ALBERT

All Library Books, journals and Electronic Records Telegrafenberg

feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    ISSN: 1617-4623
    Keywords: Nucleotide sequence of pRAT11 ; Low copy number plasmid ; Bacillus subtilis ; RepA protein ; Direct repeat
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of therepA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted intrans on DNA. The part of therepA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of theEscherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy numberBacillus plasmid is discussed.
    Type of Medium: Electronic Resource
    Location Call Number Expected Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...