colinear with the genomic sequences from which they originated (that is, not liable to undergo rearrangement). These requirements have been met with a YAC library containing DNA fragments from Drosophila melanogaster ranging in size up to several hundred kilobase pairs. Preliminary characterization of the Drosophila YAC library was carried out by in situ hybridization of random clones and analysis of clones containing known sequences. The results suggest that most euchromatic sequences can be cloned. The library also contains clones in which the inserted DNA is derived from the centromeric heterochromatin. The locations of 58 clones collectively representing about 8 percent of the euchromatic genome are presented.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Garza, D -- Ajioka, J W -- Burke, D T -- Hartl, D L -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):641-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, Washington University School of Medicine, St. Louis, MO 63110-1095.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510296" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Chromosome Mapping ; Chromosomes, Fungal ; Cloning, Molecular ; Drosophila melanogaster/*genetics ; *Genes ; Genomic Library ; Heterochromatin/analysis ; Recombination, Genetic ; Saccharomyces cerevisiae/genetics ; Salivary Glands/cytology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 58
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: An 88-base pair fragment in the core promoter of the human hepatitis B virus (HBV) contains a functional promoter and a strong liver-specific enhancer. This enhancer functions in human hepatoma cells, where it is much more active than the previously described HBV enhancer in stimulating expression of the linked bacterial chloramphenicol acetyltransferase gene expressed from heterologous promoters. Studies of the role of this enhancer-promoter in HBV may help to clarify mechanisms of gene expression in cells infected with HBV and the role of the virus in the pathogenesis of hepatitis and hepatocellular carcinoma.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Yee, J K -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):658-61.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pediatrics, School of Medicine, University of California, San Diego, La Jolla 92093.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2554495" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cell Line ; Chloramphenicol O-Acetyltransferase/genetics ; Chromosome Deletion ; *Enhancer Elements, Genetic ; *Genes, Viral ; Hepatitis B virus/*genetics ; Liver/*metabolism ; Molecular Sequence Data ; Mutation ; *Promoter Regions, Genetic ; Simplexvirus/enzymology/genetics ; Thymidine Kinase/genetics ; Transcription, Genetic ; Transfection ; Viral Structural Proteins/genetics
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 59
    Publication Date: 1989-11-03
    Description: The crystals of most proteins or other biological macromolecules are poorly ordered and diffract to lower resolutions than those observed for most crystals of simple organic and inorganic compounds. Crystallization in the microgravity environment of space may improve crystal quality by eliminating convection effects near growing crystal surfaces. A series of 11 different protein crystal growth experiments was performed on U.S. space shuttle flight STS-26 in September 1988. The microgravity-grown crystals of gamma-interferon D1, porcine elastase, and isocitrate lyase are larger, display more uniform morphologies, and yield diffraction data to significantly higher resolutions than the best crystals of these proteins grown on Earth.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉DeLucas, L J -- Smith, C D -- Smith, H W -- Vijay-Kumar, S -- Senadhi, S E -- Ealick, S E -- Carter, D C -- Snyder, R S -- Weber, P C -- Salemme, F R -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):651-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉University of Alabama, Center for Macromolecular Crystallography, Birmingham 35294.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2510297" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Crystallization ; Interferon-gamma ; Isocitrate Lyase ; Pancreatic Elastase ; *Proteins ; Space Flight ; Swine ; *Weightlessness
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 60
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pool, R -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):580.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814485" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Crystallization ; Isocitrate Lyase ; Pancreas/enzymology ; Pancreatic Elastase ; *Proteins ; Space Flight ; Swine ; *Weightlessness ; X-Ray Diffraction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 61
    Publication Date: 1989-11-03
    Description: Experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system mediated by CD4+ T cells reactive with myelin basic protein (MBP). Rats were rendered resistant to the induction of EAE by vaccination with synthetic peptides corresponding to idiotypic determinants of the beta chain VDJ region and J alpha regions of the T cell receptor (TCR) that are conserved among encephalitogenic T cells. These findings demonstrate the utility of TCR peptide vaccination for modulating the activity of autoreactive T cells and represent a general therapeutic approach for T cell-mediated pathogenesis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Howell, M D -- Winters, S T -- Olee, T -- Powell, H C -- Carlo, D J -- Brostoff, S W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):668-70.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Immune Response Corporation, San Diego, CA 92121.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814489" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Encephalomyelitis, Autoimmune, Experimental/*immunology/prevention & control ; Immunotherapy ; Macromolecular Substances ; Mice ; Mice, Inbred Strains ; Molecular Sequence Data ; Peptides/administration & dosage/chemical synthesis/immunology ; Rats ; Rats, Inbred Lew ; Receptors, Antigen, T-Cell/genetics/*immunology ; Sequence Homology, Nucleic Acid ; *Vaccination
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 62
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: Data that describe both the structure and the physiology of the mitotic spindle are reviewed. Some of the molecules that have been shown to play a role in mitosis are tabulated, and how mitosis might work is considered.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉McIntosh, J R -- Koonce, M P -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):622-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder 80309.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683078" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chromosomes/physiology/ultrastructure ; *Mitosis ; Spindle Apparatus/physiology/ultrastructure
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 63
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: We review the recent advances in understanding transitions within the cell cycle. These have come from both genetic and biochemical approaches. We discuss the phylogenetic conservation of the mechanisms that induce mitosis and their implications for other transitions in the cell cycle.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Murray, A W -- Kirschner, M W -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):614-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, School of Medicine, University of California, San Francisco 94143-0448.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683077" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Cycle ; *Genes, Regulator ; Interphase ; Mitosis ; *Models, Biological ; Models, Genetic ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 64
    Publication Date: 1989-11-03
    Description: Rejection of bone marrow grafts in irradiated mice is mediated by natural killer (NK) cells and is controlled by genes linked to the major histocompatibility complex (MHC). It has, however, not been possible to identify the genes or their products. An MHC class I (Dd) transgene introduced in C57BL donors prevented the rejection of their bone marrow by NK cells in irradiated allogeneic and F1 hybrid mice expressing the Dd gene. Conversely, H-2Dd transgenic C57BL recipients acquired the ability to reject bone marrow from C57BL donors but not from H-2Dd transgenic C57BL donors. These results provide formal evidence that NK cells are part of a system capable of rejecting cells because they lack normal genes of the host type, in contrast to T cells, which recognize cells that contain abnormal or novel sequences of non-host type.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Ohlen, C -- Kling, G -- Hoglund, P -- Hansson, M -- Scangos, G -- Bieberich, C -- Jay, G -- Karre, K -- 1 ROI CA 44882-01/CA/NCI NIH HHS/ -- 5 ROI CA-25250-06/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):666-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Tumor Biology, Karolinska Institute, Stockholm, Sweden.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814488" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Bone Marrow Transplantation ; *Genes, MHC Class I ; *Graft Rejection ; H-2 Antigens/*genetics ; Killer Cells, Natural/immunology ; Mice ; Mice, Inbred BALB C ; Mice, Inbred C57BL ; Mice, Transgenic ; Transplantation, Homologous
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 65
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: The events of the cell cycle of most organisms are ordered into dependent pathways in which the initiation of late events is dependent on the completion of early events. In eukaryotes, for example, mitosis is dependent on the completion of DNA synthesis. Some dependencies can be relieved by mutation (mitosis may then occur before completion of DNA synthesis), suggesting that the dependency is due to a control mechanism and not an intrinsic feature of the events themselves. Control mechanisms enforcing dependency in the cell cycle are here called checkpoints. Elimination of checkpoints may result in cell death, infidelity in the distribution of chromosomes or other organelles, or increased susceptibility to environmental perturbations such as DNA damaging agents. It appears that some checkpoints are eliminated during the early embryonic development of some organisms; this fact may pose special problems for the fidelity of embryonic cell division.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hartwell, L H -- Weinert, T A -- GM17709/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):629-34.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Genetics, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683079" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Cycle ; DNA Replication ; Embryo, Mammalian/physiology ; Embryo, Nonmammalian ; Models, Biological ; Models, Genetic ; Time Factors
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 66
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: Cells prepare for S phase during the G1 phase of the cell cycle. Cell biological methods have provided knowledge of cycle kinetics and of substages of G1 that are determined by extracellular signals. Through the use of biochemical and molecular biological techniques to study effects of growth factors, oncogenes, and inhibitors, intracellular events during G1 that lead to DNA synthesis are rapidly being discovered. Many cells in vivo are in a quiescent state (G0), with unduplicated DNA. Cells can be activated to reenter the cycle during G1. Similarly, cells in culture can be shifted between G0 and G1. These switches in and out of G1 are the main determinants of post-embryonic cell proliferation rate and are defectively controlled in cancer cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pardee, A B -- 24571/PHS HHS/ -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):603-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683075" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Cycle ; *Cell Division ; Cell Membrane/physiology ; Cell Nucleus/physiology ; Gene Expression ; Humans ; *Interphase ; Models, Biological ; Neoplasms/pathology ; Signal Transduction
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 67
    Publication Date: 1989-11-03
    Description: A complementary DNA (cDNA) for ubiquitin carboxyl-terminal hydrolase isozyme L3 was cloned from human B cells. The cDNA encodes a protein of 230 amino acids with a molecular mass of 26.182 daltons. The human protein is very similar to the bovine homolog, with only three amino acids differing in over 100 residues compared. The amino acid sequence deduced from the cDNA was 54% identical to that of the neuron-specific protein PGP 9.5. Purification of bovine PGP 9.5 confirmed that it is also a ubiquitin carboxyl-terminal hydrolase. These results suggest that a family of such related proteins exists and that their expression is tissue-specific.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Wilkinson, K D -- Lee, K M -- Deshpande, S -- Duerksen-Hughes, P -- Boss, J M -- Pohl, J -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):670-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biochemistry, Emory University School of Medicine, Atlanta, GA 30322.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2530630" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; B-Lymphocytes/enzymology ; Base Sequence ; Cattle ; DNA/genetics ; Humans ; Isoenzymes/genetics ; Molecular Sequence Data ; Neuropeptides/*genetics/isolation & purification ; Sequence Homology, Nucleic Acid ; Thiolester Hydrolases/*genetics/isolation & purification ; Ubiquitin Thiolesterase
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 68
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-11-03
    Description: Stimulation of phosphoinositide hydrolysis by excitatory amino acids was studied in synaptoneurosomes of kitten striate cortex at several postnatal ages. Ibotenate and glutamate stimulated phosphoinositide turnover during the second and third postnatal months; N-methyl-D-aspartate and DL-alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) were without effect. The developmental profile of ibotenate-stimulated phosphoinositide turnover parallels the postnatal changes in cortical susceptibility to visual deprivation. The transient increase in ibotenate-stimulated phosphoinositide turnover does not occur in visual cortex of kittens reared in complete darkness.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dudek, S M -- Bear, M F -- New York, N.Y. -- Science. 1989 Nov 3;246(4930):673-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Center for Neural Science, Brown University, Providence, RI 02912.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2573152" target="_blank"〉PubMed〈/a〉
    Keywords: Aging ; Animals ; Aspartic Acid/pharmacology ; Carbachol/pharmacology ; Cattle ; Glutamates/pharmacology ; Glutamic Acid ; Ibotenic Acid/pharmacology ; N-Methylaspartate ; Ocular Physiological Phenomena ; Phosphatidylinositols/*metabolism ; Synapses/drug effects/metabolism/*physiology ; Vision, Ocular ; Visual Cortex/*growth & development/metabolism/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 69
    Publication Date: 1989-10-27
    Description: Host cell factors act together with regulatory genes of the human immunodeficiency virus (HIV) to control virus production. Human-Chinese hamster ovary hybrid cell clones were used to probe for human chromosomes involved in regulating HIV gene expression. DNA transfection experiments showed that 4 of 18 clones had high levels of HIV gene expression measured by both extracellular virus production and transactivation of the HIV long terminal repeat in the presence of the trans-activator (tat) gene. Karyotype analyses revealed a 94% concordance (17/18) between human chromosome 12 and HIV gene expression. Other chromosomes had an 11 to 72% concordance with virus production.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Hart, C E -- Ou, C Y -- Galphin, J C -- Moore, J -- Bacheler, L T -- Wasmuth, J J -- Petteway, S R Jr -- Schochetman, G -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):488-91.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Centers for Disease Control, Atlanta, GA 30333.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683071" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chloramphenicol O-Acetyltransferase/genetics ; *Chromosomes, Human, Pair 12 ; Cricetinae ; Cricetulus ; Gene Expression Regulation, Viral/*genetics ; Genes, tat ; HIV-1/*genetics ; Humans ; Hybrid Cells ; Repetitive Sequences, Nucleic Acid ; Transcriptional Activation
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 70
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Birds are widely distributed, highly diversified, and exhibit behavior and social organizations equal in complexity to mammals, yet they are generally more conspicuous and approachable in natural environments. These attributes make birds excellent subjects in many areas of biological research. The topics in which studies on birds have figured prominently include the mechanisms of species formation, the regulation of the distribution and abundance of animals, the effects of the environment on behavior and physiology, the biological and evolutionary significance of variations in social organizations, the encoding of information in animal communication, the sensory basis for migration and navigation, the effects of hormones on nerve cells and behavior, the ontogeny of brain and behavior, and the structure and function of the vertebrate brain. The outstanding record of avian research suggests that birds will continue to provide important models for developing and testing new ideas in various fields of biology.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Konishi, M -- Emlen, S T -- Ricklefs, R E -- Wingfield, J C -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):465-72.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Biology, California Institute of Technology, Pasadena 91125.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683069" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptation, Physiological ; Animals ; Behavior, Animal/physiology ; Biological Evolution ; Biology/*methods ; Birds/*physiology ; Ecology ; Ethology/methods ; Neurobiology/methods
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 71
    Publication Date: 1989-10-27
    Description: Immunization with chemically detoxified pertussis toxin can prevent severe whooping cough with an efficacy similar to that of the cellular pertussis vaccine, which normally gives unwanted side effects. To avoid the reversion to toxicity and the loss of immunogenicity that may follow chemical treatment of pertussis toxin, inactive toxins were constructed by genetic manipulation. A number of genetically engineered alleles of the pertussis toxin genes, constructed by replacing either one or two key amino acids within the enzymatically active S1 subunit, were introduced into the chromosome of strains of Bordetella pertussis, B. parapertussis, and B. bronchiseptica. These strains produce mutant pertussis toxin molecules that are nontoxic and immunogenic and that protect mice from the intracerebral challenge with virulent Bordetella pertussis. Such molecules are ideal for the development of new and safer vaccines against whooping cough.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Pizza, M -- Covacci, A -- Bartoloni, A -- Perugini, M -- Nencioni, L -- De Magistris, M T -- Villa, L -- Nucci, D -- Manetti, R -- Bugnoli, M -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):497-500.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Sclavo Research Center, Siena, Italy.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683073" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Female ; Genetic Techniques ; Mice ; Mice, Inbred BALB C ; Mutation ; *Pertussis Toxin ; Pertussis Vaccine/*toxicity ; Rabbits ; Vaccines, Synthetic/toxicity ; Virulence Factors, Bordetella/genetics/immunology/*toxicity
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 72
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: Expression of the c-myc oncogene is deregulated in a variety of malignancies. Rearrangement and mutation of the c-myc locus is a characteristic feature of human Burkitt's lymphoma. Whether deregulation is solely a result of mutation of c-myc or whether it is influenced by the transformed B cell context has not been determined. A translocated and mutated allele of c-myc was stably transfected into fibroblasts. The rearranged allele was expressed indistinguishably from a normal c-myc gene: it had serum-regulated expression, was transcribed with normal promoter preference, and was strongly attenuated. Thus mutations by themselves are insufficient to deregulate c-myc transcription.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Richman, A -- Hayday, A -- 40364/PHS HHS/ -- GM 07499/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):494-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biology Department, Yale University, New Haven, CT 06511.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2683072" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Burkitt Lymphoma/genetics ; Cell Line ; Fibroblasts/metabolism ; Gene Expression Regulation, Neoplastic ; Humans ; Mutation ; Oncogenes/*genetics ; Proto-Oncogene Proteins/biosynthesis/*genetics ; Proto-Oncogene Proteins c-myc ; *Transfection ; Translocation, Genetic
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 73
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Frisch, R E -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):432.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814472" target="_blank"〉PubMed〈/a〉
    Keywords: Adult ; Animals ; Body Weight/*physiology ; Cricetinae ; Female ; Fertility/*physiology ; Humans ; Mesocricetus
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 74
    Publication Date: 1989-10-27
    Description: Activation of protein kinase C is thought to require association of the kinase with the cell membrane. It has been assumed that cellular substrates for the kinase must likewise be associated with membranes, and previous studies with membrane-associated myristoylated proteins have supported this view. It is now shown that a mutation that prevents the normal amino-terminal myristoylation of a prominent cellular substrate of protein kinase C, and appears to prevent its membrane association, does not prevent the normal phosphorylation of this protein in intact cells in response to phorbol esters. Thus, membrane association may not be required in order for protein kinase C substrates to undergo phosphorylation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Graff, J M -- Gordon, J I -- Blackshear, P J -- 2T32-GM 07171/GM/NIGMS NIH HHS/ -- AI27179/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):503-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute Laboratories, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814478" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Chickens ; Enzyme Activation ; *Intracellular Signaling Peptides and Proteins ; Membrane Proteins/metabolism ; Mutation ; Myristic Acid ; Myristic Acids ; Phosphorylation ; Protein Kinase C/*metabolism ; Proteins/*metabolism ; Substrate Specificity ; Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 75
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-27
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Barinaga, M -- New York, N.Y. -- Science. 1989 Oct 27;246(4929):446.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2814474" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Genetic Vectors ; Male ; Mice ; Mice, Transgenic ; Reproducibility of Results ; *Spermatozoa ; *Transfection
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 76
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-20
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Koppenol, W H -- Bounds, P L -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):311.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Biodynamics Institute and Departments of Chemistry and Biochemistry, Louisiana State University, Baton Rouge, LA 70803, USA.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799389" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dose-Response Relationship, Radiation ; Humans ; *Radiation, Ionizing
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 77
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-20
    Description: Fish represent the largest and most diverse group of vertebrates. Their evolutionary position relative to other vertebrates and their ability to adapt to a wide variety of environments make them ideal for studying both organismic and molecular evolution. A number of other characteristics make them excellent experimental models for studies in embryology, neurobiology, endocrinology, environmental biology, and other areas. In fact, they have played a critical role in the development of several of these disciplines. Research techniques that enable scientists to make isogenic lines in a single generation, create and maintain mutants, culture cells, and transfer cloned genes into embryos signal an increasing role for fish as experimental models.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Powers, D A -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):352-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Hopkins Marine Station, Stanford University, Pacific Grove, CA 93950〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2678474" target="_blank"〉PubMed〈/a〉
    Keywords: Adaptation, Biological ; Animals ; Developmental Biology/methods ; Endocrinology/methods ; Fish Diseases/etiology ; Fishes/*physiology ; Models, Biological ; Neoplasms/etiology/veterinary ; Neurobiology/methods ; Toxicology/methods
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 78
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-20
    Description: The basal ganglia, of which the striatum is the major component, process inputs from virtually all cerebral cortical areas to affect motor, emotional, and cognitive behaviors. Insights into how these seemingly disparate functions may be integrated have emerged from studies that have demonstrated that the mammalian striatum is composed of two compartments arranged as a mosaic, the patches and the matrix, which differ in their neurochemical and neuroanatomical properties. In this study, projections from prefrontal, cingulate, and motor cortical areas to the striatal compartments were examined with the Phaseolus vulgaris-leucoagglutinin (PHA-L) anterograde axonal tracer in rats. Each cortical area projects to both the patches and the matrix of the striatum; however, deep layer V and layer VI corticostriatal neurons project principally to the patches, whereas superficial layer V and layer III and II corticostriatal neurons project principally to the matrix. The relative contribution of patch and matrix corticostriatal projections varies among the cortical areas examined such that allocortical areas provide a greater number of inputs to the patches than to the matrix, whereas the reverse obtains for neocortical areas. These results demonstrate that the compartmental organization of corticostriatal inputs is related to their laminar origin and secondarily to the cytoarchitectonic area of origin.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gerfen, C R -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):385-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799392" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Corpus Striatum/*anatomy & histology ; Immunohistochemistry ; Phytohemagglutinins ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 79
    Publication Date: 1989-10-20
    Description: A 73-kilodalton (kD) intracellular protein was found to bind to peptide regions that target intracellular proteins for lysosomal degradation in response to serum withdrawal. This protein cross-reacted with a monoclonal antibody raised to a member of the 70-kD heat shock protein (hsp70) family, and sequences of two internal peptides of the 73-kD protein confirm that it is a member of this family. In response to serum withdrawal, the intracellular concentration of the 73-kD protein increased severalfold. In the presence of adenosine 5'-triphosphate (ATP) and MgCl2, the 73-kD protein enhanced protein degradation in two different cell-free assays for lysosomal proteolysis.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Chiang, H L -- Terlecky, S R -- Plant, C P -- Dice, J F -- AG06116/AG/NIA NIH HHS/ -- DK07542/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 20;246(4928):382-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology, Tufts University School of Medicine, Boston, MA 02111.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799391" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Cells, Cultured ; Heat-Shock Proteins/genetics/*physiology ; Immunoblotting ; Lysosomes/*metabolism ; Molecular Sequence Data ; Rats ; Ribonuclease, Pancreatic/genetics/*metabolism ; Sequence Homology, Nucleic Acid
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 80
    Publication Date: 1989-10-13
    Description: Autologous peripheral nerve grafts were used to permit and direct the regrowth of retinal ganglion cell axons from the eye to the ipsilateral superior colliculus of adult hamsters in which the optic nerves had been transected within the orbit. Extracellular recordings in the superior colliculus 15 to 18 weeks after graft insertion revealed excitatory and inhibitory postsynaptic responses to visual stimulation. The finding of light-induced responses in neurons in the superficial layers of the superior colliculus close to the graft indicates that axons regenerating from axotomized retinal ganglion cells can establish electrophysiologically functional synapses with neurons in the superior colliculus of these adult mammals.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Keirstead, S A -- Rasminsky, M -- Fukuda, Y -- Carter, D A -- Aguayo, A J -- Vidal-Sanz, M -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):255-7.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Neurosciences Unit, Montreal General Hospital, Quebec, Canada.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799387" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Axons/physiology ; Cricetinae ; Mesocricetus ; Nerve Regeneration/*physiology ; Optic Nerve/*physiology ; Photic Stimulation ; Retinal Ganglion Cells/physiology ; Superior Colliculi/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 81
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Linsk, R -- Gottesman, M -- Pernis, B -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):261.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Microbiology, Columbia University, New York, NY 10032.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799388" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Gene Expression Regulation ; Genes, MHC Class I/physiology ; Immune Tolerance/*genetics ; Organ Specificity/*genetics ; Thymus Gland/physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 82
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: Lectins on cell surfaces mediate cell-cell interactions by combining with complementary carbohydrates on apposing cells. They play a key role in the control of various normal and pathological processes in living organisms.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sharon, N -- Lis, H -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):227-34.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biophysics, Weizmann Institute of Science, Rehovot, Israel.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2552581" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bacterial Physiological Phenomena ; Cell Communication/*physiology ; Cell Differentiation ; Entamoeba histolytica/physiology ; Fabaceae/physiology ; Humans ; Lectins/*physiology ; Myxomycetes/physiology ; Orthomyxoviridae/physiology ; Plant Lectins ; Plants, Medicinal
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 83
    Publication Date: 1989-10-13
    Description: Interleukin-1 (IL-1) is a major regulator of inflammation and immunity. IL-1 induces T lymphocyte growth by acting as a second signal (together with antigen) in enhancing the production of interleukin-2 (IL-2). An IL-1-responsive element in the promoter region of the human IL-2 gene was similar to the binding site for the transcription factor AP-1. IL-1 enhanced expression of c-jun messenger RNA, whereas the antigenic signal enhanced messenger RNA expression of c-fos. Thus, the two components of the AP-1 factor are independently regulated and the AP-1 factor may serve as a nuclear mediator for the many actions of IL-1 on cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Muegge, K -- Williams, T M -- Kant, J -- Karin, M -- Chiu, R -- Schmidt, A -- Siebenlist, U -- Young, H A -- Durum, S K -- 5-T32-CA-09140/CA/NCI NIH HHS/ -- AI-R01-23879/AI/NIAID NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):249-51.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Laboratory of Molecular Immunoregulation, Program Resources Inc., Frederick, MD 21701.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799385" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chloramphenicol O-Acetyltransferase/genetics ; Gene Expression Regulation ; Humans ; Interleukin-1/*physiology ; Interleukin-2/*genetics ; Mice ; Promoter Regions, Genetic/genetics ; Proto-Oncogene Proteins c-jun/*genetics ; Tetradecanoylphorbol Acetate/pharmacology ; Transfection ; Tumor Cells, Cultured
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 84
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-13
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Parker, S T -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2799382" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Hominidae/*psychology ; Humans ; *Sexual Behavior
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 85
    Publication Date: 1989-10-13
    Description: Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein-negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Scharfman, H E -- Schwartzkroin, P A -- NS-01744/NS/NINDS NIH HHS/ -- NS-15317/NS/NINDS NIH HHS/ -- NS-18895/NS/NINDS NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):257-60.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Neurological Surgery, University of Washington, Seattle 98195.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2508225" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Animals ; Calcium/*metabolism ; Calcium-Binding Proteins/metabolism ; Egtazic Acid/pharmacology ; Electric Stimulation ; Female ; Hippocampus/cytology/drug effects/*physiology ; In Vitro Techniques ; Neurons/drug effects/physiology ; Rats ; Rats, Inbred Strains
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 86
    Publication Date: 1989-10-13
    Description: The beta-adrenergic receptor kinase (beta-ARK), which specifically phosphorylates only the agonist-occupied form of the beta-adrenergic and closely related receptors, appears to be important in mediating rapid agonist-specific (homologous) desensitization. The structure of this enzyme was elucidated by isolating clones from a bovine brain complementary DNA library through the use of oligonucleotide probes derived from partial amino acid sequence. The beta-ARK cDNA codes for a protein of 689 amino acids (79.7 kilodaltons) with a protein kinase catalytic domain that bears greatest sequence similarity to protein kinase C and the cyclic adenosine monophosphate (cyclic AMP)--dependent protein kinase. When this clone was inserted into a mammalian expression vector and transfected into COS-7 cells, a protein that specifically phosphorylated the agonist-occupied form of the beta 2-adrenergic receptor and phosphorylated, much more weakly, the light-bleached form of rhodopsin was expressed. RNA blot analysis revealed a messenger RNA of four kilobases with highest amounts in brain and spleen. Genomic DNA blot analysis also suggests that beta-ARK may be the first sequenced member of a multigene family of receptor kinases.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Benovic, J L -- DeBlasi, A -- Stone, W C -- Caron, M G -- Lefkowitz, R J -- New York, N.Y. -- Science. 1989 Oct 13;246(4927):235-40.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Department of Medicine, Duke University Medical Center, Durham, NC 27710.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2552582" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Cattle ; Cloning, Molecular ; *Cyclic AMP-Dependent Protein Kinases ; Molecular Sequence Data ; Multigene Family/*genetics ; Organ Specificity ; Phosphorylation ; Protein Kinases/biosynthesis/*genetics/physiology ; Receptors, Adrenergic, beta/metabolism ; Sequence Homology, Nucleic Acid ; Substrate Specificity ; beta-Adrenergic Receptor Kinases
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 87
    Publication Date: 1989-10-06
    Description: The tyrosine kinase pp60v-src, encoded by the v-src oncogene, seems to regulate phosphatidylinositol metabolism. The effect of pp60v-src on control points in inositol phosphate production was examined by measuring the amounts of inositol polyphosphates in Rat-1 cells expressing wild-type or mutant forms of the protein. Expression of v-src-resulted in a five- to sevenfold elevation in the steady-state amount of an isomer of inositol tetrakisphosphate, whereas the concentrations of inositol trisphosphates or other inositol tetrakisphosphates were not affected. The activity of a key enzyme in the formation of inositol tetrakisphosphates, inositol (1,4,5)-trisphosphate 3-kinase, was increased six- to eightfold in cytosolic extracts prepared from the v-src-transformed cells, suggesting that this enzyme may be one target for the pp60v-src kinase and that it may participate in the synthesis of novel, higher order inositol phosphates.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Johnson, R M -- Wasilenko, W J -- Mattingly, R R -- Weber, M J -- Garrison, J C -- CA-39076/CA/NCI NIH HHS/ -- CA-40042/CA/NCI NIH HHS/ -- DK-19952/DK/NIDDK NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):121-4.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pharmacology, University of Virginia School of Medicine, Charlottesville 22908.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506643" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Cell Line, Transformed ; Fibroblasts/metabolism ; Inositol Phosphates/*metabolism ; Isomerism ; Oncogene Protein pp60(v-src) ; Protein-Tyrosine Kinases/metabolism ; Rats ; Retroviridae Proteins/*physiology ; Sugar Phosphates/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 88
    Publication Date: 1989-10-06
    Description: For the IIIB isolate of human immunodeficiency virus type-1 (HIV-1), the immunodominant determinant of the envelope protein gp160 for cytotoxic T lymphocytes (CTLs) of H-2d mice is in a region of high sequence variability among HIV-1 isolates. The general requirements for CTL recognition of peptide antigens and the relation of recognition requirements to the natural variation in sequence of the HIV were investigated. For this purpose, a CTL line specific for the homologous segment of the envelope from the MN isolate of HIV-1 and restricted by the same class I major histocompatibility (MHC) molecule (Dd) as the IIIB-specific CTLs was raised from mice immunized with MN-env-recombinant vaccinia virus. The IIIB-specific and MN-specific CTLs were completely non-cross-reactive. Reciprocal exchange of a single amino acid between the two peptide sequences, which differed in 6 of 15 residues, led to a complete reversal of the specificity of the peptides in sensitizing targets, such that the IIIB-specific CTLs lysed targets exposed to the singly substituted MN peptide and vice versa. These data indicate the importance of single residues in defining peptide epitopic specificity and have implications for both the effect of immune pressure on selection of viral mutants and the design of effective vaccines.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Takahashi, H -- Merli, S -- Putney, S D -- Houghten, R -- Moss, B -- Germain, R N -- Berzofsky, J A -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):118-21.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Metabolism Branch, National Cancer Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2789433" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Genes, MHC Class I ; HIV Envelope Protein gp160 ; HIV-1/*immunology ; Mice ; Mice, Inbred BALB C ; Mice, Inbred C3H ; Mice, Inbred C57BL ; Molecular Sequence Data ; Retroviridae Proteins/*immunology ; T-Lymphocytes, Cytotoxic/*immunology ; Viral Envelope Proteins/*immunology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 89
    Publication Date: 1989-10-06
    Description: Embryos of the shrimp Palaemon macrodactylus are remarkably resistant to infection by the fungus Lagenidium callinectes, a recognized pathogen of many crustaceans. An Alteromonas sp. bacterial strain consistently isolated from the surface of the embryos, produces 2,3-indolinedione (isatin), a compound that inhibits the pathogenic fungus. If exposed to the fungus, bacteria-free embryos quickly die, whereas similar embryos reinoculated with the bacteria or treated only with 2,3-indolinedione live well. The commensal Alteromonas sp. bacteria protect shrimp embryos from fungal infection by producing and liberating the antifungal metabolite 2,3-indolinedione.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gil-Turnes, M S -- Hay, M E -- Fenical, W -- CA44848/CA/NCI NIH HHS/ -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):116-8.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Scripps Institution of Oceanography, University of California, San Diego, La Jolla 92093-0228.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781297" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Bacteria/metabolism ; Bacterial Physiological Phenomena ; Chytridiomycota/*physiology ; Decapoda (Crustacea)/embryology/*microbiology ; Isatin/metabolism ; Oomycetes/*physiology ; *Symbiosis ; *Water Microbiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 90
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-10-06
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Cherfas, J -- New York, N.Y. -- Science. 1989 Oct 6;246(4926):23-4.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781299" target="_blank"〉PubMed〈/a〉
    Keywords: Acquired Immunodeficiency Syndrome/*prevention & control ; Animals ; HIV/genetics ; Humans ; Research ; *Viral Vaccines
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 91
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: The CA1 pyramidal neurons in the hippocampus contain a high density of adrenal corticosteroid receptors. By intracellular recording, CA1 neurons in slices from adrenalectomized rats have been found to display a markedly reduced afterhyperpolarization (that is, the hyperpolarizing phase after a brief depolarizing current pulse) when compared with their sham controls. No differences were found for other tested membrane properties. Brief exposure of hippocampal slices from adrenalectomized rats to glucocorticoid agonists, 30 to 90 minutes before recording, greatly enhanced the afterhyperpolarization. In addition, glucocorticoids attenuated the norepinephrine-induced blockade of action potential accommodation in CA1 neurons. The findings indicate that glucocorticoids can reduce transmitter-evoked excitability in the hippocampus, presumably via a receptor-mediated genomic action.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Joels, M -- de Kloet, E R -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1502-5.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Division of Molecular Neurobiology, University of Utrecht, The Netherlands.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781292" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenalectomy ; Animals ; Glucocorticoids/*pharmacology ; Hippocampus/cytology/*drug effects ; In Vitro Techniques ; Membrane Potentials/drug effects ; Neurons/cytology/drug effects ; Norepinephrine/*pharmacology ; Rats
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 92
    Publication Date: 1989-09-29
    Description: Adrenal steroids bind specifically to hippocampal neurons under normal conditions and may contribute to hippocampal cell loss during aging, but little is known about the neurophysiological mechanisms by which they may change hippocampal cell functions. In the present studies, adrenal steroids have been shown to modulate a well-defined membrane conductance in hippocampal pyramidal cells. The calcium-dependent slow afterhyperpolarization is reduced in hippocampal slices from adrenalectomized rats, and it is increased after in vivo or in vitro administration of the adrenal steroid, corticosterone. Calcium action potentials are also reduced in adrenalectomized animals, indicating that the primary effect of corticosteroids may be on calcium conductance. The afterhyperpolarization component reduced by adrenalectomy is greater in aged rats than in young rats, suggesting that, with aging, there is an increased effect of corticosteroids on some calcium-mediated brain processes. Because elevated concentrations of intracellular calcium can be cytotoxic, these observations may increase the understanding of glucocorticoid involvement in brain aging as well as of the normal functions of these steroids in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Kerr, D S -- Campbell, L W -- Hao, S Y -- Landfield, P W -- AG04542/AG/NIA NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1505-9.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Physiology and Pharmacology, Bowman Gray School of Medicine, Winston-Salem, NC 27103.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781293" target="_blank"〉PubMed〈/a〉
    Keywords: Action Potentials/drug effects ; Adrenal Cortex Hormones/*pharmacology ; Adrenalectomy ; Aging/*physiology ; Animals ; Calcium/metabolism ; Hippocampus/*drug effects ; In Vitro Techniques ; Male ; Neurons/drug effects ; Rats ; Rats, Inbred F344 ; Tetrodotoxin/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 93
    Publication Date: 1989-09-29
    Description: Clinical observations show that there is considerable individual variability in the response to the addictive properties of drugs. This individual variability needs to be taken into account in animal models of addiction. Like humans, only some rats readily self-administer low doses of psychostimulants. The individual animals at risk can be identified on the basis of their response to environmental or pharmacological challenges. This predisposition to develop self-administration can be induced by repeated treatment with amphetamine. These results may help elucidate the neurobiological basis of addiction liability observed in both rats and humans.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Piazza, P V -- Deminiere, J M -- Le Moal, M -- Simon, H -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1511-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉INSERM U.259, Universite de Bordeaux II, France.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781295" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Dextroamphetamine/pharmacology ; Male ; Motor Activity/drug effects ; Rats ; Rats, Inbred Strains ; Risk Factors ; Self Administration ; Substance-Related Disorders/*etiology/psychology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 94
    Publication Date: 1989-09-29
    Description: Synapsins are neuronal phosphoproteins that coat synaptic vesicles, bind to the cytoskeleton, and are believed to function in the regulation of neurotransmitter release. Molecular cloning reveals that the synapsins comprise a family of four homologous proteins whose messenger RNA's are generated by differential splicing of transcripts from two genes. Each synapsin is a mosaic composed of homologous amino-terminal domains common to all synapsins and different combinations of distinct carboxyl-terminal domains. Immunocytochemical studies demonstrate that all four synapsins are widely distributed in nerve terminals, but that their relative amounts vary among different kinds of synapses. The structural diversity and differential distribution of the four synapsins suggest common and different roles of each in the integration of distinct signal transduction pathways that modulate neurotransmitter release in various types of neurons.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Sudhof, T C -- Czernik, A J -- Kao, H T -- Takei, K -- Johnston, P A -- Horiuchi, A -- Kanazir, S D -- Wagner, M A -- Perin, M S -- De Camilli, P -- AA 06944/AA/NIAAA NIH HHS/ -- MH 39327/MH/NIMH NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1474-80.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Howard Hughes Medical Institute, Dallas, TX.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2506642" target="_blank"〉PubMed〈/a〉
    Keywords: Amino Acid Sequence ; Animals ; Base Sequence ; Molecular Sequence Data ; Nerve Tissue Proteins/*genetics ; Neuropeptides/*genetics ; Phosphoproteins/*genetics ; Sequence Homology, Nucleic Acid ; Structure-Activity Relationship ; Synapsins ; Synaptic Vesicles/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 95
    Publication Date: 1989-09-29
    Description: Human malignant cells secrete low molecular size proteins that attract peripheral blood monocytes and may be responsible for the accumulation of tumor-associated macrophages observed in vivo. Similar chemotactic proteins are secreted by cultured vascular smooth muscle cells. The predominant monocyte chemoattractants produced by tumor cells of differing origin were demonstrated to be related to smooth muscle cell-derived chemotactic factor. Thus, a single class of chemotactic proteins is produced by different cell types, which suggests a common mechanism for the recruitment of monocytes and macrophages. These results are significant in view of the potential of macrophages to affect tumor growth.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Graves, D T -- Jiang, Y L -- Williamson, M J -- Valente, A J -- DE-07559/DE/NIDCR NIH HHS/ -- DE-08569/DE/NIDCR NIH HHS/ -- HL-38390/HL/NHLBI NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1490-3.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Oral Biology, Boston University Medical Center, MA 02118.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781291" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Chemotactic Factors/*biosynthesis ; *Chemotaxis, Leukocyte ; Humans ; Monocytes/*cytology ; Muscle, Smooth, Vascular/*metabolism ; Papio ; Precipitin Tests ; Tumor Cells, Cultured/*metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 96
    Publication Date: 1989-09-29
    Description: The signals that direct membrane proteins to the apical or basolateral plasma membrane domains of polarized epithelial cells are not known. Several of the class of proteins anchored in the membrane by glycosyl-phosphatidylinositol (GPI) are expressed on the apical surface of such cells. However, it is not known whether the mechanism of membrane anchorage or the polypeptide sequence provides the sorting information. The conversion of the normally basolateral vesicular stomatitis virus glycoprotein (VSV G) to a GPI-anchored protein led to its apical expression. Conversely, replacement of the GPI anchor of placental alkaline phosphatase with the transmembrane and cytoplasmic domains of VSV G shifted its expression from the apical to the basolateral surface. Thus, the mechanism of membrane anchorage can determine the sorting of proteins to the apical or basolateral surface, and the GPI anchor itself may provide an apical transport signal.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Brown, D A -- Crise, B -- Rose, J K -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1499-501.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Pathology, Yale University School of Medicine, New Haven, CT 06510.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2571189" target="_blank"〉PubMed〈/a〉
    Keywords: Alkaline Phosphatase/metabolism ; Animals ; Antigens, Surface/metabolism ; Antigens, Thy-1 ; Biological Transport ; Cell Line ; Glycolipids/*physiology ; Glycosylphosphatidylinositols ; Isoenzymes/metabolism ; *Membrane Glycoproteins ; Membrane Proteins/*metabolism ; Phosphatidylinositols/*physiology ; Viral Envelope Proteins/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 97
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: Exogenous cholecystokinin (CCK) decreases food intake and causes satiety in animals and man. However, it has not been established that endogenous CCK causes satiety or whether the response is mediated by peripheral-type (CCK-A) or brain-type (CCK-B) receptors. The development of potent and selective antagonists for CCK-A (MK-329) and CCK-B (L-365,260) receptors now allows these issues to be addressed. The CCK-A antagonist MK-329 and the CCK-B antagonist L-365,260 increased food intake in partially satiated rats and postponed the onset of satiety; however, L-365,260 was 100 times more potent than MK-329 in increasing feeding and preventing satiety. These results suggest that endogenous CCK causes satiety by an agonist action on CCK-B receptors in the brain.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dourish, C T -- Rycroft, W -- Iversen, S D -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1509-11.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Merck Sharp & Dohme Research Laboratories, Neuroscience Research Center, Terlings Park, Harlow, Essex, England.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781294" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Benzodiazepines/pharmacology ; Benzodiazepinones/pharmacology ; Brain/drug effects/*physiology ; Cholecystokinin/antagonists & inhibitors/*physiology ; Devazepide ; Male ; *Phenylurea Compounds ; Rats ; Rats, Inbred Strains ; Receptors, Cholecystokinin/drug effects/*physiology ; Satiation/*physiology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 98
    Publication Date: 1989-09-29
    Description: Autocrine growth due to dysregulated growth factor production may have a role in the development of neoplasia. Whether autocrine growth is stimulated by growth factor secretion in an autocrine loop or by intracellular binding of the growth factor to a receptor has been unclear. The carboxyl-terminus coding sequence for murine interleukin-3 (IL-3) was extended with an oligonucleotide encoding a four-amino acid endoplasmic reticulum retention signal. IL-3-dependent hematopoietic cells became growth factor-independent when the modified IL-3 gene was introduced by retroviral gene transfer, despite lack of secretion of the modified IL-3. Hence autocrine growth can occur as a result of the intracellular action of a growth factor and this mechanism may be important in neoplastic and normal cells.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Dunbar, C E -- Browder, T M -- Abrams, J S -- Nienhuis, A W -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1493-6.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Clinical Hematology Branch, National Heart, Lung, and Blood Institute, Bethesda, MD 20892.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2789432" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Cell Division/drug effects ; Cell Transformation, Neoplastic ; Cells, Cultured ; Clone Cells ; Interleukin-3/genetics/metabolism/*physiology ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Recombinant Fusion Proteins/pharmacology
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 99
    Publication Date: 1989-09-29
    Description: Proteins from Drosophila nuclei that bind to regions of alternating C and T residues present in the promoters of the heat shock genes hsp70 and hsp26 and the histone genes his3 and his4 have been purified. These proteins bind to isolated linear DNA, and genomic footprinting analyses indicate that they are bound to DNA in nuclei. In supercoiled plasmids at low pH, some of these DNA sequences adopt triple-helical structures which, if they form in vivo, could significantly affect chromatin structure. The nuclear proteins described here, and not necessarily the deformed conformation of the DNA, may be responsible for maintaining a potentially inducible promoter structure before transcriptional activation.〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Gilmour, D S -- Thomas, G H -- Elgin, S C -- F32 GM107982/GM/NIGMS NIH HHS/ -- GM31532/GM/NIGMS NIH HHS/ -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1487-90.〈br /〉〈span class="detail_caption"〉Author address: 〈/span〉Department of Biology, Washington University, St. Louis, MO 63130.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781290" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; Base Sequence ; Cytosine/metabolism ; DNA-Binding Proteins/*metabolism ; Deoxyribonuclease I ; Drosophila/genetics/metabolism ; Molecular Sequence Data ; Nuclear Proteins/*metabolism ; *Promoter Regions, Genetic ; Thymine/metabolism
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
  • 100
    facet.materialart.
    Unknown
    American Association for the Advancement of Science (AAAS)
    Publication Date: 1989-09-29
    Description: 〈br /〉〈span class="detail_caption"〉Notes: 〈/span〉Beeson, P B -- New York, N.Y. -- Science. 1989 Sep 29;245(4925):1437.〈br /〉〈span class="detail_caption"〉Record origin:〈/span〉 〈a href="http://www.ncbi.nlm.nih.gov/pubmed/2781287" target="_blank"〉PubMed〈/a〉
    Keywords: Animals ; *Animals, Laboratory ; Humans ; *Research Design
    Print ISSN: 0036-8075
    Electronic ISSN: 1095-9203
    Topics: Biology , Chemistry and Pharmacology , Computer Science , Medicine , Natural Sciences in General , Physics
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...